Starting /dee2/code/volunteer_pipeline.sh SRR3207903 current disk space = 3050353238016 free memory = 1092723612 SRR3207903 SRAfilesize 743a36edc7e5078f5ddb1f1b363cc69b SRR3207903.sra SRR3207903.sra file validated SRR3207903 is single end SRR3207903 is conventional basespace SRR3207903 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207903_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.99225 34.0 33.0 34.0 31.0 34.0 2 33.289 34.0 34.0 34.0 31.0 34.0 3 33.457 34.0 34.0 34.0 31.0 34.0 4 36.59475 37.0 37.0 37.0 35.0 37.0 5 36.6145 37.0 37.0 37.0 35.0 37.0 6 36.6255 37.0 37.0 37.0 35.0 37.0 7 36.60825 37.0 37.0 37.0 35.0 37.0 8 36.63425 37.0 37.0 37.0 35.0 37.0 9 38.50475 39.0 39.0 39.0 37.0 39.0 10-11 38.5445 39.0 39.0 39.0 37.5 39.0 12-13 38.459374999999994 39.0 39.0 39.0 37.0 39.0 14-15 40.101625 41.0 40.0 41.0 38.0 41.0 16-17 40.056875 41.0 40.0 41.0 38.0 41.0 18-19 39.979 41.0 40.0 41.0 38.0 41.0 20-21 40.021625 41.0 40.0 41.0 38.0 41.0 22-23 39.9885 41.0 40.0 41.0 38.0 41.0 24-25 39.935125 41.0 40.0 41.0 38.0 41.0 26-27 39.756375000000006 41.0 40.0 41.0 38.0 41.0 28-29 39.657875000000004 41.0 40.0 41.0 37.5 41.0 30-31 39.4075 41.0 40.0 41.0 36.5 41.0 32-33 39.609375 41.0 40.0 41.0 37.5 41.0 34-35 39.754125 41.0 40.0 41.0 38.0 41.0 36-37 39.67675 41.0 40.0 41.0 38.0 41.0 38-39 39.527625 41.0 40.0 41.0 37.0 41.0 40-41 39.525125 41.0 40.0 41.0 37.0 41.0 42-43 39.462375 41.0 40.0 41.0 37.0 41.0 44-45 39.3785 41.0 40.0 41.0 37.0 41.0 46-47 39.283500000000004 41.0 39.5 41.0 36.5 41.0 48-49 39.278125 41.0 40.0 41.0 36.0 41.0 50-51 38.968 40.5 39.5 41.0 35.5 41.0 52-53 38.79375 40.0 39.0 41.0 35.0 41.0 54-55 38.765375 40.0 39.0 41.0 35.0 41.0 56-57 38.424875 40.0 38.0 41.0 34.5 41.0 58-59 38.285624999999996 40.0 38.0 41.0 34.0 41.0 60-61 38.254999999999995 40.0 37.0 41.0 34.5 41.0 62-63 37.921625 39.5 37.0 41.0 34.0 41.0 64-65 37.54675 39.0 36.5 41.0 34.0 41.0 66-67 37.137625 39.0 36.0 40.0 34.0 41.0 68-69 36.789125 38.0 35.0 40.0 33.5 41.0 70-71 36.275125 37.0 35.0 39.0 33.0 41.0 72-73 35.8835 37.0 35.0 39.0 33.0 40.5 74-75 35.3725 36.0 35.0 38.5 32.0 39.5 76-77 34.292625 35.0 33.5 37.0 30.5 39.0 78-79 34.629875 35.0 34.5 37.0 32.0 39.0 80-81 34.306875000000005 35.0 34.0 36.5 32.0 38.0 82-83 34.050375 35.0 34.0 36.0 32.0 37.0 84-85 33.720749999999995 35.0 34.0 36.0 31.0 37.0 86-87 33.6085 35.0 34.0 35.0 31.0 36.0 88-89 33.332125000000005 35.0 34.0 35.0 30.5 36.0 90-91 33.172625 35.0 34.0 35.0 31.0 36.0 92-93 32.999625 35.0 34.0 35.0 30.5 36.0 94-95 32.82925 35.0 34.0 35.0 30.0 35.0 96-97 32.632374999999996 35.0 34.0 35.0 30.0 35.0 98-99 32.40225 35.0 34.0 35.0 29.5 35.0 100 32.16025 35.0 34.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 2.0 11 4.0 12 0.0 13 3.0 14 5.0 15 5.0 16 3.0 17 5.0 18 3.0 19 6.0 20 7.0 21 9.0 22 9.0 23 4.0 24 3.0 25 8.0 26 21.0 27 13.0 28 23.0 29 20.0 30 20.0 31 45.0 32 46.0 33 45.0 34 93.0 35 140.0 36 300.0 37 899.0 38 1912.0 39 344.