Starting /dee2/code/volunteer_pipeline.sh SRR3207901 current disk space = 3050571657216 free memory = 1442963720 SRR3207901 SRAfilesize fb04212c3bc3aa9f16912e6a0d914d65 SRR3207901.sra SRR3207901.sra file validated SRR3207901 is single end SRR3207901 is conventional basespace SRR3207901 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207901_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.882 34.0 31.0 34.0 31.0 34.0 2 33.01875 34.0 33.0 34.0 31.0 34.0 3 33.1725 34.0 34.0 34.0 31.0 34.0 4 36.387 37.0 37.0 37.0 35.0 37.0 5 36.4505 37.0 37.0 37.0 35.0 37.0 6 36.45425 37.0 37.0 37.0 35.0 37.0 7 36.4125 37.0 37.0 37.0 35.0 37.0 8 36.3805 37.0 37.0 37.0 35.0 37.0 9 38.2585 39.0 39.0 39.0 37.0 39.0 10-11 38.213125 39.0 39.0 39.0 37.0 39.0 12-13 38.0185 39.0 38.5 39.0 36.0 39.0 14-15 39.59675 41.0 40.0 41.0 37.0 41.0 16-17 39.550375 41.0 39.5 41.0 37.0 41.0 18-19 39.545874999999995 41.0 40.0 41.0 37.0 41.0 20-21 39.56325 41.0 40.0 41.0 37.0 41.0 22-23 39.495375 41.0 39.5 41.0 37.0 41.0 24-25 39.096999999999994 41.0 39.0 41.0 35.5 41.0 26-27 38.915875 40.5 38.5 41.0 35.0 41.0 28-29 39.033500000000004 40.5 39.0 41.0 36.0 41.0 30-31 38.888374999999996 40.5 39.0 41.0 35.0 41.0 32-33 39.203500000000005 41.0 39.0 41.0 36.0 41.0 34-35 39.202749999999995 41.0 39.0 41.0 36.0 41.0 36-37 38.931 41.0 39.0 41.0 35.5 41.0 38-39 38.7345 40.0 38.5 41.0 35.0 41.0 40-41 38.4595 40.0 38.0 41.0 34.0 41.0 42-43 38.65275 40.0 38.5 41.0 35.0 41.0 44-45 38.497875 40.0 38.0 41.0 34.5 41.0 46-47 38.52225 40.0 38.0 41.0 34.5 41.0 48-49 38.391875 40.0 38.0 41.0 34.5 41.0 50-51 38.077124999999995 40.0 38.0 41.0 33.0 41.0 52-53 38.1175 40.0 38.0 41.0 33.5 41.0 54-55 38.0745 40.0 38.0 41.0 34.0 41.0 56-57 37.774125 40.0 37.0 41.0 33.0 41.0 58-59 37.374875 40.0 37.0 41.0 32.5 41.0 60-61 36.84125 39.0 36.0 41.0 31.0 41.0 62-63 36.783625 39.0 36.0 41.0 31.0 41.0 64-65 36.522 39.0 35.0 40.0 31.0 41.0 66-67 35.862125 38.0 35.0 40.0 30.0 41.0 68-69 35.718125 37.0 35.0 40.0 30.0 41.0 70-71 35.207499999999996 37.0 34.5 39.0 29.5 41.0 72-73 34.888875 36.0 34.5 39.0 29.5 40.5 74-75 34.47 36.0 34.0 38.0 29.5 39.5 76-77 33.402 35.0 33.0 36.5 28.5 39.0 78-79 33.818125 35.0 34.0 37.0 29.5 39.0 80-81 33.593 35.0 34.0 36.5 29.5 37.5 82-83 33.22125 35.0 34.0 36.0 29.0 37.0 84-85 33.02975 35.0 34.0 35.5 29.0 37.0 86-87 32.71125 35.0 34.0 35.0 28.5 36.0 88-89 32.326375 35.0 33.0 35.0 27.5 36.0 90-91 32.060875 35.0 33.0 35.0 27.0 36.0 92-93 31.8395 35.0 33.0 35.0 26.5 35.0 94-95 31.7245 35.0 33.0 35.0 26.0 35.0 96-97 31.264125 35.0 32.5 35.0 24.0 35.0 98-99 31.047125 34.0 32.0 35.0 24.0 35.0 100 30.7765 34.0 32.0 35.0 23.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 1.0 7 2.0 8 0.0 9 4.0 10 3.0 11 4.0 12 6.0 13 6.0 14 7.0 15 6.0 16 5.0 17 8.0 18 9.0 19 10.0 20 11.0 21 8.0 22 8.0 23 12.0 24 17.0 25 13.0 26 31.0 27 23.0 28 24.0 29 47.0 30 61.0 31 51.0 32 76.0 33 102.0 34 139.0 35 230.0 36 364.0 37 878.0 38 1560.0 39 273.