Starting /dee2/code/volunteer_pipeline.sh SRR3207893 current disk space = 3050335354880 free memory = 1580120332 SRR3207893 SRAfilesize bd6afbc4dbe7699dddc8489020de29cb SRR3207893.sra SRR3207893.sra file validated SRR3207893 is single end SRR3207893 is conventional basespace SRR3207893 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207893_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.735 34.0 31.0 34.0 31.0 34.0 2 32.866 34.0 31.0 34.0 31.0 34.0 3 32.79825 34.0 31.0 34.0 31.0 34.0 4 36.18475 37.0 37.0 37.0 35.0 37.0 5 36.1535 37.0 37.0 37.0 35.0 37.0 6 36.18625 37.0 37.0 37.0 35.0 37.0 7 36.12675 37.0 37.0 37.0 35.0 37.0 8 36.164 37.0 37.0 37.0 35.0 37.0 9 37.975 39.0 38.0 39.0 35.0 39.0 10-11 38.023250000000004 39.0 39.0 39.0 35.0 39.0 12-13 38.006375 39.0 39.0 39.0 35.0 39.0 14-15 39.466 41.0 39.0 41.0 36.5 41.0 16-17 39.416125 41.0 39.0 41.0 36.0 41.0 18-19 39.396874999999994 41.0 39.5 41.0 36.5 41.0 20-21 39.397625000000005 41.0 39.5 41.0 36.5 41.0 22-23 39.38225 41.0 39.0 41.0 36.5 41.0 24-25 39.103875 41.0 39.0 41.0 36.0 41.0 26-27 39.240625 41.0 39.0 41.0 36.0 41.0 28-29 39.15675 40.5 39.0 41.0 36.0 41.0 30-31 38.964375000000004 40.0 39.0 41.0 35.5 41.0 32-33 38.926625 40.0 39.0 41.0 35.0 41.0 34-35 38.89375 40.0 39.0 41.0 35.0 41.0 36-37 38.726875 40.0 38.0 41.0 35.0 41.0 38-39 38.693749999999994 40.0 38.0 41.0 35.0 41.0 40-41 38.549375 40.0 38.0 41.0 34.5 41.0 42-43 38.388125 40.0 38.0 41.0 34.0 41.0 44-45 38.166124999999994 40.0 38.0 41.0 33.0 41.0 46-47 38.036249999999995 40.0 38.0 41.0 33.0 41.0 48-49 37.9905 40.0 38.0 41.0 33.0 41.0 50-51 37.956375 40.0 38.0 41.0 33.0 41.0 52-53 37.806625 40.0 37.5 41.0 32.5 41.0 54-55 37.6915 40.0 37.0 41.0 33.0 41.0 56-57 37.547375 40.0 37.0 41.0 32.5 41.0 58-59 37.352875 39.0 36.5 41.0 32.0 41.0 60-61 37.35775 39.0 36.5 41.0 32.0 41.0 62-63 37.454375 39.0 36.0 41.0 32.5 41.0 64-65 37.247749999999996 39.0 36.0 41.0 32.5 41.0 66-67 36.86925 39.0 35.0 40.5 32.0 41.0 68-69 36.57575 38.0 35.0 40.0 32.0 41.0 70-71 36.167125 37.0 35.0 39.5 31.5 41.0 72-73 35.701625 37.0 35.0 39.0 31.0 41.0 74-75 35.123125 36.0 34.5 38.5 30.5 40.0 76-77 33.453 34.5 32.5 36.5 28.0 39.0 78-79 34.278375 35.0 34.0 37.0 30.0 39.0 80-81 34.15675 35.0 34.0 36.5 30.5 38.5 82-83 33.750875 35.0 34.0 36.0 30.0 37.0 84-85 33.478750000000005 35.0 34.0 36.0 30.0 37.0 86-87 33.329875 35.0 34.0 35.5 29.5 36.5 88-89 33.163375 35.0 34.0 35.0 30.0 36.0 90-91 33.019999999999996 35.0 34.0 35.0 29.5 36.0 92-93 32.817750000000004 35.0 34.0 35.0 29.0 36.0 94-95 32.727374999999995 35.0 34.0 35.0 29.0 35.5 96-97 32.607 35.0 34.0 35.0 29.0 35.0 98-99 32.356875 35.0 34.0 35.0 29.0 35.0 100 32.02925 35.0 34.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 3.0 11 3.0 12 2.0 13 1.0 14 5.0 15 4.0 16 7.0 17 6.0 18 6.0 19 6.0 20 4.0 21 6.0 22 7.0 23 8.0 24 10.0 25 12.0 26 25.0 27 23.0 28 25.0 29 35.0 30 46.0 31 61.0 32 83.0 33 124.0 34 163.0 35 220.0 36 369.0 37 885.0 38 1497.0 39 346.