Starting /dee2/code/volunteer_pipeline.sh SRR3207897 current disk space = 3050377261056 free memory = 1579181300 SRR3207897 SRAfilesize 0a51d5ac4a57f26d45862a73b14ce8eb SRR3207897.sra SRR3207897.sra file validated SRR3207897 is single end SRR3207897 is conventional basespace SRR3207897 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207897_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9325 34.0 33.0 34.0 31.0 34.0 2 32.9535 34.0 33.0 34.0 31.0 34.0 3 33.09125 34.0 33.0 34.0 31.0 34.0 4 36.37725 37.0 37.0 37.0 35.0 37.0 5 36.2505 37.0 37.0 37.0 35.0 37.0 6 36.31175 37.0 37.0 37.0 35.0 37.0 7 36.32425 37.0 37.0 37.0 35.0 37.0 8 36.3155 37.0 37.0 37.0 35.0 37.0 9 38.146 39.0 39.0 39.0 37.0 39.0 10-11 38.119125 39.0 39.0 39.0 37.0 39.0 12-13 38.06975 39.0 39.0 39.0 37.0 39.0 14-15 39.659625000000005 41.0 40.0 41.0 37.0 41.0 16-17 39.655 41.0 40.0 41.0 37.0 41.0 18-19 39.643875 41.0 40.0 41.0 37.0 41.0 20-21 39.571625 41.0 40.0 41.0 37.0 41.0 22-23 39.61125 41.0 40.0 41.0 37.0 41.0 24-25 39.2905 41.0 40.0 41.0 37.0 41.0 26-27 39.48525 41.0 40.0 41.0 37.0 41.0 28-29 39.361625000000004 41.0 39.5 41.0 36.5 41.0 30-31 39.310625 41.0 39.0 41.0 36.0 41.0 32-33 39.112625 41.0 39.0 41.0 36.0 41.0 34-35 38.968625 40.5 39.0 41.0 35.0 41.0 36-37 39.00075 40.5 39.0 41.0 35.5 41.0 38-39 38.796375 40.0 38.0 41.0 35.0 41.0 40-41 38.700874999999996 40.0 38.0 41.0 35.0 41.0 42-43 38.510000000000005 40.0 38.0 41.0 34.5 41.0 44-45 38.386375 40.0 38.0 41.0 34.0 41.0 46-47 38.19125 40.0 38.0 41.0 33.5 41.0 48-49 38.089375000000004 40.0 38.0 41.0 33.5 41.0 50-51 37.86475 40.0 38.0 41.0 33.0 41.0 52-53 37.6905 40.0 37.0 41.0 32.5 41.0 54-55 37.6695 40.0 37.0 41.0 33.0 41.0 56-57 37.510999999999996 40.0 36.5 41.0 32.5 41.0 58-59 37.18375 39.5 36.0 41.0 32.0 41.0 60-61 37.062625 39.0 36.0 41.0 32.0 41.0 62-63 37.192875 39.0 36.0 41.0 33.0 41.0 64-65 37.082875 39.0 35.0 41.0 33.0 41.0 66-67 36.678875000000005 38.5 35.0 40.5 32.5 41.0 68-69 36.298375 37.0 35.0 40.0 32.0 41.0 70-71 35.854124999999996 37.0 35.0 39.0 32.0 41.0 72-73 35.54575 36.5 35.0 39.0 31.5 41.0 74-75 35.025125 36.0 35.0 38.5 30.5 40.0 76-77 33.508250000000004 35.0 33.0 36.5 28.5 39.0 78-79 34.187375 35.0 34.0 37.0 30.5 39.0 80-81 33.965625 35.0 34.0 36.5 30.0 38.5 82-83 33.6525 35.0 34.0 36.0 30.0 37.0 84-85 33.474625 35.0 34.0 36.0 30.0 37.0 86-87 33.1845 35.0 34.0 35.0 30.0 36.5 88-89 32.967749999999995 35.0 34.0 35.0 29.5 36.0 90-91 32.762125 35.0 34.0 35.0 29.0 36.0 92-93 32.707375 35.0 34.0 35.0 29.0 36.0 94-95 32.553 35.0 34.0 35.0 29.5 35.5 96-97 32.148375 35.0 33.5 35.0 28.0 35.0 98-99 31.94825 35.0 34.0 35.0 27.0 35.0 100 31.84 35.0 34.0 35.0 27.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 0.0 4 1.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 2.0 11 6.0 12 3.0 13 4.0 14 5.0 15 5.0 16 5.0 17 6.0 18 5.0 19 6.0 20 6.0 21 6.0 22 4.0 23 9.0 24 12.0 25 15.0 26 14.0 27 24.0 28 36.0 29 31.0 30 41.0 31 45.0 32 74.0 33 111.0 34 152.0 35 240.0 36 380.0 37 885.0 38 1474.0 39 383.