Starting /dee2/code/volunteer_pipeline.sh SRR3207895 current disk space = 3050750689280 free memory = 1420614480 SRR3207895 SRAfilesize fa0e48a620de8d8309753d9e41bff183 SRR3207895.sra SRR3207895.sra file validated SRR3207895 is single end SRR3207895 is conventional basespace SRR3207895 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207895_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.739 34.0 31.0 34.0 31.0 34.0 2 32.86075 34.0 31.0 34.0 31.0 34.0 3 32.857 34.0 31.0 34.0 31.0 34.0 4 36.207 37.0 37.0 37.0 35.0 37.0 5 36.1815 37.0 37.0 37.0 35.0 37.0 6 36.22175 37.0 37.0 37.0 35.0 37.0 7 36.17675 37.0 36.0 37.0 35.0 37.0 8 36.18825 37.0 37.0 37.0 35.0 37.0 9 38.01675 39.0 38.0 39.0 35.0 39.0 10-11 38.03825 39.0 38.5 39.0 35.0 39.0 12-13 37.982124999999996 39.0 38.0 39.0 35.0 39.0 14-15 39.4885 41.0 39.0 41.0 36.0 41.0 16-17 39.459625 41.0 39.0 41.0 36.5 41.0 18-19 39.448625 41.0 39.5 41.0 36.5 41.0 20-21 39.416125 41.0 39.0 41.0 36.0 41.0 22-23 39.464 41.0 39.5 41.0 37.0 41.0 24-25 39.086124999999996 41.0 39.0 41.0 36.0 41.0 26-27 39.175375 41.0 39.0 41.0 36.0 41.0 28-29 39.094375 40.5 39.0 41.0 36.0 41.0 30-31 38.940375 40.0 39.0 41.0 35.0 41.0 32-33 39.027375000000006 40.0 39.0 41.0 36.0 41.0 34-35 38.918499999999995 40.0 38.0 41.0 35.0 41.0 36-37 38.6635 40.0 38.0 41.0 35.0 41.0 38-39 38.650125 40.0 38.0 41.0 35.0 41.0 40-41 38.623125 40.0 38.0 41.0 34.5 41.0 42-43 38.459625 40.0 38.0 41.0 34.5 41.0 44-45 38.267875000000004 40.0 38.0 41.0 34.0 41.0 46-47 37.958875 40.0 38.0 41.0 33.0 41.0 48-49 37.883624999999995 40.0 38.0 41.0 33.0 41.0 50-51 37.792874999999995 40.0 38.0 41.0 33.0 41.0 52-53 37.684125 40.0 37.5 41.0 32.5 41.0 54-55 37.625375000000005 40.0 37.0 41.0 33.0 41.0 56-57 37.641875 40.0 37.0 41.0 33.0 41.0 58-59 37.408625 39.5 36.5 41.0 32.5 41.0 60-61 37.231625 39.0 36.0 41.0 31.5 41.0 62-63 37.363875 39.0 36.0 41.0 32.0 41.0 64-65 37.18125 39.0 36.0 41.0 32.0 41.0 66-67 36.908125 39.0 35.0 41.0 32.0 41.0 68-69 36.575375 38.0 35.0 40.0 32.0 41.0 70-71 36.148875000000004 37.0 35.0 39.5 31.0 41.0 72-73 35.721000000000004 37.0 35.0 39.0 31.0 41.0 74-75 35.103624999999994 36.0 34.5 39.0 30.5 40.0 76-77 33.420125 34.5 32.5 36.5 28.0 39.0 78-79 34.18825 35.0 34.0 37.0 29.5 39.0 80-81 34.0565 35.0 34.0 37.0 30.0 38.5 82-83 33.614374999999995 35.0 34.0 36.0 29.5 37.0 84-85 33.348124999999996 35.0 34.0 36.0 29.5 37.0 86-87 33.1975 35.0 34.0 35.5 29.0 36.5 88-89 32.98975 35.0 34.0 35.0 29.0 36.0 90-91 32.87125 35.0 34.0 35.0 29.0 36.0 92-93 32.6925 35.0 34.0 35.0 29.0 36.0 94-95 32.59025 35.0 34.0 35.0 29.0 35.5 96-97 32.449875000000006 35.0 34.0 35.0 29.0 35.0 98-99 32.11525 35.0 34.0 35.0 28.5 35.0 100 31.9 35.0 34.0 35.0 27.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 2.0 10 3.0 11 1.0 12 3.0 13 5.0 14 6.0 15 1.0 16 2.0 17 8.0 18 3.0 19 7.0 20 6.0 21 9.0 22 9.0 23 11.0 24 8.0 25 11.0 26 14.0 27 25.0 28 36.0 29 53.0 30 58.0 31 59.0 32 88.0 33 104.0 34 147.0 35 234.0 36 404.0 37 838.0 38 1523.0 39 319.