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.125 14.274999999999999 14.975 41.625 2 19.55 22.2 35.3 22.95 3 22.5 25.3 26.275 25.924999999999997 4 25.424999999999997 29.875 20.474999999999998 24.224999999999998 5 25.424999999999997 34.9 20.95 18.725 6 20.75 35.975 24.224999999999998 19.05 7 16.875 21.2 41.375 20.549999999999997 8 20.25 23.724999999999998 31.1 24.925 9 21.175 23.125 32.4 23.3 10-11 22.875 33.375 22.9375 20.8125 12-13 21.5625 26.674999999999997 29.012500000000003 22.75 14-15 21.717929482370593 27.644411102775695 28.244561140285075 22.393098274568644 16-17 21.5375 28.487499999999997 27.650000000000002 22.325 18-19 23.0 27.474999999999998 26.8 22.725 20-21 21.8875 28.325 27.237499999999997 22.55 22-23 21.349999999999998 28.625 27.737499999999997 22.287499999999998 24-25 22.537499999999998 28.4125 27.125 21.925 26-27 21.575 28.4375 28.012500000000003 21.975 28-29 22.0125 28.449999999999996 27.625 21.912499999999998 30-31 21.55 28.000000000000004 27.737499999999997 22.7125 32-33 22.275 28.6875 26.4625 22.575 34-35 22.7375 28.1125 27.500000000000004 21.65 36-37 22.75 28.1875 27.375 21.6875 38-39 22.375 27.9375 27.6 22.0875 40-41 22.725 28.1 27.537499999999998 21.637500000000003 42-43 21.6125 28.1125 28.349999999999998 21.925 44-45 22.55 27.787499999999998 27.6875 21.975 46-47 21.8125 28.95 27.750000000000004 21.4875 48-49 21.9375 28.012500000000003 27.787499999999998 22.2625 50-51 21.75 28.0625 27.6875 22.5 52-53 22.041531148361273 28.633975481611206 27.370527895921942 21.95396547410558 54-55 21.587500000000002 28.349999999999998 27.0875 22.975 56-57 21.712500000000002 29.325000000000003 27.05 21.912499999999998 58-59 22.925 28.3125 26.825 21.9375 60-61 21.8125 27.0625 28.212500000000002 22.912499999999998 62-63 23.0375 27.287499999999998 27.9375 21.7375 64-65 22.0625 28.749999999999996 27.875 21.3125 66-67 21.775 29.012500000000003 27.6875 21.525 68-69 22.5 28.037499999999998 28.6625 20.8 70-71 22.7375 28.962500000000002 27.525 20.775 72-73 21.5 28.050000000000004 28.3375 22.112499999999997 74-75 22.35 28.050000000000004 27.625 21.975 76-77 22.3625 27.762500000000003 28.287499999999998 21.587500000000002 78-79 22.3625 27.3125 27.975 22.35 80-81 21.6 28.9875 27.762500000000003 21.65 82-83 22.475 28.8875 27.8625 20.775 84-85 21.2875 28.249999999999996 28.375 22.0875 86-87 21.775 28.1625 27.575 22.4875 88-89 22.25 28.1625 28.050000000000004 21.5375 90-91 22.5 28.000000000000004 27.5625 21.9375 92-93 22.1875 27.9125 27.975 21.925 94-95 22.325 28.1375 28.449999999999996 21.087500000000002 96-97 21.975 27.575 27.962500000000002 22.4875 98-99 22.8625 27.962500000000002 27.375 21.8 100 21.95 29.025000000000002 27.224999999999998 21.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 2.0 24 2.5 25 2.5 26 5.0 27 5.5 28 8.0 29 14.0 30 15.0 31 20.0 32 35.5 33 39.0 34 51.0 35 76.5 36 84.5 37 109.5 38 138.0 39 154.5 40 195.5 41 231.0 42 247.5 43 257.5 44 268.5 45 265.0 46 256.5 47 259.5 48 234.0 49 182.0 50 148.5 51 138.5 52 117.0 53 98.0 54 82.5 55 56.5 56 32.0 57 28.5 58 29.0 59 20.0 60 19.0 61 14.5 62 8.5 63 7.0 64 5.0 65 5.0 66 5.0 67 2.5 68 2.0 69 3.0 70 1.5 71 1.0 72 2.0 73 1.5 74 1.0 75 1.5 76 2.0 77 1.0 78 0.5 79 1.0 80 1.5 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.025 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.075 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69887076537015 99.325 2 0.27603513174404015 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.02509410288582183 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC 5 0.125 TruSeq Adapter, Index 7 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88 0.