Starting /dee2/code/volunteer_pipeline.sh SRR3207898 current disk space = 3050678964224 free memory = 1501187764 SRR3207898 SRAfilesize 822fac72c0ff4d0505812a4e5f246180 SRR3207898.sra SRR3207898.sra file validated SRR3207898 is single end SRR3207898 is conventional basespace SRR3207898 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207898_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9725 34.0 33.0 34.0 31.0 34.0 2 33.0085 34.0 33.0 34.0 31.0 34.0 3 33.075 34.0 33.0 34.0 31.0 34.0 4 36.41975 37.0 37.0 37.0 35.0 37.0 5 36.27875 37.0 37.0 37.0 35.0 37.0 6 36.33225 37.0 37.0 37.0 35.0 37.0 7 36.33225 37.0 37.0 37.0 35.0 37.0 8 36.29975 37.0 37.0 37.0 35.0 37.0 9 38.10975 39.0 39.0 39.0 37.0 39.0 10-11 38.087625 39.0 39.0 39.0 36.0 39.0 12-13 38.092375000000004 39.0 39.0 39.0 37.0 39.0 14-15 39.73625 41.0 40.0 41.0 37.5 41.0 16-17 39.6575 41.0 40.0 41.0 37.0 41.0 18-19 39.648875000000004 41.0 40.0 41.0 37.0 41.0 20-21 39.54 41.0 40.0 41.0 37.0 41.0 22-23 39.698125000000005 41.0 40.0 41.0 38.0 41.0 24-25 39.23625 41.0 40.0 41.0 37.0 41.0 26-27 39.473124999999996 41.0 40.0 41.0 36.5 41.0 28-29 39.376 41.0 40.0 41.0 36.5 41.0 30-31 39.406125 41.0 40.0 41.0 37.0 41.0 32-33 39.320750000000004 41.0 40.0 41.0 36.5 41.0 34-35 39.152625 41.0 39.0 41.0 36.0 41.0 36-37 39.122 41.0 39.0 41.0 36.0 41.0 38-39 39.0325 40.0 39.0 41.0 36.0 41.0 40-41 38.938375 40.0 39.0 41.0 35.0 41.0 42-43 38.86475 40.0 38.5 41.0 35.0 41.0 44-45 38.81 40.0 39.0 41.0 35.0 41.0 46-47 38.61875 40.0 38.0 41.0 35.0 41.0 48-49 38.34125 40.0 38.0 41.0 34.5 41.0 50-51 38.284 40.0 38.0 41.0 35.0 41.0 52-53 38.157624999999996 40.0 38.0 41.0 34.0 41.0 54-55 38.164875 40.0 38.0 41.0 34.0 41.0 56-57 38.066500000000005 40.0 37.5 41.0 34.0 41.0 58-59 37.779875000000004 40.0 37.0 41.0 33.5 41.0 60-61 37.789125 40.0 37.0 41.0 33.5 41.0 62-63 37.87525 40.0 37.0 41.0 34.0 41.0 64-65 37.684125 39.0 36.5 41.0 34.0 41.0 66-67 37.334500000000006 39.0 36.0 41.0 33.5 41.0 68-69 36.888125 38.5 35.5 40.5 33.0 41.0 70-71 36.445750000000004 37.0 35.0 39.5 33.0 41.0 72-73 36.146874999999994 37.0 35.0 39.0 33.0 41.0 74-75 35.65375 36.5 35.0 39.0 32.0 40.5 76-77 34.13075 35.0 33.5 37.0 29.5 39.0 78-79 34.716499999999996 35.0 34.5 37.0 31.5 39.0 80-81 34.546375 35.0 35.0 37.0 32.0 39.0 82-83 34.195875 35.0 35.0 36.0 31.0 37.0 84-85 33.933499999999995 35.0 34.5 36.0 31.0 37.0 86-87 33.709 35.0 34.0 35.5 31.0 36.5 88-89 33.480500000000006 35.0 34.0 35.0 31.0 36.0 90-91 33.260625000000005 35.0 34.0 35.0 30.5 36.0 92-93 33.185125 35.0 34.0 35.0 31.0 36.0 94-95 33.0945 35.0 34.0 35.0 31.0 35.5 96-97 32.745999999999995 35.0 34.0 35.0 29.5 35.0 98-99 32.649 35.0 34.0 35.0 29.5 35.0 100 32.56075 35.0 34.0 35.0 30.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 0.0 4 0.0 5 1.0 6 0.0 7 0.0 8 1.0 9 0.0 10 6.0 11 0.0 12 3.0 13 3.0 14 3.0 15 3.0 16 3.0 17 1.0 18 6.0 19 4.0 20 4.0 21 5.0 22 5.0 23 10.0 24 10.0 25 18.0 26 10.0 27 16.0 28 19.0 29 24.0 30 35.0 31 56.0 32 64.0 33 65.0 34 123.0 35 198.0 36 354.0 37 847.0 38 1664.0 39 430.