Starting /dee2/code/volunteer_pipeline.sh SRR3207900 current disk space = 3050372009984 free memory = 1567266136 SRR3207900 SRAfilesize 02fd379bf31e04c6584c3f6c427d1e5e SRR3207900.sra SRR3207900.sra file validated SRR3207900 is single end SRR3207900 is conventional basespace SRR3207900 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207900_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.858 34.0 31.0 34.0 31.0 34.0 2 33.04425 34.0 31.0 34.0 31.0 34.0 3 33.20525 34.0 34.0 34.0 31.0 34.0 4 36.452 37.0 37.0 37.0 35.0 37.0 5 36.44175 37.0 37.0 37.0 35.0 37.0 6 36.46025 37.0 37.0 37.0 35.0 37.0 7 36.41425 37.0 37.0 37.0 35.0 37.0 8 36.4505 37.0 37.0 37.0 35.0 37.0 9 38.29425 39.0 39.0 39.0 37.0 39.0 10-11 38.238375000000005 39.0 39.0 39.0 37.0 39.0 12-13 37.977625 39.0 38.5 39.0 36.0 39.0 14-15 39.58475 41.0 40.0 41.0 37.0 41.0 16-17 39.505375 41.0 39.5 41.0 37.0 41.0 18-19 39.50875 41.0 39.5 41.0 36.5 41.0 20-21 39.517125 41.0 40.0 41.0 37.0 41.0 22-23 39.460875 41.0 39.0 41.0 37.0 41.0 24-25 38.972375 40.5 39.0 41.0 35.0 41.0 26-27 38.70725 40.0 38.5 41.0 34.5 41.0 28-29 38.902125 40.0 38.5 41.0 35.0 41.0 30-31 38.696749999999994 40.0 38.0 41.0 35.0 41.0 32-33 39.017375 40.5 39.0 41.0 35.5 41.0 34-35 39.007875 40.0 39.0 41.0 35.0 41.0 36-37 38.802875 40.0 38.5 41.0 35.0 41.0 38-39 38.592125 40.0 38.0 41.0 34.5 41.0 40-41 38.176249999999996 40.0 38.0 41.0 33.5 41.0 42-43 38.286500000000004 40.0 38.0 41.0 34.0 41.0 44-45 38.03875 40.0 37.5 41.0 33.5 41.0 46-47 37.998125 40.0 37.0 41.0 33.0 41.0 48-49 37.908874999999995 40.0 37.0 41.0 33.0 41.0 50-51 37.462125 40.0 36.0 41.0 32.0 41.0 52-53 37.411874999999995 40.0 36.0 41.0 33.0 41.0 54-55 37.382000000000005 40.0 36.0 41.0 33.0 41.0 56-57 36.855374999999995 39.0 35.0 41.0 31.5 41.0 58-59 36.518375 39.0 35.0 41.0 31.0 41.0 60-61 36.058125000000004 38.0 35.0 40.5 30.0 41.0 62-63 35.826875 38.0 35.0 40.0 30.0 41.0 64-65 35.529125 37.0 35.0 40.0 29.5 41.0 66-67 34.77175 36.5 34.0 39.5 28.0 41.0 68-69 34.77975 36.0 34.0 39.0 29.0 41.0 70-71 34.222125 36.0 34.0 39.0 28.5 40.0 72-73 33.870375 35.0 34.0 37.5 28.0 39.5 74-75 33.54575 35.0 34.0 37.0 28.0 39.0 76-77 32.463499999999996 34.5 32.0 36.0 26.5 38.5 78-79 32.939499999999995 35.0 33.0 36.0 27.5 38.0 80-81 32.790625 35.0 33.5 36.0 27.0 37.0 82-83 32.428875000000005 35.0 33.0 35.5 26.5 37.0 84-85 32.18875 35.0 33.0 35.0 26.5 36.5 86-87 31.762 35.0 33.0 35.0 25.0 36.0 88-89 31.56275 35.0 33.0 35.0 24.5 36.0 90-91 31.272 35.0 32.5 35.0 24.0 35.5 92-93 31.00075 35.0 32.0 35.0 23.0 35.0 94-95 30.900125000000003 35.0 32.0 35.0 23.0 35.0 96-97 30.5385 34.0 31.5 35.0 19.0 35.0 98-99 30.161749999999998 34.0 31.0 35.0 6.0 35.0 100 29.758 34.0 31.0 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 2.0 9 0.0 10 5.0 11 4.0 12 5.0 13 7.0 14 7.0 15 10.0 16 13.0 17 9.0 18 16.0 19 14.0 20 15.0 21 5.0 22 16.0 23 15.0 24 18.0 25 24.0 26 36.0 27 31.0 28 34.0 29 58.0 30 47.0 31 80.0 32 111.0 33 121.0 34 184.0 35 255.0 36 450.0 37 941.0 38 1266.0 39 200.