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.474999999999998 14.85 17.0 44.675 2 19.8 23.775 36.375 20.05 3 22.475 27.3 28.075 22.15 4 24.525 32.625 20.325 22.525000000000002 5 23.767825869402053 36.0270202651989 23.092319239429575 17.112834625969477 6 17.75 38.3 23.925 20.025000000000002 7 16.775000000000002 16.5 45.625 21.099999999999998 8 19.55 22.95 30.075000000000003 27.425 9 19.075 22.425 33.375 25.124999999999996 10-11 22.55 32.9625 22.787499999999998 21.7 12-13 20.3125 26.275 30.837500000000002 22.575 14-15 21.337500000000002 27.825 29.462500000000002 21.375 16-17 22.075 27.675 27.9375 22.3125 18-19 21.55 28.325 27.6875 22.4375 20-21 22.225 27.325 28.1375 22.3125 22-23 21.9625 27.625 28.037499999999998 22.375 24-25 21.807440925087985 28.104575163398692 28.00402212166918 22.083961789844142 26-27 21.9 27.8375 28.525 21.7375 28-29 21.575 28.1375 28.287499999999998 22.0 30-31 21.75 27.3625 27.9125 22.975 32-33 21.912499999999998 28.000000000000004 27.8875 22.2 34-35 21.425 28.125 27.5125 22.9375 36-37 21.337500000000002 28.925 27.975 21.762500000000003 38-39 21.075 27.987499999999997 28.725 22.2125 40-41 21.525 28.299999999999997 28.475 21.7 42-43 21.9625 27.425 28.4125 22.2 44-45 21.337500000000002 28.5875 28.287499999999998 21.7875 46-47 21.73151507569123 28.049543350431627 27.886901038408606 22.332040535468533 48-49 21.71608832807571 28.08832807570978 27.62145110410095 22.574132492113563 50-51 22.388811893662595 29.04119944563437 26.87413380370417 21.695854856998867 52-53 22.437742460267803 28.181704417469653 27.455887873858092 21.924665248404455 54-55 22.3875 28.462500000000002 28.537499999999998 20.6125 56-57 21.4875 27.962500000000002 28.599999999999998 21.95 58-59 22.75 27.325 28.3875 21.5375 60-61 21.2875 27.825 28.475 22.412499999999998 62-63 22.400000000000002 27.800000000000004 28.762500000000003 21.0375 64-65 21.725 28.712500000000002 27.575 21.987499999999997 66-67 21.775 28.6875 28.325 21.212500000000002 68-69 21.075 28.175 28.425 22.325 70-71 22.2 27.85 28.749999999999996 21.2 72-73 21.912499999999998 27.3 28.749999999999996 22.037499999999998 74-75 21.95 28.1375 27.6375 22.275 76-77 21.475 28.812500000000004 28.8375 20.875 78-79 21.912499999999998 28.449999999999996 28.287499999999998 21.349999999999998 80-81 22.2 28.6375 28.1125 21.05 82-83 21.85 29.325000000000003 27.037499999999998 21.7875 84-85 21.1875 27.6125 29.012500000000003 22.1875 86-87 22.0 28.6375 27.4125 21.95 88-89 21.95 28.825 27.725 21.5 90-91 21.775 28.749999999999996 28.1875 21.2875 92-93 22.0 28.5625 28.6125 20.825 94-95 21.6 28.925 28.512500000000003 20.962500000000002 96-97 22.7375 27.875 28.575 20.8125 98-99 22.5 28.675 28.0625 20.7625 100 21.15 29.15 27.675 22.025 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 2.5 24 1.5 25 3.0 26 5.5 27 6.0 28 10.0 29 18.0 30 24.0 31 26.0 32 34.5 33 47.5 34 57.5 35 69.0 36 90.5 37 128.5 38 160.5 39 172.0 40 198.0 41 231.5 42 269.0 43 280.5 44 254.5 45 254.0 46 276.5 47 262.5 48 219.0 49 177.5 50 149.0 51 136.5 52 100.0 53 74.5 54 54.5 55 42.0 56 40.5 57 26.0 58 16.0 59 12.5 60 13.0 61 9.5 62 7.5 63 7.0 64 6.0 65 5.0 66 3.5 67 0.5 68 1.5 69 2.5 70 2.0 71 1.5 72 1.5 73 1.5 74 1.0 75 0.5 76 0.0 77 0.0 78 1.0 79 1.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.5499999999999999 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.08750000000000001 48-49 0.9375 50-51 0.7875 52-53 0.11249999999999999 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88 0.