Starting /dee2/code/volunteer_pipeline.sh SRR3207905 current disk space = 3050250833920 free memory = 1513506636 SRR3207905 SRAfilesize 0616c42034ad41d9375b141ce9c8ccb2 SRR3207905.sra SRR3207905.sra file validated SRR3207905 is single end SRR3207905 is conventional basespace SRR3207905 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207905_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 42 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9375 34.0 33.0 34.0 31.0 34.0 2 33.25775 34.0 34.0 34.0 31.0 34.0 3 33.39275 34.0 34.0 34.0 31.0 34.0 4 36.5595 37.0 37.0 37.0 35.0 37.0 5 36.5955 37.0 37.0 37.0 35.0 37.0 6 36.60525 37.0 37.0 37.0 35.0 37.0 7 36.614 37.0 37.0 37.0 35.0 37.0 8 36.6115 37.0 37.0 37.0 35.0 37.0 9 38.45925 39.0 39.0 39.0 37.0 39.0 10-11 38.530874999999995 39.0 39.0 39.0 37.0 39.0 12-13 38.458625 39.0 39.0 39.0 37.0 39.0 14-15 40.111 41.0 40.0 41.0 38.0 41.0 16-17 40.025375 41.0 40.0 41.0 38.0 41.0 18-19 39.907375 41.0 40.0 41.0 38.0 41.0 20-21 39.968875 41.0 40.0 41.0 38.0 41.0 22-23 39.877125 41.0 40.0 41.0 38.0 41.0 24-25 39.82775 41.0 40.0 41.0 38.0 41.0 26-27 39.622375 41.0 40.0 41.0 37.5 41.0 28-29 39.454499999999996 41.0 40.0 41.0 37.0 41.0 30-31 39.26075 41.0 39.0 41.0 36.5 41.0 32-33 39.49325 41.0 40.0 41.0 37.0 41.0 34-35 39.528875 41.0 40.0 41.0 37.5 41.0 36-37 39.505875 41.0 40.0 41.0 37.0 41.0 38-39 39.339124999999996 41.0 40.0 41.0 37.0 41.0 40-41 39.27475 41.0 40.0 41.0 37.0 41.0 42-43 39.258125 41.0 40.0 41.0 37.0 41.0 44-45 39.1875 41.0 40.0 41.0 36.0 41.0 46-47 39.114125 41.0 40.0 41.0 36.0 41.0 48-49 39.141999999999996 41.0 40.0 41.0 36.0 41.0 50-51 38.89775 40.5 39.0 41.0 35.5 41.0 52-53 38.790125 40.0 39.0 41.0 35.0 41.0 54-55 38.661375 40.0 39.0 41.0 35.0 41.0 56-57 38.320499999999996 40.0 38.5 41.0 34.5 41.0 58-59 38.295125 40.0 38.0 41.0 34.5 41.0 60-61 38.12575 40.0 38.0 41.0 34.0 41.0 62-63 37.8445 40.0 37.0 41.0 34.0 41.0 64-65 37.528375 39.5 36.5 41.0 33.5 41.0 66-67 37.163375 39.0 36.0 41.0 33.0 41.0 68-69 36.788 39.0 35.5 40.0 32.5 41.0 70-71 36.4055 38.0 35.0 40.0 32.0 41.0 72-73 35.95399999999999 37.0 35.0 39.5 32.0 41.0 74-75 35.547375 37.0 35.0 39.0 31.5 41.0 76-77 34.471875 35.5 34.0 38.0 30.5 39.0 78-79 34.830749999999995 36.0 35.0 37.5 31.0 39.5 80-81 34.437625 35.5 34.5 37.0 31.0 39.0 82-83 34.163125 35.0 34.0 37.0 31.0 39.0 84-85 33.837875 35.0 34.0 36.0 30.5 38.0 86-87 33.591750000000005 35.0 34.0 36.0 31.0 37.0 88-89 33.27 35.0 34.0 35.5 30.0 37.0 90-91 33.022625000000005 35.0 34.0 35.0 30.0 36.0 92-93 32.755875 35.0 34.0 35.0 29.0 36.0 94-95 32.56825 35.0 34.0 35.0 29.0 36.0 96-97 32.317375 35.0 34.0 35.0 29.0 36.0 98-99 32.101875 35.0 34.0 35.0 29.0 35.5 100 31.90825 35.0 33.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 1.0 9 1.0 10 5.0 11 3.0 12 5.0 13 4.0 14 3.0 15 2.0 16 9.0 17 6.0 18 7.0 19 8.0 20 9.0 21 9.0 22 10.0 23 14.0 24 6.0 25 17.0 26 8.0 27 18.0 28 18.0 29 24.0 30 33.0 31 53.0 32 35.0 33 55.0 34 93.0 35 145.0 36 284.0 37 799.0 38 1686.0 39 627.0 40 2.