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.224999999999998 14.975 18.099999999999998 42.699999999999996 2 19.400000000000002 24.0 35.949999999999996 20.65 3 21.45 26.724999999999998 28.299999999999997 23.525 4 23.45 31.525 21.425 23.599999999999998 5 24.575 35.449999999999996 22.55 17.424999999999997 6 18.575 38.9 22.625 19.900000000000002 7 16.775000000000002 18.224999999999998 44.05 20.95 8 19.05 23.425 29.65 27.875 9 20.25 22.8 31.924999999999997 25.025 10-11 22.5125 33.4625 22.537499999999998 21.4875 12-13 20.1375 26.674999999999997 29.512500000000003 23.674999999999997 14-15 21.637500000000003 27.250000000000004 29.225 21.8875 16-17 22.425 27.85 27.487499999999997 22.237499999999997 18-19 21.95 28.449999999999996 27.487499999999997 22.112499999999997 20-21 21.865233154144267 28.691086385798226 26.703337917239654 22.740342542817853 22-23 21.1875 28.8625 28.3375 21.6125 24-25 21.4735516372796 28.614609571788414 27.70780856423174 22.20403022670025 26-27 21.512500000000003 28.6125 27.1125 22.7625 28-29 21.5 28.512500000000003 28.1 21.8875 30-31 22.112499999999997 28.075 27.537499999999998 22.275 32-33 21.6875 28.875 27.5875 21.85 34-35 21.762500000000003 28.462500000000002 27.3875 22.3875 36-37 21.3875 29.15 27.325 22.1375 38-39 21.45 28.575 27.537499999999998 22.4375 40-41 21.15 29.2 27.925 21.725 42-43 21.1125 29.4 27.325 22.162499999999998 44-45 21.375 27.725 28.6875 22.2125 46-47 20.875 27.525 28.325 23.275000000000002 48-49 21.811995967741936 27.759576612903224 28.490423387096776 21.938004032258064 50-51 21.240388251607207 28.425564099331908 27.480146224631284 22.853901424429598 52-53 21.45987229247527 29.07224239389007 27.532239889820957 21.935645423813696 54-55 21.4875 28.4 27.8875 22.225 56-57 22.375 28.249999999999996 28.000000000000004 21.375 58-59 21.6125 27.425 28.462500000000002 22.5 60-61 21.587500000000002 28.6375 27.725 22.05 62-63 21.2625 28.3875 27.8875 22.4625 64-65 21.8125 28.212500000000002 28.6875 21.2875 66-67 21.275 27.675 28.5625 22.4875 68-69 21.2875 27.437499999999996 28.5625 22.7125 70-71 21.9625 28.925 26.700000000000003 22.412499999999998 72-73 21.6875 28.6125 27.5875 22.112499999999997 74-75 20.925 29.1125 28.449999999999996 21.512500000000003 76-77 22.05 28.549999999999997 27.1375 22.2625 78-79 20.5375 28.812500000000004 28.749999999999996 21.9 80-81 22.037499999999998 27.762500000000003 28.287499999999998 21.912499999999998 82-83 22.075 27.55 28.212500000000002 22.162499999999998 84-85 21.0 28.0625 28.625 22.3125 86-87 21.65 28.4 27.725 22.225 88-89 21.912499999999998 28.225 27.650000000000002 22.2125 90-91 21.05 28.1375 28.4 22.412499999999998 92-93 22.452806600825102 28.853606700837602 27.853481685210653 20.840105013126642 94-95 21.825 28.549999999999997 28.1 21.525 96-97 21.987499999999997 28.8625 27.875 21.275 98-99 22.7125 28.549999999999997 26.6125 22.125 100 21.43035758939735 29.132283070767688 27.981995498874717 21.45536384096024 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 2.5 27 6.0 28 9.5 29 15.0 30 20.5 31 32.5 32 47.0 33 55.0 34 63.0 35 72.5 36 99.5 37 117.0 38 135.5 39 184.0 40 209.0 41 206.0 42 236.0 43 277.0 44 275.5 45 261.5 46 238.5 47 229.0 48 223.5 49 195.0 50 170.5 51 135.0 52 103.5 53 91.0 54 77.5 55 54.5 56 38.5 57 30.0 58 20.5 59 13.5 60 7.0 61 4.0 62 6.5 63 6.0 64 2.0 65 2.5 66 3.0 67 3.5 68 3.5 69 1.5 70 2.0 71 2.5 72 1.5 73 1.0 74 0.5 75 0.5 76 0.5 77 0.5 78 1.0 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0125 22-23 0.0 24-25 0.75 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.8 50-51 0.8375 52-53 0.1625 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0125 94-95 0.0 96-97 0.0 98-99 0.0 100 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.037500000000000006 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88 0.