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 554118 spots for SRR3207901.sra Written 554118 spots for SRR3207901.sra Read 554118 spots for SRR3207901.sra Written 554118 spots for SRR3207901.sra Read 554118 spots for SRR3207901.sra Written 554118 spots for SRR3207901.sra Read 554118 spots for SRR3207901.sra Written 554118 spots for SRR3207901.sra Read 554118 spots for SRR3207901.sra Written 554118 spots for SRR3207901.sra Read 554118 spots for SRR3207901.sra Written 554118 spots for SRR3207901.sra Read 554118 spots for SRR3207901.sra Written 554118 spots for SRR3207901.sra Read 554118 spots for SRR3207901.sra Written 554118 spots for SRR3207901.sra Read 554118 spots for SRR3207901.sra Written 554118 spots for SRR3207901.sra Read 554118 spots for SRR3207901.sra Written 554118 spots for SRR3207901.sra Read 554118 spots for SRR3207901.sra Written 554118 spots for SRR3207901.sra Read 554118 spots for SRR3207901.sra Written 554118 spots for SRR3207901.sra Read 554118 spots for SRR3207901.sra Written 554118 spots for SRR3207901.sra Read 554118 spots for SRR3207901.sra Written 554118 spots for SRR3207901.sra Read 554123 spots for SRR3207901.sra Written 554123 spots for SRR3207901.sra Read 554118 spots for SRR3207901.sra Written 554118 spots for SRR3207901.sra Read 554118 spots for SRR3207901.sra Written 554118 spots for SRR3207901.sra Read 554118 spots for SRR3207901.sra Written 554118 spots for SRR3207901.sra Read 554118 spots for SRR3207901.sra Written 554118 spots for SRR3207901.sra Read 554118 spots for SRR3207901.sra Written 554118 spots for SRR3207901.sra SRR ids: ['SRR3207901.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nfp9dzkv SRR3207901.sra spots: 11082365 blocks: [[1, 554118], [554119, 1108236], [1108237, 1662354], [1662355, 2216472], [2216473, 2770590], [2770591, 3324708], [3324709, 3878826], [3878827, 4432944], [4432945, 4987062], [4987063, 5541180], [5541181, 6095298], [6095299, 6649416], [6649417, 7203534], [7203535, 7757652], [7757653, 8311770], [8311771, 8865888], [8865889, 9420006], [9420007, 9974124], [9974125, 10528242], [10528243, 11082365]] SRR3207901 file size 2873243 SRR3207901 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207901 SRR3207901_1.fastq Input file: SRR3207901_1.fastq trimmed: SRR3207901-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 13:10:45 2025 >> started Tue Feb 11 13:10:50 2025 >> done (5.375s) 11082365 reads processed; of these: 1800 ( 0.02%) short reads filtered out after trimming by size control 21709 ( 0.20%) empty reads filtered out after trimming by size control 11058856 (99.79%) reads available; of these: 928387 ( 8.39%) trimmed reads available after processing 10130469 (91.61%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 330 0.00% 19 325 0.00% 20 499 0.00% 21 593 0.01% 22 884 0.01% 23 1150 0.01% 24 1491 0.01% 25 2016 0.02% 26 1882 0.02% 27 1841 0.02% 28 2019 0.02% 29 1855 0.02% 30 2005 0.02% 31 2022 0.02% 32 2057 0.02% 33 2090 0.02% 34 2313 0.02% 35 2351 0.02% 36 2522 0.02% 37 2522 0.02% 38 2768 0.03% 39 2930 0.03% 40 3063 0.03% 41 3219 0.03% 42 3333 0.03% 43 3493 0.03% 44 3781 0.03% 45 3918 0.04% 46 3924 0.04% 47 4288 0.04% 48 4547 0.04% 49 4721 0.04% 50 