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1073435 spots for SRR3207895.sra Written 1073435 spots for SRR3207895.sra Read 1073435 spots for SRR3207895.sra Written 1073435 spots for SRR3207895.sra Read 1073435 spots for SRR3207895.sra Written 1073435 spots for SRR3207895.sra Read 1073435 spots for SRR3207895.sra Written 1073435 spots for SRR3207895.sra Read 1073435 spots for SRR3207895.sra Written 1073435 spots for SRR3207895.sra Read 1073435 spots for SRR3207895.sra Written 1073435 spots for SRR3207895.sra Read 1073435 spots for SRR3207895.sra Written 1073435 spots for SRR3207895.sra Read 1073435 spots for SRR3207895.sra Written 1073435 spots for SRR3207895.sra Read 1073435 spots for SRR3207895.sra Written 1073435 spots for SRR3207895.sra Read 1073435 spots for SRR3207895.sra Written 1073435 spots for SRR3207895.sra Read 1073435 spots for SRR3207895.sra Written 1073435 spots for SRR3207895.sra Read 1073435 spots for SRR3207895.sra Written 1073435 spots for SRR3207895.sra Read 1073435 spots for SRR3207895.sra Written 1073435 spots for SRR3207895.sra Read 1073435 spots for SRR3207895.sra Written 1073435 spots for SRR3207895.sra Read 1073435 spots for SRR3207895.sra Written 1073435 spots for SRR3207895.sra Read 1073435 spots for SRR3207895.sra Written 1073435 spots for SRR3207895.sra Read 1073435 spots for SRR3207895.sra Written 1073435 spots for SRR3207895.sra Read 1073446 spots for SRR3207895.sra Written 1073446 spots for SRR3207895.sra Read 1073435 spots for SRR3207895.sra Written 1073435 spots for SRR3207895.sra Read 1073435 spots for SRR3207895.sra Written 1073435 spots for SRR3207895.sra SRR ids: ['SRR3207895.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1b01uqv6 SRR3207895.sra spots: 21468711 blocks: [[1, 1073435], [1073436, 2146870], [2146871, 3220305], [3220306, 4293740], [4293741, 5367175], [5367176, 6440610], [6440611, 7514045], [7514046, 8587480], [8587481, 9660915], [9660916, 10734350], [10734351, 11807785], [11807786, 12881220], [12881221, 13954655], [13954656, 15028090], [15028091, 16101525], [16101526, 17174960], [17174961, 18248395], [18248396, 19321830], [19321831, 20395265], [20395266, 21468711]] SRR3207895 file size 5576210 SRR3207895 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207895 SRR3207895_1.fastq Input file: SRR3207895_1.fastq trimmed: SRR3207895-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 12:34:45 2025 >> started Tue Feb 11 12:34:56 2025 >> done (10.761s) 21468711 reads processed; of these: 3061 ( 0.01%) short reads filtered out after trimming by size control 35433 ( 0.17%) empty reads filtered out after trimming by size control 21430217 (99.82%) reads available; of these: 1079091 ( 5.04%) trimmed reads available after processing 20351126 (94.96%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 439 0.00% 19 549 0.00% 20 608 0.00% 21 791 0.00% 22 1045 0.00% 23 1392 0.01% 24 1902 0.01% 25 2476 0.01% 26 2567 0.01% 27 2484 0.01% 28 2475 0.01% 29 2545 0.01% 30 2745 0.01% 31 2574 0.01% 32 2857 0.01% 33 2869 0.01% 34 3165 0.01% 35 3244 0.02% 36 3311 0.02% 37 3580 0.02% 38 3691 0.02% 39 3746 0.02% 40 4062 0.02% 41 4292 0.02% 42 4314 0.02% 43 4481 0.02% 44 4829 0.02% 45 4830 0.02% 46 5055 0.02% 47 5060 0.02% 48 5831 0.03% 49 5628 0.03% 50 5530 0.03% 51 5950 0.03% 52 6133 0.03% 53 6937 0.03% 54 6909 