Starting /dee2/code/volunteer_pipeline.sh SRR3207894 current disk space = 3050706886656 free memory = 1145602380 SRR3207894 SRAfilesize a637bac2a3e5b34d1cd5158b4905f43d SRR3207894.sra SRR3207894.sra file validated SRR3207894 is single end SRR3207894 is conventional basespace SRR3207894 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207894_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.61925 34.0 31.0 34.0 31.0 34.0 2 32.803 34.0 31.0 34.0 31.0 34.0 3 32.77675 34.0 31.0 34.0 31.0 34.0 4 36.0715 37.0 37.0 37.0 35.0 37.0 5 36.114 37.0 37.0 37.0 35.0 37.0 6 36.1105 37.0 37.0 37.0 35.0 37.0 7 36.08275 37.0 36.0 37.0 35.0 37.0 8 36.13925 37.0 36.0 37.0 35.0 37.0 9 37.91925 39.0 38.0 39.0 35.0 39.0 10-11 37.978875 39.0 38.0 39.0 35.0 39.0 12-13 37.919124999999994 39.0 38.0 39.0 35.0 39.0 14-15 39.37925 41.0 39.0 41.0 36.0 41.0 16-17 39.39725 41.0 39.0 41.0 36.0 41.0 18-19 39.339 41.0 39.0 41.0 36.0 41.0 20-21 39.345749999999995 41.0 39.0 41.0 36.0 41.0 22-23 39.284 41.0 39.0 41.0 36.0 41.0 24-25 38.945625 41.0 39.0 41.0 36.0 41.0 26-27 39.10525 41.0 39.0 41.0 35.5 41.0 28-29 38.95375 40.0 39.0 41.0 35.5 41.0 30-31 38.84525 40.0 38.5 41.0 35.0 41.0 32-33 38.869625 40.0 38.0 41.0 35.0 41.0 34-35 38.805 40.0 38.0 41.0 35.0 41.0 36-37 38.631375000000006 40.0 38.0 41.0 34.5 41.0 38-39 38.54075 40.0 38.0 41.0 34.5 41.0 40-41 38.462500000000006 40.0 38.0 41.0 34.0 41.0 42-43 38.324124999999995 40.0 38.0 41.0 33.5 41.0 44-45 38.109 40.0 38.0 41.0 33.5 41.0 46-47 37.861875 40.0 38.0 41.0 33.0 41.0 48-49 37.708375 40.0 38.0 41.0 33.0 41.0 50-51 37.60075 40.0 37.5 41.0 32.5 41.0 52-53 37.550375 40.0 37.0 41.0 32.0 41.0 54-55 37.564625 40.0 37.0 41.0 32.0 41.0 56-57 37.533500000000004 39.5 37.0 41.0 32.0 41.0 58-59 37.185125 39.0 36.0 41.0 32.0 41.0 60-61 37.11775 39.0 36.0 41.0 31.5 41.0 62-63 37.292375 39.0 36.0 41.0 32.0 41.0 64-65 37.125125 39.0 36.0 41.0 32.5 41.0 66-67 36.704125000000005 38.5 35.0 40.5 32.0 41.0 68-69 36.373000000000005 37.5 35.0 40.0 31.0 41.0 70-71 35.921 37.0 35.0 39.0 31.0 41.0 72-73 35.517624999999995 36.5 35.0 39.0 31.0 41.0 74-75 34.9255 36.0 34.5 38.5 30.0 39.5 76-77 33.235 34.5 32.0 36.5 27.5 39.0 78-79 34.135999999999996 35.0 34.0 37.0 30.0 39.0 80-81 33.8845 35.0 34.0 36.5 30.0 38.0 82-83 33.542500000000004 35.0 34.0 36.0 29.5 37.0 84-85 33.326375 35.0 34.0 36.0 29.0 37.0 86-87 33.281 35.0 34.0 35.0 30.0 36.5 88-89 33.079625 35.0 34.0 35.0 29.5 36.0 90-91 32.872125 35.0 34.0 35.0 29.0 36.0 92-93 32.602625 35.0 33.0 35.0 29.0 36.0 94-95 32.566374999999994 35.0 33.5 35.0 29.0 35.0 96-97 32.457750000000004 35.0 33.5 35.0 29.0 35.0 98-99 32.177125000000004 35.0 33.0 35.0 29.0 35.0 100 31.85 35.0 33.0 35.0 27.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 2.0 11 3.0 12 2.0 13 4.0 14 7.0 15 3.0 16 7.0 17 4.0 18 5.0 19 5.0 20 6.0 21 3.0 22 9.0 23 12.0 24 12.0 25 15.0 26 14.0 27 16.0 28 34.0 29 39.0 30 47.0 31 83.0 32 93.0 33 125.0 34 167.0 35 273.0 36 407.0 37 959.0 38 1347.0 39 292.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.75 15.049999999999999 18.224999999999998 40.975 2 19.575 22.975 37.15 20.3 3 22.225 27.150000000000002 27.400000000000002 23.225 4 24.5 32.45 20.3 22.75 5 24.418313735301474 35.876907680760574 21.66624968726545 18.038528896672503 6 17.025000000000002 38.4 24.6 19.975 7 16.975 17.925 46.0 19.1 8 20.125 21.125 29.549999999999997 29.2 9 19.25 24.0 30.975 25.775 10-11 22.3625 32.1625 23.599999999999998 21.875 12-13 20.6125 26.275 29.6625 23.45 14-15 21.3125 26.5875 29.125 22.975 16-17 22.5875 27.1375 27.3375 22.9375 18-19 22.3875 28.4375 27.55 21.625 20-21 21.7375 29.4375 27.237499999999997 