4898 0.04% 51 5122 0.05% 52 5450 0.05% 53 5820 0.05% 54 6387 0.06% 55 6551 0.06% 56 6639 0.06% 57 6813 0.06% 58 7220 0.07% 59 7050 0.06% 60 7411 0.07% 61 7407 0.07% 62 7513 0.07% 63 7557 0.07% 64 7577 0.07% 65 7877 0.07% 66 8033 0.07% 67 8004 0.07% 68 8579 0.08% 69 8617 0.08% 70 8713 0.08% 71 8931 0.08% 72 9280 0.08% 73 9485 0.09% 74 9870 0.09% 75 9470 0.09% 76 6889 0.06% 77 7941 0.07% 78 8815 0.08% 79 9659 0.09% 80 10604 0.10% 81 11436 0.10% 82 12511 0.11% 83 13529 0.12% 84 14320 0.13% 85 15382 0.14% 86 16500 0.15% 87 17840 0.16% 88 19167 0.17% 89 20519 0.19% 90 22931 0.21% 91 26671 0.24% 92 30595 0.28% 93 33631 0.30% 94 39485 0.36% 95 46682 0.42% 96 54260 0.49% 97 64915 0.59% 98 75985 0.69% 99 75094 0.68% 100 10130469 91.61% 11058856 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=29.15 fanout-score-rank=9 prefix-density=0.18 prefix-fanout=24.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC criterion=fanout-score sequence-density=0.05 sequence-density-rank=7 fanout-score=222.85 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=26.0 sequence=AAGAAGAAGAAA Started job on | Feb 11 13:11:09 Started mapping on | Feb 11 13:11:09 Finished on | Feb 11 13:11:23 Mapping speed, Million of reads per hour | 2843.71 Number of input reads | 11058856 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 10338443 Uniquely mapped reads % | 93.49% Average mapped length | 98.28 Number of splices: Total | 2846600 Number of splices: Annotated (sjdb) | 2792320 Number of splices: GT/AG | 2802258 Number of splices: GC/AG | 36337 Number of splices: AT/AC | 3051 Number of splices: Non-canonical | 4954 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 2.06 Insertion rate per base | 0.02% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 280847 % of reads mapped to multiple loci | 2.54% Number of reads mapped to too many loci | 320229 % of reads mapped to too many loci | 2.90% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.07% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 439566 439566 439566 N_multimapping 280847 280847 280847 N_noFeature 444599 5310972 5396090 N_ambiguous 113189 18846 18544 UnstrandedReadsAssigned:9780655 PositiveStrandReadsAssigned:5008625 NegativeStrandReadsAssigned:4923809 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207901 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207901-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,058,856 reads, 10,273,961 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,186 rounds 52401 SRR3207901.ke.tsv 34699 SRR3207901.se.tsv 87100 total ==> SRR3207901.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 528 36.2924 Potri.005G024800.1.v4.1 1035 936 364 51.2959 Potri.004G059700.1.v4.1 961 862 22 3.36645 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 303.607 14.0812 Potri.016G087400.1.v4.1 270 171 395 304.69 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 33 2.60025 Potri.012G127500.1.v4.1 977 878 1585 238.118 ==> SRR3207901.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 918 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 172 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 18 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR3207901 completed mapping pipeline successfully