Starting /dee2/code/volunteer_pipeline.sh SRR3207896 current disk space = 3050616549376 free memory = 1473448356 SRR3207896 SRAfilesize 62f15cef0c9b234f573fed37780ee7ac SRR3207896.sra SRR3207896.sra file validated SRR3207896 is single end SRR3207896 is conventional basespace SRR3207896 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207896_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.751 34.0 31.0 34.0 31.0 34.0 2 32.8545 34.0 31.0 34.0 31.0 34.0 3 32.80275 34.0 31.0 34.0 31.0 34.0 4 36.12925 37.0 37.0 37.0 35.0 37.0 5 36.20275 37.0 37.0 37.0 35.0 37.0 6 36.18575 37.0 37.0 37.0 35.0 37.0 7 36.14975 37.0 37.0 37.0 35.0 37.0 8 36.2075 37.0 37.0 37.0 35.0 37.0 9 37.9925 39.0 38.0 39.0 35.0 39.0 10-11 37.981125 39.0 38.0 39.0 35.0 39.0 12-13 37.90325 39.0 38.0 39.0 35.0 39.0 14-15 39.384249999999994 41.0 39.0 41.0 36.0 41.0 16-17 39.425625 41.0 39.0 41.0 36.0 41.0 18-19 39.435874999999996 41.0 39.0 41.0 36.0 41.0 20-21 39.38125 41.0 39.0 41.0 36.0 41.0 22-23 39.34225 41.0 39.0 41.0 36.0 41.0 24-25 38.891125 41.0 39.0 41.0 36.0 41.0 26-27 39.07 41.0 39.0 41.0 35.5 41.0 28-29 38.978 40.5 39.0 41.0 35.5 41.0 30-31 38.878125 40.0 38.0 41.0 35.0 41.0 32-33 38.847 40.0 38.5 41.0 35.0 41.0 34-35 38.8625 40.0 38.0 41.0 35.0 41.0 36-37 38.699124999999995 40.0 38.0 41.0 35.0 41.0 38-39 38.624125 40.0 38.0 41.0 34.5 41.0 40-41 38.485875 40.0 38.0 41.0 34.0 41.0 42-43 38.404875000000004 40.0 38.0 41.0 34.0 41.0 44-45 38.224625 40.0 38.0 41.0 33.0 41.0 46-47 37.941625 40.0 38.0 41.0 33.0 41.0 48-49 37.710499999999996 40.0 38.0 41.0 33.0 41.0 50-51 37.619875 40.0 38.0 41.0 33.0 41.0 52-53 37.6035 40.0 37.0 41.0 32.5 41.0 54-55 37.687625 40.0 37.0 41.0 33.0 41.0 56-57 37.51775 40.0 37.0 41.0 32.0 41.0 58-59 37.225375 39.0 36.0 41.0 31.5 41.0 60-61 37.187124999999995 39.0 36.0 41.0 31.5 41.0 62-63 37.267125 39.0 36.0 41.0 32.0 41.0 64-65 37.072374999999994 39.0 36.0 41.0 32.0 41.0 66-67 36.804249999999996 39.0 35.0 40.5 32.0 41.0 68-69 36.4355 38.0 35.0 40.0 31.5 41.0 70-71 35.94175 37.0 35.0 39.5 31.0 41.0 72-73 35.544 36.5 35.0 39.0 31.0 41.0 74-75 34.897125 36.0 34.5 39.0 29.5 40.0 76-77 33.27225 34.5 32.5 36.5 27.5 39.0 78-79 34.143625 35.0 34.0 37.0 30.0 39.0 80-81 34.010625000000005 35.0 34.0 37.0 30.0 39.0 82-83 33.510125 35.0 34.0 36.0 29.0 37.0 84-85 33.2795 35.0 34.0 36.0 29.0 37.0 86-87 33.138999999999996 35.0 34.0 35.5 29.0 36.5 88-89 32.9565 35.0 34.0 35.0 29.0 36.0 90-91 32.773875000000004 35.0 34.0 35.0 29.0 36.0 92-93 32.634125 35.0 34.0 35.0 29.0 36.0 94-95 32.511250000000004 35.0 34.0 35.0 29.0 35.5 96-97 32.320750000000004 35.0 34.0 35.0 28.5 35.0 98-99 32.067625 35.0 33.5 35.0 27.5 35.0 100 31.9675 35.0 33.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 5.0 11 1.0 12 5.0 13 3.0 14 6.0 15 2.0 16 7.0 17 7.0 18 10.0 19 7.0 20 6.0 21 4.0 22 7.0 23 16.0 24 10.0 25 10.0 26 14.0 27 26.0 28 36.0 29 48.0 30 55.0 31 65.0 32 94.0 33 129.0 34 159.0 35 217.0 36 374.0 37 879.0 38 1478.0 39 315.0 40 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.375 15.125 18.075 42.425000000000004 2 19.575 23.599999999999998 37.55 19.275000000000002 3 22.75 26.724999999999998 26.900000000000002 23.625 4 23.849999999999998 32.675 20.424999999999997 23.05 5 24.487243621810904 35.64282141070535 21.860930465232617 18.009004502251123 6 18.025 38.175 24.425 19.375 7 15.5 17.65 45.800000000000004 