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAATC 20 0.0020264718 70.34063 2 AAAATCA 25 0.0049075535 56.2725 3 >>END_MODULE Read 801826 spots for SRR3207898.sra Written 801826 spots for SRR3207898.sra Read 801826 spots for SRR3207898.sra Written 801826 spots for SRR3207898.sra Read 801826 spots for SRR3207898.sra Written 801826 spots for SRR3207898.sra Read 801826 spots for SRR3207898.sra Written 801826 spots for SRR3207898.sra Read 801826 spots for SRR3207898.sra Written 801826 spots for SRR3207898.sra Read 801826 spots for SRR3207898.sra Written 801826 spots for SRR3207898.sra Read 801826 spots for SRR3207898.sra Written 801826 spots for SRR3207898.sra Read 801826 spots for SRR3207898.sra Written 801826 spots for SRR3207898.sra Read 801826 spots for SRR3207898.sra Written 801826 spots for SRR3207898.sra Read 801826 spots for SRR3207898.sra Written 801826 spots for SRR3207898.sra Read 801826 spots for SRR3207898.sra Written 801826 spots for SRR3207898.sra Read 801826 spots for SRR3207898.sra Written 801826 spots for SRR3207898.sra Read 801826 spots for SRR3207898.sra Written 801826 spots for SRR3207898.sra Read 801826 spots for SRR3207898.sra Written 801826 spots for SRR3207898.sra Read 801826 spots for SRR3207898.sra Written 801826 spots for SRR3207898.sra Read 801826 spots for SRR3207898.sra Written 801826 spots for SRR3207898.sra Read 801826 spots for SRR3207898.sra Written 801826 spots for SRR3207898.sra Read 801833 spots for SRR3207898.sra Written 801833 spots for SRR3207898.sra Read 801826 spots for SRR3207898.sra Written 801826 spots for SRR3207898.sra Read 801826 spots for SRR3207898.sra Written 801826 spots for SRR3207898.sra SRR ids: ['SRR3207898.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ajmouhln SRR3207898.sra spots: 16036527 blocks: [[1, 801826], [801827, 1603652], [1603653, 2405478], [2405479, 3207304], [3207305, 4009130], [4009131, 4810956], [4810957, 5612782], [5612783, 6414608], [6414609, 7216434], [7216435, 8018260], [8018261, 8820086], [8820087, 9621912], [9621913, 10423738], [10423739, 11225564], [11225565, 12027390], [12027391, 12829216], [12829217, 13631042], [13631043, 14432868], [14432869, 15234694], [15234695, 16036527]] SRR3207898 file size 4162533 SRR3207898 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207898 SRR3207898_1.fastq Input file: SRR3207898_1.fastq trimmed: SRR3207898-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 12:53:36 2025 >> started Tue Feb 11 12:53:45 2025 >> done (9.231s) 16036527 reads processed; of these: 2347 ( 0.01%) short reads filtered out after trimming by size control 26910 ( 0.17%) empty reads filtered out after trimming by size control 16007270 (99.82%) reads available; of these: 697277 ( 4.36%) trimmed reads available after processing 15309993 (95.64%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 368 0.00% 19 402 0.00% 20 452 0.00% 21 607 0.00% 22 768 0.00% 23 1074 0.01% 24 1379 0.01% 25 1704 0.01% 26 1829 0.01% 27 1748 0.01% 28 1822 0.01% 29 1867 0.01% 30 1889 0.01% 31 1950 0.01% 32 2101 0.01% 33 2066 0.01% 34 2206 0.01% 35 2311 0.01% 36 2397 0.01% 37 2470 0.02% 38 2575 0.02% 39 2580 0.02% 40 2644 0.02% 41 2941 0.02% 42 2947 0.02% 43 3083 