Starting /dee2/code/volunteer_pipeline.sh SRR3207904 current disk space = 3050355367936 free memory = 1484282368 SRR3207904 SRAfilesize ace50770ae5230768d4f730517e6ea97 SRR3207904.sra SRR3207904.sra file validated SRR3207904 is single end SRR3207904 is conventional basespace SRR3207904 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207904_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0065 34.0 33.0 34.0 31.0 34.0 2 33.30775 34.0 34.0 34.0 31.0 34.0 3 33.4365 34.0 34.0 34.0 31.0 34.0 4 36.59875 37.0 37.0 37.0 35.0 37.0 5 36.572 37.0 37.0 37.0 35.0 37.0 6 36.58825 37.0 37.0 37.0 35.0 37.0 7 36.5975 37.0 37.0 37.0 35.0 37.0 8 36.611 37.0 37.0 37.0 35.0 37.0 9 38.462 39.0 39.0 39.0 37.0 39.0 10-11 38.509874999999994 39.0 39.0 39.0 37.0 39.0 12-13 38.450874999999996 39.0 39.0 39.0 37.0 39.0 14-15 40.052375 41.0 40.0 41.0 38.0 41.0 16-17 39.949625 41.0 40.0 41.0 38.0 41.0 18-19 39.915499999999994 41.0 40.0 41.0 38.0 41.0 20-21 39.856625 41.0 40.0 41.0 38.0 41.0 22-23 39.813874999999996 41.0 40.0 41.0 38.0 41.0 24-25 39.725625 41.0 40.0 41.0 38.0 41.0 26-27 39.568875 41.0 40.0 41.0 37.0 41.0 28-29 39.3585 41.0 40.0 41.0 37.0 41.0 30-31 39.113125 41.0 39.0 41.0 36.0 41.0 32-33 39.328625 41.0 39.5 41.0 37.0 41.0 34-35 39.41025 41.0 40.0 41.0 37.0 41.0 36-37 39.353875 41.0 40.0 41.0 36.0 41.0 38-39 39.194625 41.0 39.5 41.0 35.0 41.0 40-41 39.09775 41.0 39.0 41.0 35.0 41.0 42-43 38.955625 41.0 39.0 41.0 35.0 41.0 44-45 38.888999999999996 40.5 39.0 41.0 35.0 41.0 46-47 38.753125 41.0 39.0 41.0 35.0 41.0 48-49 38.715875 41.0 38.5 41.0 35.0 41.0 50-51 38.4055 40.0 38.0 41.0 34.5 41.0 52-53 38.202875 40.0 37.5 41.0 34.5 41.0 54-55 38.059749999999994 40.0 37.0 41.0 34.0 41.0 56-57 37.695375 40.0 36.5 41.0 33.5 41.0 58-59 37.4825 39.5 36.0 41.0 33.0 41.0 60-61 37.303375 39.0 36.0 41.0 33.0 41.0 62-63 36.867000000000004 39.0 35.0 41.0 33.0 41.0 64-65 36.50975 38.0 35.0 40.0 32.0 41.0 66-67 36.111375 37.0 35.0 40.0 32.0 41.0 68-69 35.8015 37.0 35.0 39.5 32.0 41.0 70-71 35.3735 36.0 35.0 39.0 31.0 41.0 72-73 35.026375 36.0 35.0 39.0 31.0 40.0 74-75 34.617 35.0 34.0 37.5 30.5 39.5 76-77 33.598 35.0 33.5 36.5 29.5 39.0 78-79 33.97387500000001 35.0 34.0 37.0 31.0 39.0 80-81 33.65325 35.0 34.0 36.0 30.0 37.0 82-83 33.445 35.0 34.0 36.0 30.0 37.0 84-85 33.23375 35.0 34.0 35.5 30.0 37.0 86-87 33.0385 35.0 34.0 35.0 30.0 36.0 88-89 32.790875 35.0 34.0 35.0 29.5 36.0 90-91 32.536625 35.0 34.0 35.0 29.0 36.0 92-93 32.33125 35.0 33.0 35.0 29.0 35.0 94-95 32.194125 35.0 33.0 35.0 29.0 35.0 96-97 32.04675 35.0 33.0 35.0 28.0 35.0 98-99 31.728125 35.0 33.0 35.0 27.0 35.0 100 31.48875 35.0 33.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 3.0 5 0.0 6 0.0 7 1.0 8 3.0 9 3.0 10 0.0 11 4.0 12 5.0 13 3.0 14 10.0 15 5.0 16 8.0 17 7.0 18 12.0 19 6.0 20 6.0 21 8.0 22 2.0 23 7.0 24 12.0 25 13.0 26 13.0 27 20.0 28 40.0 29 21.0 30 28.0 31 41.0 32 66.0 33 77.0 34 119.0 35 197.0 36 433.0 37 986.0 38 1542.0 39 298.0 40 1.