Starting /dee2/code/volunteer_pipeline.sh SRR3207902 current disk space = 3050311663616 free memory = 1574013320 SRR3207902 SRAfilesize e74a7095189573a5c02bcd7b781c2e6b SRR3207902.sra SRR3207902.sra file validated SRR3207902 is single end SRR3207902 is conventional basespace SRR3207902 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207902_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8755 34.0 31.0 34.0 31.0 34.0 2 33.06825 34.0 33.0 34.0 31.0 34.0 3 33.19325 34.0 34.0 34.0 31.0 34.0 4 36.458 37.0 37.0 37.0 35.0 37.0 5 36.45475 37.0 37.0 37.0 35.0 37.0 6 36.4405 37.0 37.0 37.0 35.0 37.0 7 36.454 37.0 37.0 37.0 35.0 37.0 8 36.44875 37.0 37.0 37.0 35.0 37.0 9 38.31825 39.0 39.0 39.0 37.0 39.0 10-11 38.209374999999994 39.0 39.0 39.0 37.0 39.0 12-13 38.03575 39.0 38.5 39.0 36.0 39.0 14-15 39.694874999999996 41.0 40.0 41.0 37.0 41.0 16-17 39.596000000000004 41.0 40.0 41.0 37.0 41.0 18-19 39.593500000000006 41.0 40.0 41.0 37.0 41.0 20-21 39.554874999999996 41.0 40.0 41.0 37.0 41.0 22-23 39.52175 41.0 39.5 41.0 37.0 41.0 24-25 39.19 41.0 39.0 41.0 35.5 41.0 26-27 38.995 41.0 39.0 41.0 35.5 41.0 28-29 39.042125 41.0 39.0 41.0 36.0 41.0 30-31 38.91475 40.0 39.0 41.0 35.0 41.0 32-33 39.196 41.0 39.0 41.0 36.0 41.0 34-35 39.164375 41.0 39.0 41.0 36.0 41.0 36-37 38.9795 41.0 39.0 41.0 35.5 41.0 38-39 38.758624999999995 40.0 38.5 41.0 35.0 41.0 40-41 38.3975 40.0 38.0 41.0 34.0 41.0 42-43 38.478375 40.0 38.0 41.0 34.0 41.0 44-45 38.397999999999996 40.0 38.0 41.0 34.0 41.0 46-47 38.49625 40.0 38.0 41.0 34.5 41.0 48-49 38.30975 40.0 38.0 41.0 34.0 41.0 50-51 37.9585 40.0 38.0 41.0 33.0 41.0 52-53 37.918625 40.0 37.0 41.0 33.0 41.0 54-55 37.77475 40.0 37.0 41.0 33.0 41.0 56-57 37.512249999999995 40.0 37.0 41.0 33.0 41.0 58-59 37.159875 39.5 36.0 41.0 32.0 41.0 60-61 36.608000000000004 39.0 35.0 41.0 31.0 41.0 62-63 36.471875 39.0 35.0 40.5 31.0 41.0 64-65 36.29425 38.5 35.0 40.0 31.0 41.0 66-67 35.640375 37.5 35.0 40.0 29.5 41.0 68-69 35.540875 37.0 35.0 39.5 30.0 41.0 70-71 35.015125 36.0 34.0 39.0 29.0 41.0 72-73 34.6235 36.0 34.0 39.0 29.0 40.0 74-75 34.26475 35.5 34.0 37.5 29.0 39.5 76-77 33.1315 34.5 32.5 36.5 28.0 39.0 78-79 33.61425 35.0 34.0 37.0 29.0 39.0 80-81 33.341375 35.0 34.0 36.0 29.0 37.5 82-83 33.071 35.0 34.0 36.0 29.0 37.0 84-85 32.84325 35.0 34.0 35.5 29.0 37.0 86-87 32.381375 35.0 33.0 35.0 27.5 36.0 88-89 32.061125000000004 35.0 33.0 35.0 26.5 36.0 90-91 31.82725 35.0 33.0 35.0 26.0 36.0 92-93 31.609 35.0 33.0 35.0 25.0 35.5 94-95 31.481875000000002 35.0 33.0 35.0 25.0 35.0 96-97 31.082250000000002 34.5 32.5 35.0 23.5 35.0 98-99 30.786375 35.0 32.0 35.0 21.5 35.0 100 30.599 34.0 32.0 35.0 19.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 2.0 7 1.0 8 1.0 9 5.0 10 2.0 11 1.0 12 6.0 13 7.0 14 6.0 15 7.0 16 6.0 17 10.0 18 8.0 19 6.0 20 10.0 21 21.0 22 11.0 23 17.0 24 13.0 25 23.0 26 21.0 27 30.0 28 25.0 29 40.0 30 55.0 31 69.0 32 74.0 33 104.0 34 145.0 35 244.0 36 400.0 37 909.0 38 1455.0 39 266.