0.02% 44 3173 0.02% 45 3386 0.02% 46 3451 0.02% 47 3306 0.02% 48 3531 0.02% 49 3675 0.02% 50 3639 0.02% 51 3745 0.02% 52 3975 0.02% 53 4387 0.03% 54 4296 0.03% 55 4659 0.03% 56 4094 0.03% 57 4386 0.03% 58 4268 0.03% 59 4361 0.03% 60 4213 0.03% 61 4673 0.03% 62 4732 0.03% 63 5028 0.03% 64 5939 0.04% 65 5355 0.03% 66 5588 0.03% 67 5969 0.04% 68 6507 0.04% 69 5918 0.04% 70 6139 0.04% 71 6418 0.04% 72 6818 0.04% 73 7214 0.05% 74 7403 0.05% 75 7992 0.05% 76 4376 0.03% 77 4937 0.03% 78 6016 0.04% 79 6882 0.04% 80 7422 0.05% 81 7913 0.05% 82 8340 0.05% 83 9170 0.06% 84 9495 0.06% 85 10835 0.07% 86 11155 0.07% 87 12589 0.08% 88 13381 0.08% 89 14176 0.09% 90 16266 0.10% 91 18928 0.12% 92 22727 0.14% 93 24204 0.15% 94 26893 0.17% 95 32522 0.20% 96 39450 0.25% 97 49967 0.31% 98 60656 0.38% 99 72559 0.45% 100 15309993 95.64% 16007270 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=61.25 fanout-score-rank=10 prefix-density=0.77 prefix-fanout=40.6 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTATGCCGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=17 fanout-score=298.70 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=27.6 sequence=TTCTTCTTCTTC Started job on | Feb 11 12:54:04 Started mapping on | Feb 11 12:54:04 Finished on | Feb 11 12:54:23 Mapping speed, Million of reads per hour | 3032.96 Number of input reads | 16007270 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 15290385 Uniquely mapped reads % | 95.52% Average mapped length | 98.80 Number of splices: Total | 4181344 Number of splices: Annotated (sjdb) | 4095850 Number of splices: GT/AG | 4114595 Number of splices: GC/AG | 54275 Number of splices: AT/AC | 4594 Number of splices: Non-canonical | 7880 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 2.05 Insertion rate per base | 0.02% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 382514 % of reads mapped to multiple loci | 2.39% Number of reads mapped to too many loci | 235408 % of reads mapped to too many loci | 1.47% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.61% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 334371 334371 334371 N_multimapping 382514 382514 382514 N_noFeature 756806 7925606 8008931 N_ambiguous 168381 28084 27901 UnstrandedReadsAssigned:14365198 PositiveStrandReadsAssigned:7336695 NegativeStrandReadsAssigned:7253553 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207898 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207898-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,007,270 reads, 14,880,770 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,109 rounds 52401 SRR3207898.ke.tsv 34699 SRR3207898.se.tsv 87100 total ==> SRR3207898.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 691 33.9327 Potri.005G024800.1.v4.1 1035 936 366 36.8486 Potri.004G059700.1.v4.1 961 862 43 4.70086 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 286.566 9.49534 Potri.016G087400.1.v4.1 270 171 632 348.287 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 46 2.58951 Potri.012G127500.1.v4.1 977 878 2881 309.218 ==> SRR3207898.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1764 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 294 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 40 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 3 SRR3207898 completed mapping pipeline successfully