21.05 8 18.95 22.95 30.0 28.1 9 20.275000000000002 22.575 31.724999999999998 25.424999999999997 10-11 22.1 33.1125 22.85 21.9375 12-13 20.1125 26.6125 30.125 23.150000000000002 14-15 21.3 27.3375 28.999999999999996 22.3625 16-17 22.0 27.3875 28.487499999999997 22.125 18-19 21.825 27.5875 27.437499999999996 23.150000000000002 20-21 21.6625 29.012500000000003 27.474999999999998 21.85 22-23 21.9375 28.749999999999996 27.6125 21.7 24-25 21.85572201938814 29.15774896134962 27.055268790129674 21.931260229132572 26-27 20.875 29.2 28.000000000000004 21.925 28-29 22.075 28.775000000000002 27.462500000000002 21.6875 30-31 21.75 27.9125 28.1125 22.225 32-33 22.2 28.875 27.55 21.375 34-35 21.2875 28.349999999999998 27.8375 22.525000000000002 36-37 21.15 28.1625 28.499999999999996 22.1875 38-39 21.425 28.9 27.462500000000002 22.2125 40-41 21.8625 28.1 28.1375 21.9 42-43 21.4125 28.037499999999998 28.65 21.9 44-45 22.475 27.525 28.249999999999996 21.75 46-47 22.085889570552148 27.757606109928634 28.2458995868286 21.910604732690622 48-49 22.032396861554037 27.980258162490507 27.25892179195141 22.728423184004047 50-51 21.336533602829714 28.587670540677106 27.943405760485096 22.132390096008084 52-53 21.547514711406034 27.957931638913237 28.759233754851632 21.735319894829097 54-55 22.1 27.8375 27.787499999999998 22.275 56-57 22.400000000000002 28.4 27.187499999999996 22.0125 58-59 20.724999999999998 28.3125 29.1875 21.775 60-61 21.5625 27.962500000000002 28.675 21.8 62-63 22.75 27.987499999999997 27.750000000000004 21.512500000000003 64-65 21.725 28.9 27.950000000000003 21.425 66-67 22.05551387846962 28.507126781695426 28.032008002000502 21.405351337834457 68-69 21.775 27.6625 28.749999999999996 21.8125 70-71 22.287499999999998 26.9625 28.975 21.775 72-73 21.8304576144036 27.33183295823956 28.95723930982746 21.880470117529384 74-75 22.037499999999998 28.5875 28.075 21.3 76-77 21.5375 28.3625 28.6375 21.462500000000002 78-79 21.725 28.349999999999998 28.4375 21.4875 80-81 21.2875 28.475 28.1 22.1375 82-83 22.05 27.3125 28.9 21.7375 84-85 21.2875 28.549999999999997 28.249999999999996 21.912499999999998 86-87 22.287499999999998 28.6125 27.5875 21.512500000000003 88-89 21.4875 28.6875 28.7 21.125 90-91 22.05 29.262500000000003 27.437499999999996 21.25 92-93 21.9 28.8875 27.2625 21.95 94-95 21.802725340667585 28.59107388423553 28.26603325415677 21.340167520940117 96-97 21.987499999999997 29.512500000000003 27.762500000000003 20.7375 98-99 22.215276909613703 28.46605825728216 27.640955119389925 21.677709713714215 100 22.705676419104776 28.232058014503625 28.132033008252062 20.930232558139537 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.5 23 2.5 24 1.5 25 4.0 26 5.5 27 5.5 28 8.5 29 10.5 30 18.5 31 32.0 32 37.0 33 39.5 34 57.5 35 79.0 36 102.0 37 130.0 38 143.0 39 181.5 40 209.5 41 241.0 42 267.0 43 259.0 44 263.0 45 265.0 46 251.0 47 231.5 48 214.5 49 197.0 50 165.5 51 130.5 52 106.0 53 77.5 54 57.0 55 43.0 56 38.0 57 28.0 58 18.5 59 11.5 60 8.0 61 12.5 62 12.5 63 7.0 64 6.5 65 5.5 66 2.5 67 3.0 68 2.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.5 78 1.5 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.7125 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.1625 48-49 1.225 50-51 1.05 52-53 0.1625 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.025 68-69 0.0 70-71 0.0 72-73 0.025 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0125 96-97 0.0 98-99 0.0125 100 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.94994994994994 99.85000000000001 2 0.025025025025025023 0.05 3 0.0 0.0 4 0.025025025025025023 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88 0.