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.625 16.075 15.775 41.525 2 22.3 20.575 35.625 21.5 3 22.675 23.974999999999998 26.900000000000002 26.450000000000003 4 24.025 28.999999999999996 21.325 25.650000000000002 5 25.78144536134033 32.93323330832708 22.455613903475868 18.829707426856714 6 21.15 36.55 23.599999999999998 18.7 7 17.4 20.8 40.825 20.974999999999998 8 19.3 23.625 30.925000000000004 26.150000000000002 9 20.925 22.900000000000002 31.65 24.525 10-11 22.912499999999998 32.75 23.0625 21.275 12-13 21.475 25.7375 29.65 23.1375 14-15 22.740342542817853 27.665958244780597 27.17839729966246 22.415301912739093 16-17 22.4375 27.200000000000003 27.3625 23.0 18-19 22.112499999999997 27.762500000000003 27.575 22.55 20-21 22.55 27.075 27.212500000000002 23.1625 22-23 22.6125 27.5125 26.924999999999997 22.95 24-25 22.1 28.1 26.787499999999998 23.0125 26-27 22.05 27.3125 26.650000000000002 23.9875 28-29 22.237499999999997 27.525 27.200000000000003 23.0375 30-31 22.4375 27.1375 27.400000000000002 23.025000000000002 32-33 22.037499999999998 27.900000000000002 27.175 22.8875 34-35 21.912499999999998 28.012500000000003 26.787499999999998 23.2875 36-37 21.375 26.974999999999998 28.025 23.625 38-39 22.275 28.599999999999998 26.5125 22.6125 40-41 23.8375 27.425 26.1625 22.575 42-43 22.9625 27.4125 27.325 22.3 44-45 22.8875 28.15 26.1 22.8625 46-47 22.425 27.8625 27.025 22.6875 48-49 22.625 27.9375 27.55 21.8875 50-51 22.412499999999998 27.762500000000003 27.275 22.55 52-53 22.629472104078058 27.107830873154864 27.958468851638727 22.304228171128347 54-55 22.7125 27.5875 27.400000000000002 22.3 56-57 22.9625 27.5125 27.237499999999997 22.287499999999998 58-59 22.6375 27.5875 27.650000000000002 22.125 60-61 22.1375 27.075 27.237499999999997 23.549999999999997 62-63 22.975 27.0875 27.775 22.162499999999998 64-65 22.25 27.425 27.275 23.05 66-67 22.162499999999998 28.199999999999996 27.400000000000002 22.237499999999997 68-69 22.662499999999998 27.8625 27.3625 22.112499999999997 70-71 22.2 28.575 26.8125 22.412499999999998 72-73 22.7375 27.3 26.3625 23.599999999999998 74-75 22.8 27.675 27.325 22.2 76-77 22.725 28.3375 26.087500000000002 22.85 78-79 22.6875 27.537499999999998 27.2625 22.5125 80-81 23.3875 27.6875 27.125 21.8 82-83 21.65 27.8125 27.425 23.1125 84-85 21.5375 28.3625 27.200000000000003 22.900000000000002 86-87 22.912499999999998 28.287499999999998 27.275 21.525 88-89 22.9375 28.262500000000003 26.674999999999997 22.125 90-91 21.55 28.325 27.9375 22.1875 92-93 23.3875 26.6 27.800000000000004 22.2125 94-95 23.200000000000003 27.025 27.525 22.25 96-97 22.125 26.474999999999998 28.725 22.675 98-99 21.775 28.65 27.6 21.975 100 23.45 27.275 27.224999999999998 22.05 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 1.0 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 3.0 26 4.5 27 6.5 28 6.5 29 9.0 30 14.0 31 17.5 32 24.0 33 31.5 34 45.5 35 68.5 36 89.0 37 106.0 38 128.5 39 156.0 40 175.5 41 200.0 42 217.5 43 237.0 44 265.0 45 269.0 46 253.5 47 224.5 48 220.0 49 202.5 50 166.0 51 140.0 52 113.0 53 102.5 54 88.5 55 64.0 56 47.0 57 37.0 58 34.5 59 40.5 60 35.5 61 23.0 62 18.0 63 19.5 64 15.5 65 9.5 66 7.0 67 6.5 68 7.0 69 5.0 70 5.5 71 5.0 72 3.5 73 4.0 74 4.0 75 6.0 76 6.0 77 3.5 78 1.5 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0125 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.075 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62330487192365 99.175 2 0.3515821195379206 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.025113008538422906 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGC 5 0.125 TruSeq Adapter, Index 12 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.037500000000000006 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.0875 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1125 0.0 0.0 0.0 0.0 64-65 0.1375 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.1875 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88 0.