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.199999999999996 13.0 15.925 42.875 2 22.175 19.375 32.775 25.674999999999997 3 24.349999999999998 22.55 24.25 28.849999999999998 4 27.6 29.225 17.9 25.275 5 27.33866933466733 32.91645822911456 20.76038019009505 18.98449224612306 6 22.475 35.35 22.275 19.900000000000002 7 19.900000000000002 20.1 38.725 21.275 8 21.075 23.150000000000002 27.900000000000002 27.875 9 22.55 21.625 29.349999999999998 26.474999999999998 10-11 24.2 31.637500000000003 21.8 22.3625 12-13 22.5875 26.7625 27.125 23.525 14-15 23.12695434646654 26.454033771106943 26.52908067542214 23.889931207004377 16-17 23.549999999999997 26.375 26.25 23.825 18-19 23.724999999999998 26.400000000000002 26.35 23.525 20-21 22.875 27.287499999999998 27.025 22.8125 22-23 23.5625 26.7125 26.5375 23.1875 24-25 22.5 27.6 25.900000000000002 24.0 26-27 23.7625 25.9875 27.1 23.150000000000002 28-29 23.724999999999998 26.625 26.4125 23.2375 30-31 22.400000000000002 26.55 27.987499999999997 23.0625 32-33 25.0375 25.8625 25.637500000000003 23.4625 34-35 23.925 26.637499999999996 26.525 22.912499999999998 36-37 23.200000000000003 26.4625 26.7125 23.625 38-39 23.825 25.974999999999998 25.95 24.25 40-41 23.375 26.625 25.4375 24.5625 42-43 23.1125 27.200000000000003 26.025 23.6625 44-45 24.0125 26.9625 26.3625 22.662499999999998 46-47 23.3625 26.137500000000003 26.087500000000002 24.4125 48-49 23.4625 26.825 25.9875 23.724999999999998 50-51 23.674999999999997 26.6625 25.174999999999997 24.4875 52-53 23.967975981986488 26.45734300725544 26.594946209657245 22.979734801100825 54-55 23.549999999999997 26.637499999999996 25.7 24.1125 56-57 22.287499999999998 26.737499999999997 27.075 23.9 58-59 23.5875 26.85 26.987499999999997 22.575 60-61 23.8375 25.9875 27.3125 22.8625 62-63 24.349999999999998 25.5625 27.025 23.0625 64-65 23.200000000000003 26.075 26.825 23.9 66-67 23.3875 26.887499999999996 26.075 23.65 68-69 23.0375 27.525 25.6 23.8375 70-71 24.1625 27.200000000000003 25.637500000000003 23.0 72-73 23.7875 26.924999999999997 26.1125 23.175 74-75 23.1 27.3375 26.0375 23.525 76-77 24.5625 27.400000000000002 24.837500000000002 23.200000000000003 78-79 23.7375 25.5 26.5875 24.175 80-81 23.8875 26.525 26.487500000000004 23.1 82-83 24.2875 26.875 25.4625 23.375 84-85 24.3 27.200000000000003 25.5125 22.9875 86-87 24.2875 26.5375 26.150000000000002 23.025000000000002 88-89 24.1375 25.912499999999998 26.337500000000002 23.6125 90-91 24.125 26.450000000000003 26.0375 23.3875 92-93 23.5 27.4125 26.275 22.8125 94-95 24.4 25.525 26.275 23.799999999999997 96-97 23.4125 26.237500000000004 26.437500000000004 23.9125 98-99 24.212500000000002 26.875 25.7375 23.175 100 23.7 25.85 27.925 22.525000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 1.5 23 1.5 24 2.0 25 4.0 26 3.5 27 5.0 28 6.0 29 7.5 30 9.0 31 12.0 32 20.0 33 31.5 34 41.0 35 49.5 36 61.0 37 78.5 38 101.5 39 126.0 40 154.0 41 181.0 42 191.0 43 206.5 44 223.0 45 217.0 46 220.5 47 226.5 48 216.5 49 200.5 50 173.0 51 146.0 52 129.5 53 109.0 54 88.5 55 76.5 56 74.0 57 69.5 58 60.0 59 57.0 60 49.5 61 43.5 62 45.0 63 38.0 64 31.0 65 23.0 66 17.0 67 13.5 68 12.0 69 17.5 70 16.5 71 12.5 72 15.0 73 16.5 74 14.0 75 14.0 76 14.0 77 11.0 78 7.5 79 3.5 80 2.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0625 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.075 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.875 #Duplication Level Percentage of deduplicated Percentage of total 1 97.49677419354839 94.45 2 2.038709677419355 3.95 3 0.36129032258064514 1.05 4 0.07741935483870968 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025806451612903226 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGC 10 0.25 TruSeq Adapter, Index 6 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88 0.