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.675 15.0 18.0 42.325 2 21.025 24.025 35.975 18.975 3 22.95 27.675 26.950000000000003 22.425 4 24.5 32.375 20.150000000000002 22.975 5 24.39329497122842 35.92694520890668 22.241681260945708 17.43807855891919 6 18.224999999999998 37.8 24.25 19.725 7 16.6 17.075000000000003 45.35 20.974999999999998 8 19.1 21.5 30.725 28.675 9 19.25 22.6 32.45 25.7 10-11 21.875 33.5875 22.775000000000002 21.762500000000003 12-13 19.787499999999998 25.974999999999998 31.025000000000002 23.2125 14-15 21.1375 27.175 28.475 23.2125 16-17 21.4125 27.237499999999997 28.825 22.525000000000002 18-19 21.775 28.349999999999998 27.05 22.825 20-21 21.762500000000003 28.225 28.3875 21.625 22-23 21.837500000000002 28.199999999999996 28.125 21.837500000000002 24-25 21.40077821011673 28.367013932471448 28.291703276013557 21.94050458139827 26-27 21.5375 27.3625 28.425 22.675 28-29 22.0625 28.975 27.575 21.3875 30-31 21.925 27.8625 27.9125 22.3 32-33 21.975 28.0875 27.9125 22.025 34-35 21.224999999999998 28.675 27.4125 22.6875 36-37 22.55 27.650000000000002 27.962500000000002 21.837500000000002 38-39 21.4375 27.950000000000003 27.975 22.6375 40-41 21.85 27.6375 28.3375 22.175 42-43 21.7875 28.1125 27.800000000000004 22.3 44-45 22.575 28.3375 27.250000000000004 21.837500000000002 46-47 21.76088044022011 27.75137568784392 28.27663831915958 22.211105552776388 48-49 22.251572327044027 27.69811320754717 26.893081761006286 23.157232704402517 50-51 21.63147310206134 28.97184514831574 27.51382604323781 21.88285570638512 52-53 22.726704190118824 28.455284552845526 27.166979362101312 21.651031894934334 54-55 21.2375 28.549999999999997 27.900000000000002 22.3125 56-57 21.1625 28.3375 28.375 22.125 58-59 21.349999999999998 28.0875 28.4375 22.125 60-61 21.55 28.225 27.275 22.95 62-63 21.987499999999997 28.849999999999998 28.075 21.087500000000002 64-65 21.987499999999997 29.425 27.6125 20.974999999999998 66-67 22.0125 28.15 28.349999999999998 21.4875 68-69 21.2 28.475 28.012500000000003 22.3125 70-71 21.762500000000003 28.1125 26.924999999999997 23.200000000000003 72-73 21.3875 28.6625 28.787499999999998 21.1625 74-75 22.3625 27.425 28.499999999999996 21.712500000000002 76-77 21.75 27.825 28.1875 22.237499999999997 78-79 21.275 29.9375 27.3625 21.425 80-81 21.65 28.025 28.375 21.95 82-83 21.775 28.15 27.825 22.25 84-85 22.175 29.425 26.9125 21.4875 86-87 21.25 28.962500000000002 27.775 22.0125 88-89 22.412499999999998 28.487499999999997 27.187499999999996 21.912499999999998 90-91 22.6375 27.6375 27.900000000000002 21.825 92-93 22.4375 28.65 27.6375 21.275 94-95 22.2125 27.925 27.875 21.987499999999997 96-97 22.425 27.6875 28.225 21.6625 98-99 22.1 28.349999999999998 27.950000000000003 21.6 100 21.975 29.549999999999997 27.425 21.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 1.0 25 4.5 26 7.0 27 9.0 28 11.5 29 15.5 30 21.0 31 25.5 32 38.0 33 57.5 34 63.0 35 70.5 36 96.0 37 119.0 38 125.0 39 159.0 40 205.5 41 226.5 42 243.5 43 251.0 44 253.0 45 272.0 46 261.5 47 235.0 48 220.5 49 190.0 50 177.5 51 153.5 52 112.5 53 80.5 54 63.0 55 53.0 56 37.0 57 29.5 58 24.5 59 17.0 60 13.0 61 8.0 62 6.0 63 8.0 64 5.0 65 3.0 66 3.5 67 2.5 68 4.0 69 3.5 70 2.5 71 2.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.5 77 1.0 78 1.5 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.41250000000000003 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.05 48-49 0.625 50-51 0.5499999999999999 52-53 0.0625 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74931060416145 99.47500000000001 2 0.22562045625470042 0.44999999999999996 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.037500000000000006 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.30000000000000004 0.0 0.0 0.0 0.0 82-83 0.48750000000000004 0.0 0.0 0.0 0.0 84-85 0.6875 0.0 0.0 0.0 0.0 86-87 0.8500000000000001 0.0 0.0 0.0 0.0 88 1.