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 684500 spots for SRR3207902.sra Written 684500 spots for SRR3207902.sra Read 684500 spots for SRR3207902.sra Written 684500 spots for SRR3207902.sra Read 684500 spots for SRR3207902.sra Written 684500 spots for SRR3207902.sra Read 684500 spots for SRR3207902.sra Written 684500 spots for SRR3207902.sra Read 684500 spots for SRR3207902.sra Written 684500 spots for SRR3207902.sra Read 684500 spots for SRR3207902.sra Written 684500 spots for SRR3207902.sra Read 684500 spots for SRR3207902.sra Written 684500 spots for SRR3207902.sra Read 684500 spots for SRR3207902.sra Written 684500 spots for SRR3207902.sra Read 684500 spots for SRR3207902.sra Written 684500 spots for SRR3207902.sra Read 684500 spots for SRR3207902.sra Written 684500 spots for SRR3207902.sra Read 684500 spots for SRR3207902.sra Written 684500 spots for SRR3207902.sra Read 684500 spots for SRR3207902.sra Written 684500 spots for SRR3207902.sra Read 684500 spots for SRR3207902.sra Written 684500 spots for SRR3207902.sra Read 684508 spots for SRR3207902.sra Written 684508 spots for SRR3207902.sra Read 684500 spots for SRR3207902.sra Written 684500 spots for SRR3207902.sra Read 684500 spots for SRR3207902.sra Written 684500 spots for SRR3207902.sra Read 684500 spots for SRR3207902.sra Written 684500 spots for SRR3207902.sra Read 684500 spots for SRR3207902.sra Written 684500 spots for SRR3207902.sra Read 684500 spots for SRR3207902.sra Written 684500 spots for SRR3207902.sra Read 684500 spots for SRR3207902.sra Written 684500 spots for SRR3207902.sra SRR ids: ['SRR3207902.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_59m84jj2 SRR3207902.sra spots: 13690008 blocks: [[1, 684500], [684501, 1369000], [1369001, 2053500], [2053501, 2738000], [2738001, 3422500], [3422501, 4107000], [4107001, 4791500], [4791501, 5476000], [5476001, 6160500], [6160501, 6845000], [6845001, 7529500], [7529501, 8214000], [8214001, 8898500], [8898501, 9583000], [9583001, 10267500], [10267501, 10952000], [10952001, 11636500], [11636501, 12321000], [12321001, 13005500], [13005501, 13690008]] SRR3207902 file size 3551854 SRR3207902 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207902 SRR3207902_1.fastq Input file: SRR3207902_1.fastq trimmed: SRR3207902-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 13:51:42 2025 >> started Tue Feb 11 13:51:49 2025 >> done (6.962s) 13690008 reads processed; of these: 3152 ( 0.02%) short reads filtered out after trimming by size control 30345 ( 0.22%) empty reads filtered out after trimming by size control 13656511 (99.76%) reads available; of these: 1281622 ( 9.38%) trimmed reads available after processing 12374889 (90.62%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 567 0.00% 19 729 0.01% 20 856 0.01% 21 1126 0.01% 22 1492 0.01% 23 1728 0.01% 24 2323 0.02% 25 2874 0.02% 26 3057 0.02% 27 2899 0.02% 28 2947 0.02% 29 2914 0.02% 30 3077 0.02% 31 3017 0.02% 32 3151 0.02% 33 3244 0.02% 34 3470 0.03% 35 3486 0.03% 36 3866 0.03% 37 4109 0.03% 38 4234 0.03% 39 4366 