21.587500000000002 22-23 21.6125 28.925 27.237499999999997 22.225 24-25 21.328803322008305 28.400654334969172 28.438404429344406 21.832137913678118 26-27 22.6125 27.875 28.125 21.3875 28-29 21.337500000000002 28.549999999999997 27.6375 22.475 30-31 21.087500000000002 28.7 28.175 22.037499999999998 32-33 22.45 27.775 27.487499999999997 22.287499999999998 34-35 22.112499999999997 27.875 27.875 22.1375 36-37 22.475 27.575 28.475 21.475 38-39 22.0 28.599999999999998 27.1 22.3 40-41 22.925 28.037499999999998 27.0125 22.025 42-43 22.0875 28.025 28.349999999999998 21.5375 44-45 21.9 28.1 27.9125 22.0875 46-47 22.768192048012004 27.494373593398347 27.60690172543136 22.13053263315829 48-49 21.539628365566934 28.15067627354317 27.594488686638858 22.715206674251043 50-51 22.487072770841216 27.859755328540796 27.75885988144785 21.894312019170133 52-53 22.433412529698636 28.160560210078778 27.335250719019633 22.070776541202953 54-55 21.912499999999998 29.062500000000004 26.8 22.225 56-57 21.8 27.437499999999996 28.5875 22.175 58-59 22.525000000000002 27.700000000000003 28.037499999999998 21.7375 60-61 21.7375 27.3875 28.487499999999997 22.3875 62-63 21.637500000000003 27.825 28.175 22.3625 64-65 22.162499999999998 27.987499999999997 28.462500000000002 21.3875 66-67 22.777847230903863 27.29091136392049 27.640955119389925 22.290286285785722 68-69 21.85 28.462500000000002 27.725 21.9625 70-71 22.7625 28.6375 27.224999999999998 21.375 72-73 21.827728466058257 27.84098012251531 28.103512939117394 22.22777847230904 74-75 21.6875 28.599999999999998 28.0625 21.65 76-77 21.512500000000003 28.375 27.500000000000004 22.6125 78-79 22.55 27.325 27.425 22.7 80-81 21.837500000000002 28.262500000000003 27.950000000000003 21.95 82-83 21.4125 28.375 28.549999999999997 21.6625 84-85 21.837500000000002 28.525 27.187499999999996 22.45 86-87 22.7125 27.224999999999998 28.5875 21.475 88-89 23.175 27.462500000000002 27.250000000000004 22.112499999999997 90-91 22.75 28.3125 27.474999999999998 21.462500000000002 92-93 22.4875 28.8625 27.775 20.875 94-95 22.15 28.3625 27.762500000000003 21.725 96-97 23.175 27.55 27.462500000000002 21.8125 98-99 22.1375 28.487499999999997 27.237499999999997 22.1375 100 22.280570142535634 28.432108027006752 27.306826706676667 21.980495123780948 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.5 19 1.0 20 0.5 21 0.5 22 0.5 23 0.5 24 0.5 25 2.0 26 4.0 27 5.0 28 6.5 29 9.0 30 16.0 31 25.5 32 31.5 33 38.5 34 56.5 35 74.0 36 93.5 37 119.5 38 140.0 39 166.0 40 214.0 41 235.0 42 225.0 43 257.0 44 286.5 45 269.5 46 246.0 47 234.0 48 219.0 49 196.0 50 171.0 51 142.0 52 108.0 53 81.0 54 66.5 55 47.0 56 37.5 57 36.0 58 24.5 59 17.0 60 12.5 61 12.0 62 15.5 63 14.0 64 8.0 65 3.5 66 2.5 67 1.5 68 1.5 69 3.0 70 3.0 71 2.5 72 2.5 73 2.5 74 2.0 75 1.5 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 1.5 83 1.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.6625 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.025 48-49 1.1125 50-51 0.8875 52-53 0.0375 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0125 68-69 0.0 70-71 0.0 72-73 0.0125 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.025 0.0 0.0 0.0 8 0.0 0.025 0.0 0.0 0.0 9 0.0 0.025 0.0 0.0 0.0 10-11 0.0 0.025 0.0 0.0 0.0 12-13 0.0 0.025 0.0 0.0 0.0 14-15 0.0 0.025 0.0 0.0 0.0 16-17 0.0 0.025 0.0 0.0 0.0 18-19 0.0 0.025 0.0 0.0 0.0 20-21 0.0 0.025 0.0 0.0 0.0 22-23 0.0 0.025 0.0 0.0 0.0 24-25 0.0 0.025 0.0 0.0 0.0 26-27 0.0 0.025 0.0 0.0 0.0 28-29 0.0 0.025 0.0 0.0 0.0 30-31 0.0 0.025 0.0 0.0 0.0 32-33 0.0 0.025 0.0 0.0 0.0 34-35 0.0 0.025 0.0 0.0 0.0 36-37 0.0 0.025 0.0 0.0 0.0 38-39 0.0 