0.03% 55 7358 0.03% 56 6611 0.03% 57 6823 0.03% 58 6959 0.03% 59 7561 0.04% 60 6683 0.03% 61 6711 0.03% 62 7018 0.03% 63 7345 0.03% 64 7691 0.04% 65 8279 0.04% 66 8535 0.04% 67 8818 0.04% 68 9607 0.04% 69 8931 0.04% 70 9553 0.04% 71 9747 0.05% 72 10210 0.05% 73 10972 0.05% 74 11595 0.05% 75 12176 0.06% 76 6347 0.03% 77 7631 0.04% 78 9249 0.04% 79 10254 0.05% 80 11069 0.05% 81 12731 0.06% 82 12826 0.06% 83 13788 0.06% 84 14744 0.07% 85 16473 0.08% 86 17603 0.08% 87 18478 0.09% 88 21355 0.10% 89 22430 0.10% 90 24850 0.12% 91 27661 0.13% 92 33098 0.15% 93 37354 0.17% 94 43652 0.20% 95 52349 0.24% 96 63284 0.30% 97 79737 0.37% 98 99422 0.46% 99 112627 0.53% 100 20351126 94.96% 21430217 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=63.15 fanout-score-rank=4 prefix-density=0.65 prefix-fanout=40.4 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCA criterion=fanout-score sequence-density=0.05 sequence-density-rank=10 fanout-score=204.46 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=25.6 sequence=AAGAAGAAGAAA Started job on | Feb 11 12:35:12 Started mapping on | Feb 11 12:35:12 Finished on | Feb 11 12:35:31 Mapping speed, Million of reads per hour | 4060.46 Number of input reads | 21430217 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 20488885 Uniquely mapped reads % | 95.61% Average mapped length | 98.71 Number of splices: Total | 5612474 Number of splices: Annotated (sjdb) | 5493087 Number of splices: GT/AG | 5523989 Number of splices: GC/AG | 72080 Number of splices: AT/AC | 6195 Number of splices: Non-canonical | 10210 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.02% Deletion average length | 2.02 Insertion rate per base | 0.02% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 503720 % of reads mapped to multiple loci | 2.35% Number of reads mapped to too many loci | 309534 % of reads mapped to too many loci | 1.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.59% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 437612 437612 437612 N_multimapping 503720 503720 503720 N_noFeature 1043479 10617389 10750555 N_ambiguous 241358 38714 38566 UnstrandedReadsAssigned:19204048 PositiveStrandReadsAssigned:9832782 NegativeStrandReadsAssigned:9699764 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207895 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207895-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,430,217 reads, 19,893,797 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,077 rounds 52401 SRR3207895.ke.tsv 34699 SRR3207895.se.tsv 87100 total ==> SRR3207895.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1119 42.5601 Potri.005G024800.1.v4.1 1035 936 408 31.815 Potri.004G059700.1.v4.1 961 862 121 10.2453 Potri.007G009000.2.v4.1 1416 1317 1 0.0554194 Potri.003G141000.2.v4.1 2943 2844 435.551 11.1778 Potri.016G087400.1.v4.1 270 171 691 294.937 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 83 3.61885 Potri.012G127500.1.v4.1 977 878 1469 122.117 ==> SRR3207895.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2715 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 405 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 102 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR3207895 completed mapping pipeline successfully