Starting /dee2/code/volunteer_pipeline.sh SRR3207899 current disk space = 3050601582592 free memory = 1488738956 SRR3207899 SRAfilesize f8800ca765be6f848eb58744e97740e6 SRR3207899.sra SRR3207899.sra file validated SRR3207899 is single end SRR3207899 is conventional basespace SRR3207899 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207899_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0325 34.0 33.0 34.0 31.0 34.0 2 33.02325 34.0 33.0 34.0 31.0 34.0 3 33.16025 34.0 34.0 34.0 31.0 34.0 4 36.433 37.0 37.0 37.0 35.0 37.0 5 36.384 37.0 37.0 37.0 35.0 37.0 6 36.34125 37.0 37.0 37.0 35.0 37.0 7 36.3735 37.0 37.0 37.0 35.0 37.0 8 36.34725 37.0 37.0 37.0 35.0 37.0 9 38.20275 39.0 39.0 39.0 37.0 39.0 10-11 38.17475 39.0 39.0 39.0 37.0 39.0 12-13 38.19375 39.0 39.0 39.0 37.0 39.0 14-15 39.774874999999994 41.0 40.0 41.0 37.5 41.0 16-17 39.763625000000005 41.0 40.0 41.0 37.5 41.0 18-19 39.73350000000001 41.0 40.0 41.0 38.0 41.0 20-21 39.615375 41.0 40.0 41.0 37.0 41.0 22-23 39.774249999999995 41.0 40.0 41.0 38.0 41.0 24-25 39.354124999999996 41.0 40.0 41.0 37.0 41.0 26-27 39.564375 41.0 40.0 41.0 37.0 41.0 28-29 39.495625000000004 41.0 40.0 41.0 37.0 41.0 30-31 39.479875 41.0 40.0 41.0 37.0 41.0 32-33 39.40675 41.0 40.0 41.0 37.0 41.0 34-35 39.288375 41.0 39.0 41.0 36.0 41.0 36-37 39.201625 40.5 39.0 41.0 36.0 41.0 38-39 39.142624999999995 40.5 39.0 41.0 36.0 41.0 40-41 39.011875 40.0 39.0 41.0 35.5 41.0 42-43 38.941 40.0 39.0 41.0 35.0 41.0 44-45 38.832125 40.0 38.0 41.0 35.0 41.0 46-47 38.649125 40.0 38.0 41.0 35.0 41.0 48-49 38.496125 40.0 38.0 41.0 35.0 41.0 50-51 38.352 40.0 38.0 41.0 34.0 41.0 52-53 38.258624999999995 40.0 38.0 41.0 33.5 41.0 54-55 38.191874999999996 40.0 38.0 41.0 34.0 41.0 56-57 38.092375000000004 40.0 37.5 41.0 34.0 41.0 58-59 37.698125000000005 40.0 37.0 41.0 33.0 41.0 60-61 37.743875 40.0 37.0 41.0 33.5 41.0 62-63 37.89575 40.0 37.0 41.0 34.0 41.0 64-65 37.669875000000005 39.0 36.0 41.0 34.0 41.0 66-67 37.35275 39.0 36.0 41.0 33.5 41.0 68-69 36.948499999999996 38.5 35.0 40.0 33.0 41.0 70-71 36.4825 37.0 35.0 39.5 32.5 41.0 72-73 36.15825 37.0 35.0 39.0 33.0 41.0 74-75 35.692375 36.5 35.0 39.0 32.0 40.5 76-77 34.170375 35.0 33.5 37.0 29.5 39.0 78-79 34.736374999999995 35.0 34.5 37.0 31.0 39.0 80-81 34.560874999999996 35.0 35.0 37.0 31.5 39.0 82-83 34.217375 35.0 35.0 36.0 31.0 37.0 84-85 33.98725 35.0 34.0 36.0 31.5 37.0 86-87 33.6905 35.0 34.0 36.0 31.0 36.5 88-89 33.5185 35.0 34.0 35.0 31.0 36.0 90-91 33.32025 35.0 34.0 35.0 31.0 36.0 92-93 33.20525 35.0 34.0 35.0 31.0 36.0 94-95 33.11575 35.0 34.0 35.0 31.0 36.0 96-97 32.735125 35.0 34.0 35.0 29.5 35.0 98-99 32.645250000000004 35.0 34.0 35.0 29.0 35.0 100 32.6085 35.0 34.0 35.0 30.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 2.0 9 0.0 10 0.0 11 3.0 12 2.0 13 5.0 14 4.0 15 1.0 16 3.0 17 4.0 18 5.0 19 3.0 20 6.0 21 4.0 22 5.0 23 4.0 24 3.0 25 7.0 26 19.0 27 25.0 28 31.0 29 20.0 30 35.0 31 50.0 32 61.0 33 99.0 34 115.0 35 187.0 36 345.0 37 891.0 38 1614.0 39 444.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.674999999999997 15.325 17.0 42.0 2 20.575 23.3 36.375 19.75 3 22.25 27.175 28.275 22.3 4 23.849999999999998 33.15 20.599999999999998 22.400000000000002 5 24.375 35.375 22.025 18.224999999999998 6 18.25 37.25 24.75 19.75 7 17.325 15.9 44.15 22.625 8 19.0 23.775 28.525 28.7 9 20.075000000000003 22.400000000000002 31.85 25.674999999999997 10-11 22.565320665083135 33.991748968621074 22.96537067133392 20.47755969496187 12-13 20.6375 25.9875 30.525000000000002 22.85 14-15 21.212500000000002 28.712500000000002 28.349999999999998 21.725 16-17 21.95 27.5875 28.3375 22.125 18-19 21.587500000000002 