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 24.34673366834171 20.0 15.678391959798995 39.9748743718593 2 20.7 23.925 31.474999999999998 23.9 3 18.2 27.55 29.725 24.525 4 21.4 32.175 25.75 20.674999999999997 5 23.10577644411103 34.48362090522631 25.131282820705174 17.27931982995749 6 19.625 36.925000000000004 25.674999999999997 17.775 7 16.7 26.575 37.15 19.575 8 17.075000000000003 27.200000000000003 34.575 21.15 9 17.474999999999998 25.124999999999996 33.95 23.45 10-11 20.3625 31.95 27.025 20.6625 12-13 20.549999999999997 29.037499999999998 29.037499999999998 21.375 14-15 20.525 30.85 28.349999999999998 20.275000000000002 16-17 21.2 28.825 28.299999999999997 21.675 18-19 20.625 29.5 27.900000000000002 21.975 20-21 21.025 29.125 28.525 21.325 22-23 20.95 28.625 28.4 22.025 24-25 20.349999999999998 28.749999999999996 29.7375 21.1625 26-27 20.837500000000002 29.925 28.537499999999998 20.7 28-29 20.5375 29.5375 28.775000000000002 21.15 30-31 21.4125 28.812500000000004 28.4 21.375 32-33 20.275000000000002 29.25 29.2375 21.2375 34-35 21.175 29.212500000000002 28.512500000000003 21.099999999999998 36-37 21.2875 29.2875 28.775000000000002 20.65 38-39 21.15 29.1875 28.5875 21.075 40-41 21.575 29.612500000000004 27.462500000000002 21.349999999999998 42-43 20.4 28.0875 29.599999999999998 21.912499999999998 44-45 20.4875 29.2375 28.287499999999998 21.987499999999997 46-47 20.424999999999997 29.1625 29.1875 21.224999999999998 48-49 21.0 29.525000000000002 28.1875 21.2875 50-51 21.077634704338042 29.44118014751844 28.703587948493563 20.777597199649954 52-53 21.325 29.1125 28.462500000000002 21.099999999999998 54-55 19.9875 30.375000000000004 28.725 20.9125 56-57 20.4875 29.075 29.049999999999997 21.3875 58-59 20.525 29.6875 28.3375 21.45 60-61 21.325 28.975 27.950000000000003 21.75 62-63 20.4125 29.5875 28.625 21.375 64-65 20.990123765470685 29.11613951743968 28.57857232154019 21.315164395549445 66-67 21.390173771721464 29.378672334041756 28.216027003375423 21.015126890861357 68-69 21.1125 30.625000000000004 28.4 19.8625 70-71 20.974999999999998 29.099999999999998 28.95 20.974999999999998 72-73 20.375 29.462500000000002 28.9 21.2625 74-75 20.4625 29.475 29.062500000000004 21.0 76-77 20.3875 30.0 28.5875 21.025 78-79 20.5 29.812499999999996 28.4 21.2875 80-81 20.840105013126642 28.94111763970496 28.703587948493563 21.515189398674835 82-83 20.825 29.049999999999997 29.975 20.150000000000002 84-85 21.637500000000003 28.425 28.925 21.0125 86-87 20.42755344418052 29.128641080135015 29.791223902987873 20.652581572696587 88-89 21.8304576144036 28.80720180045011 29.019754938734682 20.342585646411603 90-91 21.605401350337583 28.93223305826457 28.732183045761438 20.730182545636406 92-93 20.342585646411603 29.132283070767688 29.532383095773945 20.99274818704676 94-95 20.865108138517314 28.20352544068008 29.641205150643827 21.29016127015877 96-97 20.31757939484871 29.457364341085274 29.669917479369843 20.555138784696176 98-99 22.540317539692463 29.391173896737094 27.69096137017127 20.377547193399177 100 20.45 28.925 28.299999999999997 22.325 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.5 17 2.0 18 4.0 19 6.0 20 4.5 21 9.5 22 13.5 23 13.5 24 18.5 25 26.0 26 33.5 27 38.0 28 38.0 29 44.5 30 62.5 31 67.5 32 77.0 33 95.5 34 95.5 35 107.5 36 136.5 37 150.0 38 167.0 39 184.0 40 184.5 41 195.5 42 192.0 43 185.5 44 203.0 45 220.0 46 188.5 47 160.5 48 158.0 49 148.0 50 131.5 51 109.5 52 97.0 53 78.5 54 67.5 55 52.5 56 40.5 57 35.0 58 30.5 59 25.5 60 16.5 61 12.0 62 15.0 63 15.0 64 7.5 65 4.0 66 4.0 67 5.5 68 4.5 69 2.5 70 1.0 71 1.0 72 2.0 73 2.5 74 2.0 75 0.5 76 0.5 77 1.0 78 1.5 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0125 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0125 66-67 0.0125 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0125 82-83 0.0 84-85 0.0 86-87 0.0125 88-89 0.025 90-91 0.025 92-93 0.025 94-95 0.0125 96-97 0.025 98-99 0.0125 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88 0.