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.28930817610063 13.484276729559749 14.79245283018868 45.43396226415094 2 20.775 21.525 35.925000000000004 21.775 3 22.925 25.6 25.4 26.075 4 24.099999999999998 31.424999999999997 19.775000000000002 24.7 5 25.906476619154787 32.93323330832708 21.980495123780948 19.179794948737182 6 19.55 36.55 24.2 19.7 7 17.65 19.975 41.175 21.2 8 20.349999999999998 23.5 30.725 25.424999999999997 9 20.05 24.375 30.85 24.725 10-11 22.45 33.425 23.8875 20.2375 12-13 21.2625 27.275 28.4125 23.05 14-15 21.375 28.1125 28.6875 21.825 16-17 21.5625 27.8875 27.775 22.775000000000002 18-19 22.1 28.975 26.6625 22.2625 20-21 22.375 29.525000000000002 26.450000000000003 21.65 22-23 21.45 28.8625 27.775 21.912499999999998 24-25 22.45 27.800000000000004 27.3875 22.3625 26-27 22.525000000000002 27.525 27.150000000000002 22.8 28-29 22.3375 28.575 26.125 22.9625 30-31 22.275 28.000000000000004 27.650000000000002 22.075 32-33 21.925 28.599999999999998 27.0 22.475 34-35 22.575 27.3375 27.275 22.8125 36-37 21.9375 28.675 27.3 22.0875 38-39 22.2625 28.050000000000004 27.700000000000003 21.987499999999997 40-41 21.837500000000002 27.9125 27.537499999999998 22.7125 42-43 21.525 28.925 27.0 22.55 44-45 22.2 28.199999999999996 27.250000000000004 22.35 46-47 21.5375 28.5875 27.3375 22.537499999999998 48-49 21.8125 27.525 27.8125 22.85 50-51 21.833187445291983 28.248093034888083 27.68538201825685 22.233337501563085 52-53 21.085542771385693 28.264132066033014 28.16408204102051 22.486243121560783 54-55 21.9 27.875 27.487499999999997 22.7375 56-57 22.787499999999998 27.3125 27.787499999999998 22.112499999999997 58-59 22.175 27.85 28.0875 21.8875 60-61 22.1875 27.425 27.5125 22.875 62-63 21.512500000000003 28.449999999999996 27.8125 22.225 64-65 22.6 28.375 26.924999999999997 22.1 66-67 21.4375 28.9875 27.075 22.5 68-69 22.400000000000002 27.712500000000002 28.349999999999998 21.5375 70-71 20.9375 28.3625 28.287499999999998 22.412499999999998 72-73 22.025 28.4125 27.0875 22.475 74-75 21.85 28.262500000000003 27.775 22.112499999999997 76-77 21.875 28.275 28.5625 21.2875 78-79 22.45 28.1375 27.5125 21.9 80-81 22.4625 26.737499999999997 27.975 22.825 82-83 22.475 27.487499999999997 27.8625 22.175 84-85 22.2125 27.474999999999998 27.987499999999997 22.325 86-87 21.55 27.825 27.787499999999998 22.8375 88-89 22.354265699274457 27.77082812109082 27.9459594696022 21.928946710032523 90-91 22.141606204653492 27.645734300725543 28.68401300975732 21.528646484863646 92-93 21.608103038639488 28.510691509315993 28.49818682005752 21.383018631986992 94-95 23.002875359419928 27.765970746343292 27.17839729966246 22.052756594574323 96-97 21.825 27.8125 28.3625 22.0 98-99 21.81522690336292 29.26615826978372 26.828353544193025 22.090261282660332 100 23.325000000000003 28.125 27.85 20.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.5 22 0.5 23 1.0 24 1.5 25 1.5 26 2.0 27 5.0 28 7.0 29 6.5 30 12.0 31 20.0 32 25.0 33 26.0 34 40.0 35 61.5 36 82.0 37 111.0 38 133.5 39 162.0 40 180.5 41 209.0 42 247.0 43 272.5 44 282.0 45 274.0 46 274.0 47 262.0 48 247.0 49 211.0 50 178.5 51 150.5 52 113.5 53 91.0 54 72.5 55 60.5 56 43.0 57 26.5 58 18.5 59 19.0 60 16.0 61 12.0 62 9.5 63 6.0 64 4.0 65 2.0 66 3.0 67 3.5 68 2.0 69 1.0 70 1.5 71 1.5 72 1.0 73 1.0 74 1.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.625 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0375 52-53 0.05 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.075 90-91 0.075 92-93 0.0375 94-95 0.0125 96-97 0.0 98-99 0.0125 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.1125 0.0 0.0 0.0 0.0 42-43 0.125 0.0 0.0 0.0 0.0 44-45 0.125 0.0 0.0 0.0 0.0 46-47 0.125 0.0 0.0 0.0 0.0 48-49 0.125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.1375 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88 0.