27.987499999999997 27.700000000000003 22.725 20-21 21.98324371639365 29.461047892959858 27.335250719019633 21.22045767162686 22-23 22.112499999999997 28.462500000000002 27.8875 21.5375 24-25 21.712345989439275 28.715111893386975 27.64646718632135 21.9260749308524 26-27 21.725 28.575 27.1 22.6 28-29 20.925 29.175 27.8875 22.0125 30-31 21.7875 28.749999999999996 27.1125 22.35 32-33 21.425 28.999999999999996 27.650000000000002 21.925 34-35 21.725 29.037499999999998 27.487499999999997 21.75 36-37 21.512500000000003 28.299999999999997 27.987499999999997 22.2 38-39 21.7 29.5 27.200000000000003 21.6 40-41 21.2875 29.4 27.05 22.2625 42-43 21.7 28.375 28.499999999999996 21.425 44-45 22.525000000000002 28.512500000000003 28.1625 20.8 46-47 22.25 29.1875 26.437500000000004 22.125 48-49 21.640291384074352 28.636021100226074 28.22155237377543 21.50213514192414 50-51 21.97083961789844 27.601809954751133 28.443941679235795 21.98340874811463 52-53 21.386559879864848 28.807408334376174 28.43198598423226 21.374045801526716 54-55 22.32087032637239 27.747905464549206 27.622858571964485 22.308365637113916 56-57 21.3125 28.15 28.599999999999998 21.9375 58-59 22.5625 28.325 26.724999999999998 22.3875 60-61 21.224999999999998 29.9875 26.9625 21.825 62-63 21.825 28.475 28.249999999999996 21.45 64-65 21.170438914592975 29.473552582218332 28.23558834562961 21.12042015755908 66-67 22.10829060897837 27.897961735650867 28.03551331749406 21.958234337876704 68-69 22.070776541202953 28.03551331749406 27.960485181943227 21.93322495935976 70-71 21.512500000000003 29.062500000000004 27.2625 22.162499999999998 72-73 21.5 28.962500000000002 27.237499999999997 22.3 74-75 21.212500000000002 28.012500000000003 28.3125 22.4625 76-77 21.9625 28.712500000000002 28.725 20.599999999999998 78-79 22.1 27.825 27.8125 22.2625 80-81 22.0875 28.9375 27.0625 21.912499999999998 82-83 21.675 28.15 28.425 21.75 84-85 21.820682756033513 27.58534450418907 28.660747780417655 21.93322495935976 86-87 22.0 27.8375 28.7375 21.425 88-89 21.75 28.7375 28.15 21.3625 90-91 21.8875 28.575 27.375 22.162499999999998 92-93 22.483431286732525 28.74828060522696 27.285231961985744 21.48305614605477 94-95 21.678759069301975 28.696522391793845 28.071053289967473 21.553665248936703 96-97 22.76422764227642 28.180112570356474 27.817385866166354 21.23827392120075 98-99 22.470926597474055 28.23558834562961 28.048018006752535 21.245467050143805 100 22.842131598699027 27.570678008506377 27.77082812109082 21.816362271703778 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 0.5 20 0.0 21 0.0 22 1.5 23 1.5 24 0.5 25 3.0 26 4.0 27 4.5 28 11.5 29 16.5 30 20.0 31 27.0 32 39.0 33 56.0 34 62.0 35 85.0 36 114.5 37 124.5 38 152.0 39 170.0 40 189.5 41 227.5 42 244.0 43 243.0 44 258.0 45 270.0 46 252.5 47 230.0 48 214.0 49 187.5 50 153.5 51 138.5 52 113.0 53 93.0 54 73.5 55 47.0 56 32.5 57 25.5 58 26.0 59 19.5 60 15.0 61 10.0 62 7.0 63 7.0 64 5.0 65 4.0 66 2.5 67 2.5 68 3.0 69 1.5 70 0.5 71 0.5 72 1.0 73 0.5 74 0.0 75 0.5 76 1.0 77 1.0 78 1.0 79 0.5 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0125 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0375 22-23 0.0 24-25 0.575 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.475 50-51 0.5499999999999999 52-53 0.11249999999999999 54-55 0.0375 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0375 66-67 0.0375 68-69 0.0375 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0375 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0375 94-95 0.075 96-97 0.0625 98-99 0.0375 100 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.1 0.0 0.0 0.0 0.0 12-13 0.1 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.1 0.0 0.0 0.0 0.0 22-23 0.1 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.16249999999999998 0.0 0.0 0.0 0.0 70-71 0.21250000000000002 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.2625 0.0 0.0 0.0 0.0 76-77 0.36250000000000004 0.0 0.0 0.0 0.0 78-79 0.4 0.0 0.0 0.0 0.0 80-81 0.5 0.0 0.0 0.0 0.0 82-83 0.675 0.0 0.0 0.0 0.0 84-85 0.85 0.0 0.0 0.0 0.0 86-87 1.0 0.0 0.0 0.0 0.0 88 1.