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 521038 spots for SRR3207905.sra Written 521038 spots for SRR3207905.sra Read 521038 spots for SRR3207905.sra Written 521038 spots for SRR3207905.sra Read 521038 spots for SRR3207905.sra Written 521038 spots for SRR3207905.sra Read 521038 spots for SRR3207905.sra Written 521038 spots for SRR3207905.sra Read 521038 spots for SRR3207905.sra Written 521038 spots for SRR3207905.sra Read 521038 spots for SRR3207905.sra Written 521038 spots for SRR3207905.sra Read 521038 spots for SRR3207905.sra Written 521038 spots for SRR3207905.sra Read 521038 spots for SRR3207905.sra Written 521038 spots for SRR3207905.sra Read 521038 spots for SRR3207905.sra Written 521038 spots for SRR3207905.sra Read 521038 spots for SRR3207905.sra Written 521038 spots for SRR3207905.sra Read 521038 spots for SRR3207905.sra Written 521038 spots for SRR3207905.sra Read 521038 spots for SRR3207905.sra Written 521038 spots for SRR3207905.sra Read 521040 spots for SRR3207905.sra Written 521040 spots for SRR3207905.sra Read 521038 spots for SRR3207905.sra Written 521038 spots for SRR3207905.sra Read 521038 spots for SRR3207905.sra Written 521038 spots for SRR3207905.sra Read 521038 spots for SRR3207905.sra Written 521038 spots for SRR3207905.sra Read 521038 spots for SRR3207905.sra Written 521038 spots for SRR3207905.sra Read 521038 spots for SRR3207905.sra Written 521038 spots for SRR3207905.sra Read 521038 spots for SRR3207905.sra Written 521038 spots for SRR3207905.sra Read 521038 spots for SRR3207905.sra Written 521038 spots for SRR3207905.sra SRR ids: ['SRR3207905.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7anpmwkb SRR3207905.sra spots: 10420762 blocks: [[1, 521038], [521039, 1042076], [1042077, 1563114], [1563115, 2084152], [2084153, 2605190], [2605191, 3126228], [3126229, 3647266], [3647267, 4168304], [4168305, 4689342], [4689343, 5210380], [5210381, 5731418], [5731419, 6252456], [6252457, 6773494], [6773495, 7294532], [7294533, 7815570], [7815571, 8336608], [8336609, 8857646], [8857647, 9378684], [9378685, 9899722], [9899723, 10420762]] SRR3207905 file size 2701057 SRR3207905 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207905 SRR3207905_1.fastq Input file: SRR3207905_1.fastq trimmed: SRR3207905-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 13:45:03 2025 >> started Tue Feb 11 13:45:08 2025 >> done (5.530s) 10420762 reads processed; of these: 2259 ( 0.02%) short reads filtered out after trimming by size control 20360 ( 0.20%) empty reads filtered out after trimming by size control 10398143 (99.78%) reads available; of these: 873209 ( 8.40%) trimmed reads available after processing 9524934 (91.60%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 457 0.00% 19 579 0.01% 20 675 0.01% 21 906 0.01% 22 1205 0.01% 23 1555 0.01% 24 2079 0.02% 25 2579 0.02% 26 2446 0.02% 27 2435 0.02% 28 2620 0.03% 29 2577 0.02% 30 2609 0.03% 31 2625 0.03% 32 2510 0.02% 33 2674 0.03% 34 2689 0.03% 35 2808 0.03% 36 2950 0.03% 37 3023 0.03% 38 3258 