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 865051 spots for SRR3207903.sra Written 865051 spots for SRR3207903.sra Read 865051 spots for SRR3207903.sra Written 865051 spots for SRR3207903.sra Read 865051 spots for SRR3207903.sra Written 865051 spots for SRR3207903.sra Read 865051 spots for SRR3207903.sra Written 865051 spots for SRR3207903.sra Read 865051 spots for SRR3207903.sra Written 865051 spots for SRR3207903.sra Read 865051 spots for SRR3207903.sra Written 865051 spots for SRR3207903.sra Read 865051 spots for SRR3207903.sra Written 865051 spots for SRR3207903.sra Read 865051 spots for SRR3207903.sra Written 865051 spots for SRR3207903.sra Read 865051 spots for SRR3207903.sra Written 865051 spots for SRR3207903.sra Read 865051 spots for SRR3207903.sra Written 865051 spots for SRR3207903.sra Read 865051 spots for SRR3207903.sra Written 865051 spots for SRR3207903.sra Read 865051 spots for SRR3207903.sra Written 865051 spots for SRR3207903.sra Read 865051 spots for SRR3207903.sra Written 865051 spots for SRR3207903.sra Read 865051 spots for SRR3207903.sra Written 865051 spots for SRR3207903.sra Read 865051 spots for SRR3207903.sra Written 865051 spots for SRR3207903.sra Read 865051 spots for SRR3207903.sra Written 865051 spots for SRR3207903.sra Read 865051 spots for SRR3207903.sra Written 865051 spots for SRR3207903.sra Read 865056 spots for SRR3207903.sra Written 865056 spots for SRR3207903.sra Read 865051 spots for SRR3207903.sra Written 865051 spots for SRR3207903.sra Read 865051 spots for SRR3207903.sra Written 865051 spots for SRR3207903.sra SRR ids: ['SRR3207903.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j51drt49 SRR3207903.sra spots: 17301025 blocks: [[1, 865051], [865052, 1730102], [1730103, 2595153], [2595154, 3460204], [3460205, 4325255], [4325256, 5190306], [5190307, 6055357], [6055358, 6920408], [6920409, 7785459], [7785460, 8650510], [8650511, 9515561], [9515562, 10380612], [10380613, 11245663], [11245664, 12110714], [12110715, 12975765], [12975766, 13840816], [13840817, 14705867], [14705868, 15570918], [15570919, 16435969], [16435970, 17301025]] SRR3207903 file size 4491588 SRR3207903 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207903 SRR3207903_1.fastq Input file: SRR3207903_1.fastq trimmed: SRR3207903-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 13:20:30 2025 >> started Tue Feb 11 13:20:43 2025 >> done (12.760s) 17301025 reads processed; of these: 5934 ( 0.03%) short reads filtered out after trimming by size control 22477 ( 0.13%) empty reads filtered out after trimming by size control 17272614 (99.84%) reads available; of these: 1429866 ( 8.28%) trimmed reads available after processing 15842748 (91.72%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 899 0.01% 19 1050 0.01% 20 1204 0.01% 21 1483 0.01% 22 1836 0.01% 23 2307 0.01% 24 2912 0.02% 25 3710 0.02% 26 3750 0.02% 27 3735 0.02% 28 3992 0.02% 29 3937 0.02% 30 4055 0.02% 31 3834 0.02% 32 3926 0.02% 33 4068 0.02% 34 4343 0.03% 35 4454 0.03% 36 4755 0.03% 37 4863 0.03% 38 5006 0.03% 39 5308 0.03% 40 5646 0.03% 41 5839 0.03% 42 5904 0.03% 43 6380 0.04% 44 6771 0.04% 45 6897 0.04% 46 7156 0.04% 47 7552 