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.162650602409638 13.78012048192771 12.600401606425704 45.45682730923695 2 21.625 20.825 35.025 22.525000000000002 3 23.425 24.349999999999998 23.549999999999997 28.675 4 26.1 28.799999999999997 19.45 25.650000000000002 5 27.306826706676667 31.48287071767942 22.13053263315829 19.079769942485623 6 22.15 35.275 21.675 20.9 7 18.875 20.674999999999997 39.375 21.075 8 19.0 23.825 31.025000000000002 26.150000000000002 9 22.25 21.8 31.275 24.675 10-11 23.400000000000002 31.65 23.0375 21.912499999999998 12-13 22.7625 25.75 27.425 24.0625 14-15 22.3375 27.175 28.0875 22.400000000000002 16-17 22.162499999999998 26.85 26.525 24.462500000000002 18-19 22.3 27.075 26.5625 24.0625 20-21 22.475 26.437500000000004 27.200000000000003 23.8875 22-23 23.225 27.1375 25.8625 23.775 24-25 22.5125 27.0125 26.724999999999998 23.75 26-27 22.625 27.275 26.525 23.575 28-29 23.400000000000002 26.687499999999996 26.437500000000004 23.474999999999998 30-31 22.7 27.0875 26.174999999999997 24.0375 32-33 23.125 27.200000000000003 26.9625 22.7125 34-35 23.25 26.387500000000003 26.737499999999997 23.625 36-37 22.9625 26.724999999999998 27.05 23.2625 38-39 23.0125 27.05 25.837500000000002 24.099999999999998 40-41 23.5875 26.924999999999997 27.1125 22.375 42-43 23.6125 26.7625 26.424999999999997 23.200000000000003 44-45 23.575 27.6 26.487500000000004 22.3375 46-47 22.875 27.575 26.137500000000003 23.4125 48-49 22.675 27.125 27.375 22.825 50-51 23.17118919594848 27.19769913717644 26.50994122796049 23.121170438914593 52-53 23.102887860982623 27.078384798099762 26.64083010376297 23.177897237154642 54-55 23.375 26.5125 27.375 22.7375 56-57 22.775000000000002 25.674999999999997 27.625 23.925 58-59 24.087500000000002 26.5 27.575 21.837500000000002 60-61 22.85 27.537499999999998 26.9625 22.650000000000002 62-63 23.5875 26.724999999999998 26.900000000000002 22.787499999999998 64-65 22.665333166645834 27.240905113139142 26.578322290286287 23.51543942992874 66-67 23.3 28.025 25.9625 22.7125 68-69 22.5625 26.8625 26.7125 23.8625 70-71 23.175 27.575 26.875 22.375 72-73 23.7 26.087500000000002 26.4625 23.75 74-75 22.1 27.437499999999996 26.85 23.6125 76-77 23.599999999999998 26.55 27.187499999999996 22.662499999999998 78-79 23.7 26.7625 25.687500000000004 23.849999999999998 80-81 23.0 27.125 26.9125 22.9625 82-83 23.35 26.275 27.075 23.3 84-85 23.425 26.025 27.212500000000002 23.3375 86-87 22.912499999999998 27.2625 26.137500000000003 23.6875 88-89 23.3991995997999 25.850425212606304 27.37618809404702 23.374187093546773 90-91 23.1048286214661 26.507380535401552 26.46985238929197 23.91793845384038 92-93 23.521320495185694 27.047642866074778 26.58496936351132 22.84606727522821 94-95 22.690336292036505 26.815851981497683 27.078384798099762 23.415426928366045 96-97 23.075000000000003 27.125 25.912499999999998 23.8875 98-99 22.840355044380548 27.00337542192774 26.92836604575572 23.22790348793599 100 23.724999999999998 26.450000000000003 26.625 23.200000000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.0 23 0.5 24 0.5 25 2.0 26 2.5 27 2.0 28 3.0 29 5.0 30 11.5 31 13.0 32 15.5 33 25.5 34 33.0 35 50.0 36 75.0 37 90.0 38 108.5 39 136.0 40 164.5 41 194.5 42 212.0 43 223.0 44 246.0 45 256.5 46 234.0 47 225.5 48 213.0 49 193.5 50 164.5 51 136.0 52 136.5 53 120.0 54 100.0 55 82.5 56 68.0 57 59.5 58 53.0 59 44.0 60 34.5 61 34.5 62 33.0 63 28.0 64 22.5 65 18.5 66 15.5 67 15.0 68 14.0 69 10.0 70 11.0 71 10.0 72 9.0 73 10.5 74 8.0 75 6.0 76 5.0 77 5.0 78 3.5 79 2.0 80 2.