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 885390 spots for SRR3207896.sra Written 885390 spots for SRR3207896.sra Read 885390 spots for SRR3207896.sra Written 885390 spots for SRR3207896.sra Read 885390 spots for SRR3207896.sra Written 885390 spots for SRR3207896.sra Read 885390 spots for SRR3207896.sra Written 885390 spots for SRR3207896.sra Read 885390 spots for SRR3207896.sra Written 885390 spots for SRR3207896.sra Read 885390 spots for SRR3207896.sra Written 885390 spots for SRR3207896.sra Read 885390 spots for SRR3207896.sra Written 885390 spots for SRR3207896.sra Read 885390 spots for SRR3207896.sra Written 885390 spots for SRR3207896.sra Read 885390 spots for SRR3207896.sra Written 885390 spots for SRR3207896.sra Read 885390 spots for SRR3207896.sra Written 885390 spots for SRR3207896.sra Read 885390 spots for SRR3207896.sra Written 885390 spots for SRR3207896.sra Read 885390 spots for SRR3207896.sra Written 885390 spots for SRR3207896.sra Read 885390 spots for SRR3207896.sra Written 885390 spots for SRR3207896.sra Read 885390 spots for SRR3207896.sra Written 885390 spots for SRR3207896.sra Read 885390 spots for SRR3207896.sra Written 885390 spots for SRR3207896.sra Read 885390 spots for SRR3207896.sra Written 885390 spots for SRR3207896.sra Read 885390 spots for SRR3207896.sra Written 885390 spots for SRR3207896.sra Read 885390 spots for SRR3207896.sra Written 885390 spots for SRR3207896.sra Read 885390 spots for SRR3207896.sra Written 885390 spots for SRR3207896.sra Read 885392 spots for SRR3207896.sra Written 885392 spots for SRR3207896.sra SRR ids: ['SRR3207896.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yeu4w0rl SRR3207896.sra spots: 17707802 blocks: [[1, 885390], [885391, 1770780], [1770781, 2656170], [2656171, 3541560], [3541561, 4426950], [4426951, 5312340], [5312341, 6197730], [6197731, 7083120], [7083121, 7968510], [7968511, 8853900], [8853901, 9739290], [9739291, 10624680], [10624681, 11510070], [11510071, 12395460], [12395461, 13280850], [13280851, 14166240], [14166241, 15051630], [15051631, 15937020], [15937021, 16822410], [16822411, 17707802]] SRR3207896 file size 4597431 SRR3207896 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207896 SRR3207896_1.fastq Input file: SRR3207896_1.fastq trimmed: SRR3207896-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 12:56:13 2025 >> started Tue Feb 11 12:56:22 2025 >> done (8.184s) 17707802 reads processed; of these: 2594 ( 0.01%) short reads filtered out after trimming by size control 36689 ( 0.21%) empty reads filtered out after trimming by size control 17668519 (99.78%) reads available; of these: 906666 ( 5.13%) trimmed reads available after processing 16761853 (94.87%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 362 0.00% 19 463 0.00% 20 533 0.00% 21 688 0.00% 22 900 0.01% 23 1163 0.01% 24 1562 0.01% 25 2074 0.01% 26 2238 0.01% 27 2141 0.01% 28 2218 0.01% 29 2293 0.01% 30 2283 0.01% 31 2204 0.01% 32 2382 0.01% 33 2333 0.01% 34 2710 0.02% 35 2806 0.02% 36 2817 0.02% 37 3040 0.02% 38 3086 0.02% 39 3252 0.02% 