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1299245 spots for SRR3207900.sra Written 1299245 spots for SRR3207900.sra Read 1299245 spots for SRR3207900.sra Written 1299245 spots for SRR3207900.sra Read 1299245 spots for SRR3207900.sra Written 1299245 spots for SRR3207900.sra Read 1299245 spots for SRR3207900.sra Written 1299245 spots for SRR3207900.sra Read 1299245 spots for SRR3207900.sra Written 1299245 spots for SRR3207900.sra Read 1299245 spots for SRR3207900.sra Written 1299245 spots for SRR3207900.sra Read 1299245 spots for SRR3207900.sra Written 1299245 spots for SRR3207900.sra Read 1299245 spots for SRR3207900.sra Written 1299245 spots for SRR3207900.sra Read 1299245 spots for SRR3207900.sra Written 1299245 spots for SRR3207900.sra Read 1299245 spots for SRR3207900.sra Written 1299245 spots for SRR3207900.sra Read 1299245 spots for SRR3207900.sra Written 1299245 spots for SRR3207900.sra Read 1299245 spots for SRR3207900.sra Written 1299245 spots for SRR3207900.sra Read 1299245 spots for SRR3207900.sra Written 1299245 spots for SRR3207900.sra Read 1299245 spots for SRR3207900.sra Written 1299245 spots for SRR3207900.sra Read 1299245 spots for SRR3207900.sra Written 1299245 spots for SRR3207900.sra Read 1299245 spots for SRR3207900.sra Written 1299245 spots for SRR3207900.sra Read 1299251 spots for SRR3207900.sra Written 1299251 spots for SRR3207900.sra Read 1299245 spots for SRR3207900.sra Written 1299245 spots for SRR3207900.sra Read 1299245 spots for SRR3207900.sra Written 1299245 spots for SRR3207900.sra Read 1299245 spots for SRR3207900.sra Written 1299245 spots for SRR3207900.sra SRR ids: ['SRR3207900.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z83u72dg SRR3207900.sra spots: 25984906 blocks: [[1, 1299245], [1299246, 2598490], [2598491, 3897735], [3897736, 5196980], [5196981, 6496225], [6496226, 7795470], [7795471, 9094715], [9094716, 10393960], [10393961, 11693205], [11693206, 12992450], [12992451, 14291695], [14291696, 15590940], [15590941, 16890185], [16890186, 18189430], [18189431, 19488675], [19488676, 20787920], [20787921, 22087165], [22087166, 23386410], [23386411, 24685655], [24685656, 25984906]] SRR3207900 file size 6751485 SRR3207900 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207900 SRR3207900_1.fastq Input file: SRR3207900_1.fastq trimmed: SRR3207900-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 13:43:08 2025 >> started Tue Feb 11 13:43:21 2025 >> done (12.643s) 25984906 reads processed; of these: 4246 ( 0.02%) short reads filtered out after trimming by size control 70052 ( 0.27%) empty reads filtered out after trimming by size control 25910608 (99.71%) reads available; of these: 2872367 (11.09%) trimmed reads available after processing 23038241 (88.91%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 953 0.00% 19 1084 0.00% 20 1462 0.01% 21 1915 0.01% 22 2670 0.01% 23 3411 0.01% 24 4660 0.02% 25 6247 0.02% 26 5969 0.02% 27 6197 0.02% 28 6168 0.02% 29 6300 0.02% 30 6810 0.03% 31 6476 0.02% 32 6936 0.03% 33 7046 0.03% 34 7722 0.03% 35 8165 0.03% 36 9053 0.03% 37 9060 0.03% 38 9434 0.04% 39 9934 0.04% 40 10431 0.04% 41 10759 0.04% 42 11341 0.04% 43 12263 0.05% 44 12413 0.05% 