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0375 52-53 0.0125 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0125 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.05 90-91 0.075 92-93 0.0375 94-95 0.0125 96-97 0.0 98-99 0.0125 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.5 #Duplication Level Percentage of deduplicated Percentage of total 1 97.7948717948718 95.35 2 1.9743589743589745 3.85 3 0.1794871794871795 0.525 4 0.0 0.0 5 0.02564102564102564 0.125 6 0.02564102564102564 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTAT 6 0.15 TruSeq Adapter, Index 14 (97% over 44bp) CCGACATCGAAGGATCAAAAAGCAACGTCGCTATGAACGCTTGGCTGCCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88 0.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 567403 spots for SRR3207904.sra Written 567403 spots for SRR3207904.sra Read 567403 spots for SRR3207904.sra Written 567403 spots for SRR3207904.sra Read 567403 spots for SRR3207904.sra Written 567403 spots for SRR3207904.sra Read 567403 spots for SRR3207904.sra Written 567403 spots for SRR3207904.sra Read 567403 spots for SRR3207904.sra Written 567403 spots for SRR3207904.sra Read 567403 spots for SRR3207904.sra Written 567403 spots for SRR3207904.sra Read 567403 spots for SRR3207904.sra Written 567403 spots for SRR3207904.sra Read 567403 spots for SRR3207904.sra Written 567403 spots for SRR3207904.sra Read 567403 spots for SRR3207904.sra Written 567403 spots for SRR3207904.sra Read 567403 spots for SRR3207904.sra Written 567403 spots for SRR3207904.sra Read 567403 spots for SRR3207904.sra Written 567403 spots for SRR3207904.sra Read 567403 spots for SRR3207904.sra Written 567403 spots for SRR3207904.sra Read 567403 spots for SRR3207904.sra Written 567403 spots for SRR3207904.sra Read 567403 spots for SRR3207904.sra Written 567403 spots for SRR3207904.sra Read 567403 spots for SRR3207904.sra Written 567403 spots for SRR3207904.sra Read 567403 spots for SRR3207904.sra Written 567403 spots for SRR3207904.sra Read 567403 spots for SRR3207904.sra Written 567403 spots for SRR3207904.sra Read 567403 spots for SRR3207904.sra Written 567403 spots for SRR3207904.sra Read 567403 spots for SRR3207904.sra Written 567403 spots for SRR3207904.sra Read 567407 spots for SRR3207904.sra Written 567407 spots for SRR3207904.sra SRR ids: ['SRR3207904.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vj8eiavb SRR3207904.sra spots: 11348064 blocks: [[1, 567403], [567404, 1134806], [1134807, 1702209], [1702210, 2269612], [2269613, 2837015], [2837016, 3404418], [3404419, 3971821], [3971822, 4539224], [4539225, 5106627], [5106628, 5674030], [5674031, 6241433], [6241434, 6808836], [6808837, 7376239], [7376240, 7943642], [7943643, 8511045], [8511046, 9078448], [9078449, 9645851], [9645852, 10213254], [10213255, 10780657], [10780658, 11348064]] SRR3207904 file size 2942386 SRR3207904 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207904 SRR3207904_1.fastq Input file: SRR3207904_1.fastq trimmed: SRR3207904-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 13:19:46 2025 >> started Tue Feb 11 13:19:52 2025 >> done (5.789s) 11348064 reads processed; of these: 2256 ( 0.02%) short reads filtered out after trimming by size control 13034 ( 0.11%) empty reads filtered out after trimming by size control 11332774 (99.87%) reads available; of these: 1087204 ( 9.59%) trimmed reads available after processing 10245570 (90.41%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 406 0.00% 19 486 0.00% 20 624 0.01% 21 749 0.01% 22 1074 0.01% 23 1436 0.01% 24 1807 0.02% 25 2486 0.02% 26 2437 0.02% 27 2497 0.02% 28 2637 0.02% 29 2636 0.02% 30 2669 0.02% 31 2626 0.02% 32 2588 0.02% 33 2753 0.02% 34 3056 0.03% 35 3077 