0.025 0.0 0.0 0.0 40-41 0.0 0.025 0.0 0.0 0.0 42-43 0.0 0.025 0.0 0.0 0.0 44-45 0.0 0.025 0.0 0.0 0.0 46-47 0.0 0.025 0.0 0.0 0.0 48-49 0.0 0.025 0.0 0.0 0.0 50-51 0.0 0.025 0.0 0.0 0.0 52-53 0.0 0.025 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.025 0.025 0.0 0.0 0.0 62-63 0.025 0.025 0.0 0.0 0.0 64-65 0.025 0.025 0.0 0.0 0.0 66-67 0.025 0.025 0.0 0.0 0.0 68-69 0.037500000000000006 0.025 0.0 0.0 0.0 70-71 0.075 0.025 0.0 0.0 0.0 72-73 0.075 0.025 0.0 0.0 0.0 74-75 0.1 0.025 0.0 0.0 0.0 76-77 0.1 0.025 0.0 0.0 0.0 78-79 0.1375 0.025 0.0 0.0 0.0 80-81 0.1875 0.025 0.0 0.0 0.0 82-83 0.3625 0.025 0.0 0.0 0.0 84-85 0.5249999999999999 0.025 0.0 0.0 0.0 86-87 0.6875 0.025 0.0 0.0 0.0 88 0.9 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1186115 spots for SRR3207894.sra Written 1186115 spots for SRR3207894.sra Read 1186115 spots for SRR3207894.sra Written 1186115 spots for SRR3207894.sra Read 1186115 spots for SRR3207894.sra Written 1186115 spots for SRR3207894.sra Read 1186115 spots for SRR3207894.sra Written 1186115 spots for SRR3207894.sra Read 1186116 spots for SRR3207894.sra Written 1186116 spots for SRR3207894.sra Read 1186115 spots for SRR3207894.sra Written 1186115 spots for SRR3207894.sra Read 1186115 spots for SRR3207894.sra Written 1186115 spots for SRR3207894.sra Read 1186115 spots for SRR3207894.sra Written 1186115 spots for SRR3207894.sra Read 1186115 spots for SRR3207894.sra Written 1186115 spots for SRR3207894.sra Read 1186115 spots for SRR3207894.sra Written 1186115 spots for SRR3207894.sra Read 1186115 spots for SRR3207894.sra Written 1186115 spots for SRR3207894.sra Read 1186115 spots for SRR3207894.sra Written 1186115 spots for SRR3207894.sra Read 1186115 spots for SRR3207894.sra Written 1186115 spots for SRR3207894.sra Read 1186115 spots for SRR3207894.sra Written 1186115 spots for SRR3207894.sra Read 1186115 spots for SRR3207894.sra Written 1186115 spots for SRR3207894.sra Read 1186115 spots for SRR3207894.sra Written 1186115 spots for SRR3207894.sra Read 1186115 spots for SRR3207894.sra Written 1186115 spots for SRR3207894.sra Read 1186115 spots for SRR3207894.sra Written 1186115 spots for SRR3207894.sra Read 1186115 spots for SRR3207894.sra Written 1186115 spots for SRR3207894.sra Read 1186115 spots for SRR3207894.sra Written 1186115 spots for SRR3207894.sra SRR ids: ['SRR3207894.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2ho0rpzo SRR3207894.sra spots: 23722301 blocks: [[1, 1186115], [1186116, 2372230], [2372231, 3558345], [3558346, 4744460], [4744461, 5930575], [5930576, 7116690], [7116691, 8302805], [8302806, 9488920], [9488921, 10675035], [10675036, 11861150], [11861151, 13047265], [13047266, 14233380], [14233381, 15419495], [15419496, 16605610], [16605611, 17791725], [17791726, 18977840], [18977841, 20163955], [20163956, 21350070], [21350071, 22536185], [22536186, 23722301]] SRR3207894 file size 6162643 SRR3207894 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207894 SRR3207894_1.fastq Input file: SRR3207894_1.fastq trimmed: SRR3207894-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 12:43:25 2025 >> started Tue Feb 11 12:43:43 2025 >> done (17.989s) 23722301 reads processed; of these: 3250 ( 0.01%) short reads filtered out after trimming by size control 34555 ( 0.15%) empty reads filtered out after trimming by size control 23684496 (99.84%) reads available; of these: 1269738 ( 5.36%) trimmed reads available after processing 22414758 (94.64%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 497 0.00% 19 633 0.00% 20 763 0.00% 21 933 0.00% 22 1255 0.01% 23 1771 0.01% 24 2262 0.01% 25 2937 