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 791263 spots for SRR3207893.sra Written 791263 spots for SRR3207893.sra Read 791263 spots for SRR3207893.sra Written 791263 spots for SRR3207893.sra Read 791263 spots for SRR3207893.sra Written 791263 spots for SRR3207893.sra Read 791263 spots for SRR3207893.sra Written 791263 spots for SRR3207893.sra Read 791263 spots for SRR3207893.sra Written 791263 spots for SRR3207893.sra Read 791263 spots for SRR3207893.sra Written 791263 spots for SRR3207893.sra Read 791263 spots for SRR3207893.sra Written 791263 spots for SRR3207893.sra Read 791263 spots for SRR3207893.sra Written 791263 spots for SRR3207893.sra Read 791263 spots for SRR3207893.sra Written 791263 spots for SRR3207893.sra Read 791263 spots for SRR3207893.sra Written 791263 spots for SRR3207893.sra Read 791263 spots for SRR3207893.sra Written 791263 spots for SRR3207893.sra Read 791263 spots for SRR3207893.sra Written 791263 spots for SRR3207893.sra Read 791263 spots for SRR3207893.sra Written 791263 spots for SRR3207893.sra Read 791263 spots for SRR3207893.sra Written 791263 spots for SRR3207893.sra Read 791263 spots for SRR3207893.sra Written 791263 spots for SRR3207893.sra Read 791263 spots for SRR3207893.sra Written 791263 spots for SRR3207893.sra Read 791263 spots for SRR3207893.sra Written 791263 spots for SRR3207893.sra Read 791263 spots for SRR3207893.sra Written 791263 spots for SRR3207893.sra Read 791263 spots for SRR3207893.sra Written 791263 spots for SRR3207893.sra Read 791263 spots for SRR3207893.sra Written 791263 spots for SRR3207893.sra SRR ids: ['SRR3207893.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m5xluo3g SRR3207893.sra spots: 15825260 blocks: [[1, 791263], [791264, 1582526], [1582527, 2373789], [2373790, 3165052], [3165053, 3956315], [3956316, 4747578], [4747579, 5538841], [5538842, 6330104], [6330105, 7121367], [7121368, 7912630], [7912631, 8703893], [8703894, 9495156], [9495157, 10286419], [10286420, 11077682], [11077683, 11868945], [11868946, 12660208], [12660209, 13451471], [13451472, 14242734], [14242735, 15033997], [15033998, 15825260]] SRR3207893 file size 4107522 SRR3207893 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207893 SRR3207893_1.fastq Input file: SRR3207893_1.fastq trimmed: SRR3207893-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 13:21:20 2025 >> started Tue Feb 11 13:21:28 2025 >> done (7.827s) 15825260 reads processed; of these: 2501 ( 0.02%) short reads filtered out after trimming by size control 42444 ( 0.27%) empty reads filtered out after trimming by size control 15780315 (99.72%) reads available; of these: 822795 ( 5.21%) trimmed reads available after processing 14957520 (94.79%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 362 0.00% 19 472 0.00% 20 507 0.00% 21 658 0.00% 22 900 0.01% 23 1157 0.01% 24 1556 0.01% 25 2014 0.01% 26 2142 0.01% 27 2029 0.01% 28 1963 0.01% 29 2126 0.01% 30 2214 0.01% 31 2177 0.01% 32 2304 0.01% 33 2368 0.02% 34 2524 0.02% 35 2565 0.02% 36 2744 0.02% 37 2808 0.02% 38 2961 0.02% 39 3112 0.02% 40 3181 0.02% 41 3394 0.02% 42 3351 0.02% 43 3427 0.02% 44 3708 0.02% 45 3929 0.02% 