40 3411 0.02% 41 3623 0.02% 42 3550 0.02% 43 3888 0.02% 44 3979 0.02% 45 4116 0.02% 46 4206 0.02% 47 4287 0.02% 48 4836 0.03% 49 4668 0.03% 50 4772 0.03% 51 5012 0.03% 52 5098 0.03% 53 5741 0.03% 54 5973 0.03% 55 6418 0.04% 56 5531 0.03% 57 5752 0.03% 58 5909 0.03% 59 6442 0.04% 60 5398 0.03% 61 5784 0.03% 62 6046 0.03% 63 6175 0.03% 64 6544 0.04% 65 6874 0.04% 66 7219 0.04% 67 7516 0.04% 68 8422 0.05% 69 7787 0.04% 70 8004 0.05% 71 8285 0.05% 72 8809 0.05% 73 9253 0.05% 74 9881 0.06% 75 10179 0.06% 76 5438 0.03% 77 6322 0.04% 78 7592 0.04% 79 8538 0.05% 80 9286 0.05% 81 10541 0.06% 82 10831 0.06% 83 11679 0.07% 84 12490 0.07% 85 13691 0.08% 86 14735 0.08% 87 15540 0.09% 88 18047 0.10% 89 18758 0.11% 90 20879 0.12% 91 23547 0.13% 92 27651 0.16% 93 31257 0.18% 94 36188 0.20% 95 43549 0.25% 96 52582 0.30% 97 66831 0.38% 98 83469 0.47% 99 94289 0.53% 100 16761853 94.87% 17668519 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=61.42 fanout-score-rank=10 prefix-density=0.75 prefix-fanout=40.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=18 fanout-score=330.88 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=29.1 sequence=TTCTTCTTCTTC Started job on | Feb 11 12:56:37 Started mapping on | Feb 11 12:56:37 Finished on | Feb 11 12:56:56 Mapping speed, Million of reads per hour | 3347.72 Number of input reads | 17668519 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 16863549 Uniquely mapped reads % | 95.44% Average mapped length | 98.67 Number of splices: Total | 4793850 Number of splices: Annotated (sjdb) | 4695209 Number of splices: GT/AG | 4717534 Number of splices: GC/AG | 62251 Number of splices: AT/AC | 5337 Number of splices: Non-canonical | 8728 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.02% Deletion average length | 2.03 Insertion rate per base | 0.02% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 445697 % of reads mapped to multiple loci | 2.52% Number of reads mapped to too many loci | 238943 % of reads mapped to too many loci | 1.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.67% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 359273 359273 359273 N_multimapping 445697 445697 445697 N_noFeature 841257 8759997 8839454 N_ambiguous 167273 30957 31197 UnstrandedReadsAssigned:15855019 PositiveStrandReadsAssigned:8072595 NegativeStrandReadsAssigned:7992898 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207896 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207896-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,668,519 reads, 16,407,660 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,200 rounds 52401 SRR3207896.ke.tsv 34699 SRR3207896.se.tsv 87100 total ==> SRR3207896.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1068 49.4082 Potri.005G024800.1.v4.1 1035 936 499 47.329 Potri.004G059700.1.v4.1 961 862 35 3.60466 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 427.793 13.3539 Potri.016G087400.1.v4.1 270 171 595 308.904 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 80.6657 4.27796 Potri.012G127500.1.v4.1 977 878 2469 249.649 ==> SRR3207896.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1963 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 268 Potri.001G212900.v4.1 13 Potri.001G182400.v4.1 19 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR3207896 completed mapping pipeline successfully