0.03% 40 4643 0.03% 41 4784 0.04% 42 5166 0.04% 43 5463 0.04% 44 5791 0.04% 45 5714 0.04% 46 6076 0.04% 47 6448 0.05% 48 6829 0.05% 49 7012 0.05% 50 7521 0.06% 51 7725 0.06% 52 7851 0.06% 53 8428 0.06% 54 9371 0.07% 55 9417 0.07% 56 9768 0.07% 57 9900 0.07% 58 10258 0.08% 59 10347 0.08% 60 10511 0.08% 61 10697 0.08% 62 10610 0.08% 63 10761 0.08% 64 10738 0.08% 65 10997 0.08% 66 10963 0.08% 67 11207 0.08% 68 11886 0.09% 69 11978 0.09% 70 12089 0.09% 71 12673 0.09% 72 13067 0.10% 73 12892 0.09% 74 13105 0.10% 75 13127 0.10% 76 9338 0.07% 77 10701 0.08% 78 11983 0.09% 79 13299 0.10% 80 14517 0.11% 81 16006 0.12% 82 17398 0.13% 83 18484 0.14% 84 19581 0.14% 85 21102 0.15% 86 22822 0.17% 87 24555 0.18% 88 26250 0.19% 89 28670 0.21% 90 31478 0.23% 91 35930 0.26% 92 41874 0.31% 93 45784 0.34% 94 53410 0.39% 95 63638 0.47% 96 73413 0.54% 97 86763 0.64% 98 100396 0.74% 99 98885 0.72% 100 12374889 90.62% 13656511 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=1.90 fanout-score-rank=31 prefix-density=0.17 prefix-fanout=1.9 sequence=CGCGCTTGGTTGAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=26 fanout-score=128.63 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=18.4 sequence=CTGCTGCTGCTG Started job on | Feb 11 13:52:05 Started mapping on | Feb 11 13:52:05 Finished on | Feb 11 13:52:28 Mapping speed, Million of reads per hour | 2137.54 Number of input reads | 13656511 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 11765676 Uniquely mapped reads % | 86.15% Average mapped length | 98.20 Number of splices: Total | 3288607 Number of splices: Annotated (sjdb) | 3217151 Number of splices: GT/AG | 3234231 Number of splices: GC/AG | 45011 Number of splices: AT/AC | 3680 Number of splices: Non-canonical | 5685 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 2.07 Insertion rate per base | 0.01% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 415186 % of reads mapped to multiple loci | 3.04% Number of reads mapped to too many loci | 1239956 % of reads mapped to too many loci | 9.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.71% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1475649 1475649 1475649 N_multimapping 415186 415186 415186 N_noFeature 552079 6122050 6128795 N_ambiguous 113675 23633 23326 UnstrandedReadsAssigned:11099922 PositiveStrandReadsAssigned:5619993 NegativeStrandReadsAssigned:5613555 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207902 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207902-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,656,511 reads, 12,498,260 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,197 rounds 52401 SRR3207902.ke.tsv 34699 SRR3207902.se.tsv 87100 total ==> SRR3207902.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 992 56.4856 Potri.005G024800.1.v4.1 1035 936 1372 160.169 Potri.004G059700.1.v4.1 961 862 21 2.66203 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 385.375 14.8066 Potri.016G087400.1.v4.1 270 171 446 284.997 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 86.7329 5.66147 Potri.012G127500.1.v4.1 977 878 3121 388.419 ==> SRR3207902.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 421 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 158 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 9 SRR3207902 completed mapping pipeline successfully