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.224999999999998 14.85 17.4 42.525 2 20.625 22.575 34.575 22.225 3 23.375 25.05 26.474999999999998 25.1 4 24.625 30.875000000000004 19.950000000000003 24.55 5 25.224999999999998 34.55 21.475 18.75 6 19.650000000000002 36.55 23.1 20.7 7 17.675 17.599999999999998 43.85 20.875 8 20.275000000000002 22.8 28.725 28.199999999999996 9 20.549999999999997 23.0 30.625000000000004 25.825 10-11 22.787499999999998 32.800000000000004 21.625 22.787499999999998 12-13 21.212500000000002 26.525 29.025000000000002 23.2375 14-15 21.925 26.55 28.175 23.35 16-17 22.675 26.974999999999998 26.8 23.549999999999997 18-19 21.837500000000002 27.8875 27.05 23.225 20-21 22.118029507376843 27.781945486371594 26.85671417854464 23.243310827706924 22-23 21.712500000000002 27.700000000000003 27.8375 22.75 24-25 21.246387737152908 28.232189973614773 27.591405955522053 22.930016333710267 26-27 22.112499999999997 28.1625 26.724999999999998 23.0 28-29 22.4875 27.375 26.4125 23.724999999999998 30-31 21.762500000000003 27.6125 27.250000000000004 23.375 32-33 22.237499999999997 27.250000000000004 26.737499999999997 23.775 34-35 22.0875 28.199999999999996 26.575 23.1375 36-37 22.6 27.950000000000003 26.4625 22.9875 38-39 22.9625 28.0875 26.974999999999998 21.975 40-41 22.0875 27.375 26.775 23.7625 42-43 21.9625 27.8875 27.474999999999998 22.675 44-45 22.6375 28.1125 27.0125 22.237499999999997 46-47 22.625 27.075 27.3 23.0 48-49 21.977883890424728 27.93415431012817 26.97914048755969 23.10882131188741 50-51 22.70440251572327 27.78616352201258 26.742138364779873 22.767295597484278 52-53 22.19997497184332 27.193092228757354 27.480916030534353 23.126016768864975 54-55 22.3 26.0 28.725 22.975 56-57 21.3875 27.375 27.775 23.4625 58-59 23.025000000000002 27.500000000000004 26.85 22.625 60-61 22.35 28.175 27.325 22.15 62-63 23.325000000000003 27.9125 27.150000000000002 21.6125 64-65 22.2125 26.9625 28.175 22.650000000000002 66-67 22.1375 27.1 27.275 23.4875 68-69 22.740342542817853 28.19102387798475 26.878359794974372 22.190273784223027 70-71 22.037499999999998 28.299999999999997 26.650000000000002 23.0125 72-73 22.412499999999998 27.4125 27.725 22.45 74-75 22.4625 27.35 27.375 22.8125 76-77 22.4875 28.075 27.2625 22.175 78-79 21.9625 27.750000000000004 27.375 22.912499999999998 80-81 22.2125 27.950000000000003 27.625 22.2125 82-83 22.925 27.0 27.487499999999997 22.5875 84-85 22.440305038129765 27.815976997124643 26.828353544193025 22.91536442055257 86-87 22.15 28.487499999999997 27.0875 22.275 88-89 23.225 26.924999999999997 27.35 22.5 90-91 22.3625 27.175 27.700000000000003 22.7625 92-93 22.218054513628406 27.969492373093274 27.694423605901473 22.118029507376843 94-95 22.36809202300575 27.769442360590148 27.569392348087025 22.29307326831708 96-97 22.3625 27.175 27.750000000000004 22.7125 98-99 22.6 27.900000000000002 26.924999999999997 22.575 100 23.21160580290145 27.863931965982992 26.3631815907954 22.56128064032016 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.0 23 0.0 24 1.0 25 2.0 26 4.5 27 6.0 28 7.0 29 11.5 30 18.5 31 22.5 32 28.0 33 42.0 34 57.0 35 69.5 36 91.0 37 110.5 38 124.5 39 150.5 40 175.5 41 193.0 42 227.5 43 238.0 44 248.0 45 256.5 46 231.0 47 233.0 48 239.5 49 203.5 50 154.5 51 133.5 52 117.0 53 92.5 54 73.5 55 63.0 56 48.5 57 44.0 58 43.5 59 30.5 60 24.0 61 28.5 62 23.5 63 14.5 64 14.0 65 11.0 66 6.5 67 6.0 68 7.0 69 8.5 70 8.0 71 5.0 72 4.5 73 6.0 74 5.0 75 4.0 76 7.5 77 7.5 78 5.0 79 3.0 80 2.0 81 1.0 82 0.5 83 0.5 84 0.5 85 0.5 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.025 22-23 0.0 24-25 0.5125000000000001 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.525 50-51 0.625 52-53 0.11249999999999999 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0125 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0125 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.025 94-95 0.025 96-97 0.0 98-99 0.0 100 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21776431995963 98.3 2 0.7065354529396921 1.4000000000000001 3 0.05046681806712087 0.15 4 0.0 0.0 5 0.0 0.0 6 0.025233409033560434 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTAT 6 0.15 TruSeq Adapter, Index 13 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.037500000000000006 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88 0.