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1039944 spots for SRR3207899.sra Written 1039944 spots for SRR3207899.sra Read 1039944 spots for SRR3207899.sra Written 1039944 spots for SRR3207899.sra Read 1039944 spots for SRR3207899.sra Written 1039944 spots for SRR3207899.sra Read 1039944 spots for SRR3207899.sra Written 1039944 spots for SRR3207899.sra Read 1039944 spots for SRR3207899.sra Written 1039944 spots for SRR3207899.sra Read 1039944 spots for SRR3207899.sra Written 1039944 spots for SRR3207899.sra Read 1039944 spots for SRR3207899.sra Written 1039944 spots for SRR3207899.sra Read 1039944 spots for SRR3207899.sra Written 1039944 spots for SRR3207899.sra Read 1039944 spots for SRR3207899.sra Written 1039944 spots for SRR3207899.sra Read 1039944 spots for SRR3207899.sra Written 1039944 spots for SRR3207899.sra Read 1039944 spots for SRR3207899.sra Written 1039944 spots for SRR3207899.sra Read 1039944 spots for SRR3207899.sra Written 1039944 spots for SRR3207899.sra Read 1039944 spots for SRR3207899.sra Written 1039944 spots for SRR3207899.sra Read 1039944 spots for SRR3207899.sra Written 1039944 spots for SRR3207899.sra Read 1039944 spots for SRR3207899.sra Written 1039944 spots for SRR3207899.sra Read 1039944 spots for SRR3207899.sra Written 1039944 spots for SRR3207899.sra Read 1039944 spots for SRR3207899.sra Written 1039944 spots for SRR3207899.sra Read 1039944 spots for SRR3207899.sra Written 1039944 spots for SRR3207899.sra Read 1039944 spots for SRR3207899.sra Written 1039944 spots for SRR3207899.sra Read 1039951 spots for SRR3207899.sra Written 1039951 spots for SRR3207899.sra SRR ids: ['SRR3207899.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9p1wg80g SRR3207899.sra spots: 20798887 blocks: [[1, 1039944], [1039945, 2079888], [2079889, 3119832], [3119833, 4159776], [4159777, 5199720], [5199721, 6239664], [6239665, 7279608], [7279609, 8319552], [8319553, 9359496], [9359497, 10399440], [10399441, 11439384], [11439385, 12479328], [12479329, 13519272], [13519273, 14559216], [14559217, 15599160], [15599161, 16639104], [16639105, 17679048], [17679049, 18718992], [18718993, 19758936], [19758937, 20798887]] SRR3207899 file size 5401900 SRR3207899 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207899 SRR3207899_1.fastq Input file: SRR3207899_1.fastq trimmed: SRR3207899-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 12:50:01 2025 >> started Tue Feb 11 12:50:11 2025 >> done (10.170s) 20798887 reads processed; of these: 2864 ( 0.01%) short reads filtered out after trimming by size control 37310 ( 0.18%) empty reads filtered out after trimming by size control 20758713 (99.81%) reads available; of these: 888351 ( 4.28%) trimmed reads available after processing 19870362 (95.72%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 410 0.00% 19 505 0.00% 20 516 0.00% 21 675 0.00% 22 955 0.00% 23 1289 0.01% 24 1663 0.01% 25 2151 0.01% 26 2295 0.01% 27 2171 0.01% 28 2290 0.01% 29 2299 0.01% 30 2351 0.01% 31 2450 0.01% 32 2678 0.01% 33 2608 0.01% 34 2753 0.01% 35 2947 0.01% 36 3079 0.01% 37 3119 0.02% 38 3233 0.02% 39 3300 0.02% 40 3401 0.02% 41 3563 0.02% 42 3698 0.02% 43 3947 0.02% 44 4074 0.02% 45 4257 0.02% 46 4291 0.02% 47 4158 0.02% 48 4497 0.02% 49 4782 0.02% 50 4777 0.02% 