45 12749 0.05% 46 13192 0.05% 47 13967 0.05% 48 14578 0.06% 49 15368 0.06% 50 15765 0.06% 51 16641 0.06% 52 16986 0.07% 53 18190 0.07% 54 20615 0.08% 55 20854 0.08% 56 21391 0.08% 57 21663 0.08% 58 23126 0.09% 59 21924 0.08% 60 22770 0.09% 61 23057 0.09% 62 23791 0.09% 63 23864 0.09% 64 24250 0.09% 65 24557 0.09% 66 24163 0.09% 67 24835 0.10% 68 26125 0.10% 69 26647 0.10% 70 26783 0.10% 71 28733 0.11% 72 28796 0.11% 73 29090 0.11% 74 29754 0.11% 75 29885 0.12% 76 20191 0.08% 77 23267 0.09% 78 27362 0.11% 79 29910 0.12% 80 32371 0.12% 81 35516 0.14% 82 39890 0.15% 83 41824 0.16% 84 44015 0.17% 85 48310 0.19% 86 51519 0.20% 87 55888 0.22% 88 60393 0.23% 89 67032 0.26% 90 73443 0.28% 91 82457 0.32% 92 96775 0.37% 93 105700 0.41% 94 121510 0.47% 95 145649 0.56% 96 165139 0.64% 97 194683 0.75% 98 221168 0.85% 99 219367 0.85% 100 23038241 88.91% 25910608 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=22 prefix-density=0.33 prefix-fanout=2.0 sequence=CCGGCGATGCGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=21 fanout-score=171.68 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=21.6 sequence=AAGAAGAAGAAA Started job on | Feb 11 13:43:38 Started mapping on | Feb 11 13:43:38 Finished on | Feb 11 13:44:27 Mapping speed, Million of reads per hour | 1903.64 Number of input reads | 25910608 Average input read length | 97 UNIQUE READS: Uniquely mapped reads number | 18184460 Uniquely mapped reads % | 70.18% Average mapped length | 98.27 Number of splices: Total | 4995001 Number of splices: Annotated (sjdb) | 4899059 Number of splices: GT/AG | 4913494 Number of splices: GC/AG | 67368 Number of splices: AT/AC | 5628 Number of splices: Non-canonical | 8511 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 2.06 Insertion rate per base | 0.01% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 712889 % of reads mapped to multiple loci | 2.75% Number of reads mapped to too many loci | 6649111 % of reads mapped to too many loci | 25.66% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.37% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 7013259 7013259 7013259 N_multimapping 712889 712889 712889 N_noFeature 861017 9393164 9524719 N_ambiguous 191832 32486 32046 UnstrandedReadsAssigned:17131611 PositiveStrandReadsAssigned:8758810 NegativeStrandReadsAssigned:8627695 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207900 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207900-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,910,608 reads, 23,641,451 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,103 rounds 52401 SRR3207900.ke.tsv 34699 SRR3207900.se.tsv 87100 total ==> SRR3207900.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1186 32.515 Potri.005G024800.1.v4.1 1035 936 428 24.057 Potri.004G059700.1.v4.1 961 862 33 2.0141 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 494.26 9.14323 Potri.016G087400.1.v4.1 270 171 765 235.364 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 46 1.44569 Potri.012G127500.1.v4.1 977 878 3030 181.561 ==> SRR3207900.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1361 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 299 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 18 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 5 SRR3207900 completed mapping pipeline successfully