0.03% 36 3556 0.03% 37 3406 0.03% 38 3579 0.03% 39 3730 0.03% 40 3953 0.03% 41 4111 0.04% 42 4323 0.04% 43 4653 0.04% 44 4639 0.04% 45 4783 0.04% 46 4862 0.04% 47 5172 0.05% 48 5441 0.05% 49 5638 0.05% 50 5765 0.05% 51 6108 0.05% 52 6333 0.06% 53 6877 0.06% 54 7567 0.07% 55 7373 0.07% 56 7943 0.07% 57 7906 0.07% 58 8462 0.07% 59 8126 0.07% 60 8082 0.07% 61 8351 0.07% 62 8575 0.08% 63 8381 0.07% 64 8697 0.08% 65 8554 0.08% 66 8546 0.08% 67 8697 0.08% 68 9365 0.08% 69 8999 0.08% 70 8834 0.08% 71 9533 0.08% 72 9785 0.09% 73 9650 0.09% 74 9529 0.08% 75 9920 0.09% 76 6705 0.06% 77 7708 0.07% 78 9518 0.08% 79 10325 0.09% 80 11066 0.10% 81 12235 0.11% 82 13635 0.12% 83 13939 0.12% 84 14795 0.13% 85 16133 0.14% 86 17522 0.15% 87 19848 0.18% 88 20403 0.18% 89 23206 0.20% 90 25002 0.22% 91 27283 0.24% 92 31812 0.28% 93 36248 0.32% 94 41799 0.37% 95 51698 0.46% 96 62579 0.55% 97 76234 0.67% 98 98876 0.87% 99 124787 1.10% 100 10245570 90.41% 11332774 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=33 prefix-density=0.32 prefix-fanout=2.0 sequence=CCGGCGATGCGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=24 fanout-score=75.91 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=13.5 sequence=GCAGCAGCAGCAA Started job on | Feb 11 13:20:11 Started mapping on | Feb 11 13:20:11 Finished on | Feb 11 13:20:34 Mapping speed, Million of reads per hour | 1773.83 Number of input reads | 11332774 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 8371070 Uniquely mapped reads % | 73.87% Average mapped length | 98.37 Number of splices: Total | 2404275 Number of splices: Annotated (sjdb) | 2354151 Number of splices: GT/AG | 2365855 Number of splices: GC/AG | 31882 Number of splices: AT/AC | 2572 Number of splices: Non-canonical | 3966 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 2.05 Insertion rate per base | 0.01% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 307873 % of reads mapped to multiple loci | 2.72% Number of reads mapped to too many loci | 2447289 % of reads mapped to too many loci | 21.59% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.79% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2653831 2653831 2653831 N_multimapping 307873 307873 307873 N_noFeature 401917 4372611 4343490 N_ambiguous 87176 15056 15377 UnstrandedReadsAssigned:7881977 PositiveStrandReadsAssigned:3983403 NegativeStrandReadsAssigned:4012203 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207904 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207904-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,332,774 reads, 10,278,776 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,156 rounds 52401 SRR3207904.ke.tsv 34699 SRR3207904.se.tsv 87100 total ==> SRR3207904.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 304 20.2354 Potri.005G024800.1.v4.1 1035 936 138 18.8329 Potri.004G059700.1.v4.1 961 862 24 3.55646 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 223.372 10.0326 Potri.016G087400.1.v4.1 270 171 314 234.556 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 24.6665 1.8822 Potri.012G127500.1.v4.1 977 878 1880 273.512 ==> SRR3207904.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 599 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 144 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 27 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR3207904 completed mapping pipeline successfully