51 4952 0.02% 52 5185 0.02% 53 5895 0.03% 54 5651 0.03% 55 6004 0.03% 56 5437 0.03% 57 5528 0.03% 58 5742 0.03% 59 5972 0.03% 60 5690 0.03% 61 6373 0.03% 62 6615 0.03% 63 6937 0.03% 64 8419 0.04% 65 7357 0.04% 66 7991 0.04% 67 8298 0.04% 68 9045 0.04% 69 7287 0.04% 70 7641 0.04% 71 8211 0.04% 72 8610 0.04% 73 8998 0.04% 74 9274 0.04% 75 9997 0.05% 76 5542 0.03% 77 6501 0.03% 78 7753 0.04% 79 8439 0.04% 80 9125 0.04% 81 9934 0.05% 82 10478 0.05% 83 11389 0.05% 84 12373 0.06% 85 13288 0.06% 86 14218 0.07% 87 15700 0.08% 88 16874 0.08% 89 17602 0.08% 90 20301 0.10% 91 23975 0.12% 92 29113 0.14% 93 30720 0.15% 94 34256 0.17% 95 41066 0.20% 96 49594 0.24% 97 63318 0.31% 98 76815 0.37% 99 91686 0.44% 100 19870362 95.72% 20758713 reads passed initial QC criterion=sequence-density sequence-density=0.81 sequence-density-rank=1 fanout-score=58.44 fanout-score-rank=4 prefix-density=1.16 prefix-fanout=40.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATGCCGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=258.25 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=15.5 sequence=CAGCAGCAAGACAAACCGAATTATTCATAAGTACCAATAAAATAAGCATTGCGCAAAAGGGATAGGATAAATCACTCTTAAGCTTGAGGCTTCTCCCATTTGAGGGGCTTGACAACTTCCCAGGTGAAGTCTGGGTCATCCCTTCCAAAATGTCCGTATGCAGCTGTCTTCAAGAACCTATTACCCCCCCTCTTGAGATCCAGGTTGATGGTCATCATTCCAGGCCTAAAGTCAAAGCTCTCCTTCACAATCTTAAGGATCTCCTTGTCAGGAATTTTTCCAGTGCCATAGGTGTCCACAAAGACTGACAAAGGCTCAGGTACACCAATAGCATAGGAAACTTGCACAATGCACCTACGAGCAAGACCATTTGCTACGATGCTCTTGGCAGCTT Started job on | Feb 11 12:50:27 Started mapping on | Feb 11 12:50:27 Finished on | Feb 11 12:50:46 Mapping speed, Million of reads per hour | 3933.23 Number of input reads | 20758713 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 19864656 Uniquely mapped reads % | 95.69% Average mapped length | 98.73 Number of splices: Total | 5465336 Number of splices: Annotated (sjdb) | 5351360 Number of splices: GT/AG | 5378344 Number of splices: GC/AG | 70342 Number of splices: AT/AC | 6003 Number of splices: Non-canonical | 10647 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 2.00 Insertion rate per base | 0.02% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 518609 % of reads mapped to multiple loci | 2.50% Number of reads mapped to too many loci | 249198 % of reads mapped to too many loci | 1.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.60% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 375448 375448 375448 N_multimapping 518609 518609 518609 N_noFeature 956832 10296624 10378723 N_ambiguous 220250 37045 37400 UnstrandedReadsAssigned:18687574 PositiveStrandReadsAssigned:9530987 NegativeStrandReadsAssigned:9448533 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207899 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207899-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,758,713 reads, 19,336,304 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,129 rounds 52401 SRR3207899.ke.tsv 34699 SRR3207899.se.tsv 87100 total ==> SRR3207899.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1130 43.9426 Potri.005G024800.1.v4.1 1035 936 731 58.2806 Potri.004G059700.1.v4.1 961 862 96 8.31087 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 473.533 12.4252 Potri.016G087400.1.v4.1 270 171 848.49 370.283 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 60 2.67472 Potri.012G127500.1.v4.1 977 878 1370 116.442 ==> SRR3207899.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2734 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 289 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 56 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR3207899 completed mapping pipeline successfully