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 638847 spots for SRR3207897.sra Written 638847 spots for SRR3207897.sra Read 638847 spots for SRR3207897.sra Written 638847 spots for SRR3207897.sra Read 638847 spots for SRR3207897.sra Written 638847 spots for SRR3207897.sra Read 638847 spots for SRR3207897.sra Written 638847 spots for SRR3207897.sra Read 638847 spots for SRR3207897.sra Written 638847 spots for SRR3207897.sra Read 638847 spots for SRR3207897.sra Written 638847 spots for SRR3207897.sra Read 638847 spots for SRR3207897.sra Written 638847 spots for SRR3207897.sra Read 638847 spots for SRR3207897.sra Written 638847 spots for SRR3207897.sra Read 638847 spots for SRR3207897.sra Written 638847 spots for SRR3207897.sra Read 638847 spots for SRR3207897.sra Written 638847 spots for SRR3207897.sra Read 638847 spots for SRR3207897.sra Written 638847 spots for SRR3207897.sra Read 638847 spots for SRR3207897.sra Written 638847 spots for SRR3207897.sra Read 638847 spots for SRR3207897.sra Written 638847 spots for SRR3207897.sra Read 638857 spots for SRR3207897.sra Written 638857 spots for SRR3207897.sra Read 638847 spots for SRR3207897.sra Written 638847 spots for SRR3207897.sra Read 638847 spots for SRR3207897.sra Written 638847 spots for SRR3207897.sra Read 638847 spots for SRR3207897.sra Written 638847 spots for SRR3207897.sra Read 638847 spots for SRR3207897.sra Written 638847 spots for SRR3207897.sra Read 638847 spots for SRR3207897.sra Written 638847 spots for SRR3207897.sra Read 638847 spots for SRR3207897.sra Written 638847 spots for SRR3207897.sra SRR ids: ['SRR3207897.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_v5ng3dvs SRR3207897.sra spots: 12776950 blocks: [[1, 638847], [638848, 1277694], [1277695, 1916541], [1916542, 2555388], [2555389, 3194235], [3194236, 3833082], [3833083, 4471929], [4471930, 5110776], [5110777, 5749623], [5749624, 6388470], [6388471, 7027317], [7027318, 7666164], [7666165, 8305011], [8305012, 8943858], [8943859, 9582705], [9582706, 10221552], [10221553, 10860399], [10860400, 11499246], [11499247, 12138093], [12138094, 12776950]] SRR3207897 file size 3314252 SRR3207897 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207897 SRR3207897_1.fastq Input file: SRR3207897_1.fastq trimmed: SRR3207897-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 13:38:38 2025 >> started Tue Feb 11 13:38:47 2025 >> done (8.671s) 12776950 reads processed; of these: 1735 ( 0.01%) short reads filtered out after trimming by size control 35797 ( 0.28%) empty reads filtered out after trimming by size control 12739418 (99.71%) reads available; of these: 641281 ( 5.03%) trimmed reads available after processing 12098137 (94.97%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 315 0.00% 19 354 0.00% 20 438 0.00% 21 579 0.00% 22 748 0.01% 23 1028 0.01% 24 1326 0.01% 25 1811 0.01% 26 1861 0.01% 27 1851 0.01% 28 1812 0.01% 29 1928 0.02% 30 2129 0.02% 31 2016 0.02% 32 2216 0.02% 33 2125 0.02% 34 2343 0.02% 35 2359 