0.03% 39 3390 0.03% 40 3542 0.03% 41 3487 0.03% 42 3623 0.03% 43 3846 0.04% 44 4006 0.04% 45 4252 0.04% 46 4218 0.04% 47 4299 0.04% 48 4583 0.04% 49 4949 0.05% 50 5156 0.05% 51 5320 0.05% 52 5485 0.05% 53 5994 0.06% 54 6341 0.06% 55 6241 0.06% 56 6698 0.06% 57 6623 0.06% 58 7210 0.07% 59 7176 0.07% 60 7056 0.07% 61 7283 0.07% 62 7483 0.07% 63 7191 0.07% 64 7356 0.07% 65 7209 0.07% 66 7458 0.07% 67 7498 0.07% 68 8065 0.08% 69 7444 0.07% 70 7443 0.07% 71 7677 0.07% 72 7851 0.08% 73 7922 0.08% 74 7963 0.08% 75 7807 0.08% 76 5809 0.06% 77 6636 0.06% 78 7743 0.07% 79 8563 0.08% 80 8841 0.09% 81 9864 0.09% 82 10559 0.10% 83 11221 0.11% 84 11695 0.11% 85 12493 0.12% 86 13786 0.13% 87 15499 0.15% 88 15654 0.15% 89 16997 0.16% 90 18638 0.18% 91 20797 0.20% 92 24143 0.23% 93 26853 0.26% 94 31645 0.30% 95 37715 0.36% 96 47235 0.45% 97 58088 0.56% 98 77783 0.75% 99 102548 0.99% 100 9524934 91.60% 10398143 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=4.06 fanout-score-rank=24 prefix-density=0.28 prefix-fanout=3.4 sequence=GCCTGTAATCCCAGCACTTTGGGAGGCC criterion=fanout-score sequence-density=0.10 sequence-density-rank=30 fanout-score=29.81 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=11.8 sequence=AAAAGGAAATATCTTC Started job on | Feb 11 13:45:36 Started mapping on | Feb 11 13:45:36 Finished on | Feb 11 13:46:49 Mapping speed, Million of reads per hour | 512.79 Number of input reads | 10398143 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 4969019 Uniquely mapped reads % | 47.79% Average mapped length | 98.25 Number of splices: Total | 1345060 Number of splices: Annotated (sjdb) | 1318239 Number of splices: GT/AG | 1323613 Number of splices: GC/AG | 17356 Number of splices: AT/AC | 1663 Number of splices: Non-canonical | 2428 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 1.98 Insertion rate per base | 0.01% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 138136 % of reads mapped to multiple loci | 1.33% Number of reads mapped to too many loci | 111727 % of reads mapped to too many loci | 1.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 49.79% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5290988 5290988 5290988 N_multimapping 138136 138136 138136 N_noFeature 188845 2569774 2547710 N_ambiguous 58463 8990 9206 UnstrandedReadsAssigned:4721711 PositiveStrandReadsAssigned:2390255 NegativeStrandReadsAssigned:2412103 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207905 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207905-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,398,143 reads, 4,931,300 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,100 rounds 52401 SRR3207905.ke.tsv 34699 SRR3207905.se.tsv 87100 total ==> SRR3207905.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 371 50.2211 Potri.005G024800.1.v4.1 1035 936 164 45.5151 Potri.004G059700.1.v4.1 961 862 20 6.02713 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 113 10.3214 Potri.016G087400.1.v4.1 270 171 206 312.938 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 24 3.72429 Potri.012G127500.1.v4.1 977 878 1429 422.791 ==> SRR3207905.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 391 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 87 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR3207905 completed mapping pipeline successfully