0.01% 26 3249 0.01% 27 3070 0.01% 28 3117 0.01% 29 3215 0.01% 30 3370 0.01% 31 3265 0.01% 32 3446 0.01% 33 3472 0.01% 34 3716 0.02% 35 4067 0.02% 36 4234 0.02% 37 4457 0.02% 38 4423 0.02% 39 4654 0.02% 40 5002 0.02% 41 5224 0.02% 42 5104 0.02% 43 5419 0.02% 44 5631 0.02% 45 5984 0.03% 46 6130 0.03% 47 5926 0.03% 48 6965 0.03% 49 6623 0.03% 50 6691 0.03% 51 7113 0.03% 52 7139 0.03% 53 8112 0.03% 54 8184 0.03% 55 8826 0.04% 56 7790 0.03% 57 8158 0.03% 58 8295 0.04% 59 8995 0.04% 60 7886 0.03% 61 8098 0.03% 62 8484 0.04% 63 9131 0.04% 64 9711 0.04% 65 9786 0.04% 66 10559 0.04% 67 10807 0.05% 68 11884 0.05% 69 10738 0.05% 70 10914 0.05% 71 11538 0.05% 72 12207 0.05% 73 12722 0.05% 74 13457 0.06% 75 14384 0.06% 76 7616 0.03% 77 8811 0.04% 78 10744 0.05% 79 11938 0.05% 80 13090 0.06% 81 14634 0.06% 82 14914 0.06% 83 16245 0.07% 84 17684 0.07% 85 19479 0.08% 86 20658 0.09% 87 21564 0.09% 88 24779 0.10% 89 26142 0.11% 90 28975 0.12% 91 32977 0.14% 92 38676 0.16% 93 43928 0.19% 94 50725 0.21% 95 60694 0.26% 96 73849 0.31% 97 93213 0.39% 98 114913 0.49% 99 131067 0.55% 100 22414758 94.64% 23684496 reads passed initial QC criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=63.08 fanout-score-rank=4 prefix-density=1.06 prefix-fanout=42.7 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=8 fanout-score=224.05 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=25.7 sequence=AAGAAGAAGAAA Started job on | Feb 11 12:44:01 Started mapping on | Feb 11 12:44:01 Finished on | Feb 11 12:44:31 Mapping speed, Million of reads per hour | 2842.14 Number of input reads | 23684496 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 22217500 Uniquely mapped reads % | 93.81% Average mapped length | 98.58 Number of splices: Total | 6128955 Number of splices: Annotated (sjdb) | 5999909 Number of splices: GT/AG | 6029294 Number of splices: GC/AG | 81169 Number of splices: AT/AC | 6782 Number of splices: Non-canonical | 11710 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.02% Deletion average length | 2.01 Insertion rate per base | 0.02% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 599886 % of reads mapped to multiple loci | 2.53% Number of reads mapped to too many loci | 720381 % of reads mapped to too many loci | 3.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.61% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 867110 867110 867110 N_multimapping 599886 599886 599886 N_noFeature 1042312 11480562 11623522 N_ambiguous 239780 42527 41919 UnstrandedReadsAssigned:20935408 PositiveStrandReadsAssigned:10694411 NegativeStrandReadsAssigned:10552059 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207894 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207894-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,684,496 reads, 22,043,423 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,071 rounds 52401 SRR3207894.ke.tsv 34699 SRR3207894.se.tsv 87100 total ==> SRR3207894.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1286 43.3641 Potri.005G024800.1.v4.1 1035 936 380 26.2708 Potri.004G059700.1.v4.1 961 862 104 7.80712 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 631.764 14.3744 Potri.016G087400.1.v4.1 270 171 998 377.658 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 103.647 4.0065 Potri.012G127500.1.v4.1 977 878 3783 278.809 ==> SRR3207894.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2509 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 353 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 61 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 6 SRR3207894 completed mapping pipeline successfully