0.02% 36 2427 0.02% 37 2545 0.02% 38 2629 0.02% 39 2752 0.02% 40 2934 0.02% 41 3005 0.02% 42 3067 0.02% 43 3244 0.03% 44 3392 0.03% 45 3303 0.03% 46 3390 0.03% 47 3225 0.03% 48 3465 0.03% 49 3532 0.03% 50 3515 0.03% 51 3709 0.03% 52 3873 0.03% 53 3906 0.03% 54 4077 0.03% 55 4237 0.03% 56 3944 0.03% 57 4047 0.03% 58 4118 0.03% 59 3986 0.03% 60 3881 0.03% 61 4140 0.03% 62 4384 0.03% 63 4585 0.04% 64 5216 0.04% 65 4948 0.04% 66 5261 0.04% 67 5329 0.04% 68 5764 0.05% 69 5400 0.04% 70 5726 0.04% 71 6176 0.05% 72 6551 0.05% 73 6693 0.05% 74 6893 0.05% 75 7534 0.06% 76 3767 0.03% 77 4411 0.03% 78 5509 0.04% 79 6231 0.05% 80 6437 0.05% 81 7092 0.06% 82 7816 0.06% 83 8084 0.06% 84 8974 0.07% 85 9709 0.08% 86 10280 0.08% 87 11629 0.09% 88 12350 0.10% 89 12920 0.10% 90 14860 0.12% 91 17479 0.14% 92 21192 0.17% 93 22042 0.17% 94 24399 0.19% 95 29432 0.23% 96 35187 0.28% 97 45251 0.36% 98 54014 0.42% 99 64174 0.50% 100 12098137 94.97% 12739418 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=50.40 fanout-score-rank=6 prefix-density=0.42 prefix-fanout=35.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTATGCCGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=18 fanout-score=264.50 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=29.0 sequence=TTCTTCTTCTTT Started job on | Feb 11 13:39:05 Started mapping on | Feb 11 13:39:05 Finished on | Feb 11 13:39:23 Mapping speed, Million of reads per hour | 2547.88 Number of input reads | 12739418 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 10796849 Uniquely mapped reads % | 84.75% Average mapped length | 98.86 Number of splices: Total | 3082883 Number of splices: Annotated (sjdb) | 3021954 Number of splices: GT/AG | 3031500 Number of splices: GC/AG | 42240 Number of splices: AT/AC | 3460 Number of splices: Non-canonical | 5683 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 2.06 Insertion rate per base | 0.02% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 333613 % of reads mapped to multiple loci | 2.62% Number of reads mapped to too many loci | 1526990 % of reads mapped to too many loci | 11.99% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.62% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1608956 1608956 1608956 N_multimapping 333613 333613 333613 N_noFeature 471439 5565836 5631139 N_ambiguous 112440 20913 20383 UnstrandedReadsAssigned:10212970 PositiveStrandReadsAssigned:5210100 NegativeStrandReadsAssigned:5145327 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207897 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207897-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,739,418 reads, 11,860,507 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,123 rounds 52401 SRR3207897.ke.tsv 34699 SRR3207897.se.tsv 87100 total ==> SRR3207897.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 970 57.6829 Potri.005G024800.1.v4.1 1035 936 224 27.31 Potri.004G059700.1.v4.1 961 862 44 5.825 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 259.2 10.4005 Potri.016G087400.1.v4.1 270 171 400 266.94 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 45 3.06766 Potri.012G127500.1.v4.1 977 878 2340 304.139 ==> SRR3207897.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1130 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 238 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 23 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR3207897 completed mapping pipeline successfully