0.04% 48 7922 0.05% 49 8172 0.05% 50 8607 0.05% 51 9030 0.05% 52 9089 0.05% 53 9443 0.05% 54 10262 0.06% 55 10704 0.06% 56 10868 0.06% 57 11126 0.06% 58 11316 0.07% 59 11390 0.07% 60 11487 0.07% 61 11787 0.07% 62 11959 0.07% 63 11386 0.07% 64 11685 0.07% 65 11872 0.07% 66 11511 0.07% 67 11881 0.07% 68 12876 0.07% 69 11881 0.07% 70 11927 0.07% 71 12342 0.07% 72 12868 0.07% 73 12841 0.07% 74 12596 0.07% 75 12527 0.07% 76 9302 0.05% 77 10349 0.06% 78 12489 0.07% 79 13587 0.08% 80 14709 0.09% 81 15580 0.09% 82 16941 0.10% 83 17814 0.10% 84 19105 0.11% 85 20139 0.12% 86 22150 0.13% 87 24766 0.14% 88 25089 0.15% 89 27610 0.16% 90 30371 0.18% 91 33541 0.19% 92 39354 0.23% 93 44517 0.26% 94 52001 0.30% 95 62431 0.36% 96 78711 0.46% 97 97017 0.56% 98 130420 0.76% 99 172946 1.00% 100 15842748 91.72% 17272614 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=43.35 fanout-score-rank=9 prefix-density=0.38 prefix-fanout=32.2 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTATGCCGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=10 fanout-score=234.09 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=24.9 sequence=AAGAAGAAGAAA Started job on | Feb 11 13:21:04 Started mapping on | Feb 11 13:21:05 Finished on | Feb 11 13:21:25 Mapping speed, Million of reads per hour | 3109.07 Number of input reads | 17272614 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 16433985 Uniquely mapped reads % | 95.14% Average mapped length | 98.21 Number of splices: Total | 4745135 Number of splices: Annotated (sjdb) | 4655620 Number of splices: GT/AG | 4670072 Number of splices: GC/AG | 62166 Number of splices: AT/AC | 5369 Number of splices: Non-canonical | 7528 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 1.99 Insertion rate per base | 0.01% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 423584 % of reads mapped to multiple loci | 2.45% Number of reads mapped to too many loci | 212144 % of reads mapped to too many loci | 1.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.17% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 415045 415045 415045 N_multimapping 423584 423584 423584 N_noFeature 629124 8520600 8418822 N_ambiguous 181770 28396 29977 UnstrandedReadsAssigned:15623091 PositiveStrandReadsAssigned:7884989 NegativeStrandReadsAssigned:7985186 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207903 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207903-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,272,614 reads, 16,128,216 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,157 rounds 52401 SRR3207903.ke.tsv 34699 SRR3207903.se.tsv 87100 total ==> SRR3207903.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 548 24.463 Potri.005G024800.1.v4.1 1035 936 196 17.9384 Potri.004G059700.1.v4.1 961 862 98 9.73918 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 334.498 10.0755 Potri.016G087400.1.v4.1 270 171 689 345.165 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 79.5607 4.07143 Potri.012G127500.1.v4.1 977 878 4391 428.423 ==> SRR3207903.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2248 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 321 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 55 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207903 completed mapping pipeline successfully