46 3934 0.02% 47 3981 0.03% 48 4429 0.03% 49 4299 0.03% 50 4280 0.03% 51 4622 0.03% 52 4592 0.03% 53 5394 0.03% 54 5451 0.03% 55 5885 0.04% 56 5098 0.03% 57 5411 0.03% 58 5548 0.04% 59 5950 0.04% 60 5253 0.03% 61 5818 0.04% 62 5777 0.04% 63 5961 0.04% 64 6597 0.04% 65 6743 0.04% 66 6947 0.04% 67 7483 0.05% 68 8168 0.05% 69 7126 0.05% 70 7072 0.04% 71 7407 0.05% 72 7966 0.05% 73 8188 0.05% 74 8725 0.06% 75 9211 0.06% 76 4924 0.03% 77 5885 0.04% 78 7080 0.04% 79 7568 0.05% 80 8291 0.05% 81 9465 0.06% 82 9620 0.06% 83 10425 0.07% 84 11389 0.07% 85 12241 0.08% 86 13249 0.08% 87 13931 0.09% 88 16120 0.10% 89 16656 0.11% 90 18568 0.12% 91 20972 0.13% 92 24961 0.16% 93 27931 0.18% 94 32756 0.21% 95 39095 0.25% 96 47283 0.30% 97 59824 0.38% 98 74143 0.47% 99 84449 0.54% 100 14957520 94.79% 15780315 reads passed initial QC criterion=sequence-density sequence-density=0.94 sequence-density-rank=1 fanout-score=59.90 fanout-score-rank=9 prefix-density=1.35 prefix-fanout=41.7 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=13 fanout-score=304.11 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=28.7 sequence=TTCTTCTTCTTC Started job on | Feb 11 13:21:46 Started mapping on | Feb 11 13:21:46 Finished on | Feb 11 13:22:04 Mapping speed, Million of reads per hour | 3156.06 Number of input reads | 15780315 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 14950062 Uniquely mapped reads % | 94.74% Average mapped length | 98.51 Number of splices: Total | 4194379 Number of splices: Annotated (sjdb) | 4112489 Number of splices: GT/AG | 4127912 Number of splices: GC/AG | 53521 Number of splices: AT/AC | 4422 Number of splices: Non-canonical | 8524 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.02% Deletion average length | 2.01 Insertion rate per base | 0.01% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 404641 % of reads mapped to multiple loci | 2.56% Number of reads mapped to too many loci | 290705 % of reads mapped to too many loci | 1.84% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.84% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 425612 425612 425612 N_multimapping 404641 404641 404641 N_noFeature 728022 7757589 7826051 N_ambiguous 147921 26835 26885 UnstrandedReadsAssigned:14074119 PositiveStrandReadsAssigned:7165638 NegativeStrandReadsAssigned:7097126 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207893 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207893-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,780,315 reads, 14,648,116 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,223 rounds 52401 SRR3207893.ke.tsv 34699 SRR3207893.se.tsv 87100 total ==> SRR3207893.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 816 41.9997 Potri.005G024800.1.v4.1 1035 936 555 58.5664 Potri.004G059700.1.v4.1 961 862 33 3.78127 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 419.306 14.5624 Potri.016G087400.1.v4.1 270 171 574 331.549 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 54 3.18618 Potri.012G127500.1.v4.1 977 878 1647 185.281 ==> SRR3207893.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 1850 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 218 Potri.001G212900.v4.1 15 Potri.001G182400.v4.1 33 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3207893 completed mapping pipeline successfully