Starting /dee2/code/volunteer_pipeline.sh SRR3207906 current disk space = 3050273890304 free memory = 1488978060 SRR3207906 SRAfilesize 883e6388b42692c8b8ddbfcb14d63a74 SRR3207906.sra SRR3207906.sra file validated SRR3207906 is single end SRR3207906 is conventional basespace SRR3207906 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207906_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9255 34.0 33.0 34.0 31.0 34.0 2 33.26025 34.0 34.0 34.0 31.0 34.0 3 33.45575 34.0 34.0 34.0 31.0 34.0 4 36.634 37.0 37.0 37.0 35.0 37.0 5 36.63 37.0 37.0 37.0 35.0 37.0 6 36.64925 37.0 37.0 37.0 35.0 37.0 7 36.66125 37.0 37.0 37.0 35.0 37.0 8 36.6325 37.0 37.0 37.0 35.0 37.0 9 38.5115 39.0 39.0 39.0 37.0 39.0 10-11 38.544624999999996 39.0 39.0 39.0 38.0 39.0 12-13 38.501625000000004 39.0 39.0 39.0 37.0 39.0 14-15 40.09675 41.0 40.0 41.0 38.0 41.0 16-17 40.020250000000004 41.0 40.0 41.0 38.0 41.0 18-19 39.882125 41.0 40.0 41.0 38.0 41.0 20-21 39.936 41.0 40.0 41.0 38.0 41.0 22-23 39.9335 41.0 40.0 41.0 38.0 41.0 24-25 39.8885 41.0 40.0 41.0 38.0 41.0 26-27 39.757125 41.0 40.0 41.0 38.0 41.0 28-29 39.541 41.0 40.0 41.0 37.0 41.0 30-31 39.326125000000005 41.0 39.0 41.0 36.5 41.0 32-33 39.5975 41.0 40.0 41.0 37.5 41.0 34-35 39.721000000000004 41.0 40.0 41.0 38.0 41.0 36-37 39.698499999999996 41.0 40.0 41.0 38.0 41.0 38-39 39.534125 41.0 40.0 41.0 37.0 41.0 40-41 39.510125 41.0 40.0 41.0 37.0 41.0 42-43 39.487875 41.0 40.0 41.0 37.0 41.0 44-45 39.378125 41.0 40.0 41.0 37.0 41.0 46-47 39.20725 41.0 40.0 41.0 36.5 41.0 48-49 39.256625 41.0 40.0 41.0 36.5 41.0 50-51 38.969625 40.5 39.0 41.0 35.5 41.0 52-53 38.77275 40.0 39.0 41.0 35.0 41.0 54-55 38.730000000000004 40.0 38.5 41.0 35.0 41.0 56-57 38.394625 40.0 38.0 41.0 34.5 41.0 58-59 38.28975 40.0 38.0 41.0 34.0 41.0 60-61 38.148624999999996 40.0 37.0 41.0 34.0 41.0 62-63 37.796875 39.5 37.0 41.0 34.0 41.0 64-65 37.494249999999994 39.0 36.0 41.0 34.0 41.0 66-67 37.109875 39.0 36.0 40.0 33.5 41.0 68-69 36.7615 38.0 35.0 40.0 33.0 41.0 70-71 36.236125 37.0 35.0 39.5 32.0 41.0 72-73 35.801500000000004 37.0 35.0 39.0 32.0 40.5 74-75 35.391125 36.0 35.0 38.5 32.0 40.0 76-77 34.30525 35.0 34.0 37.0 30.5 39.0 78-79 34.587125 35.0 34.5 37.0 31.5 39.0 80-81 34.25175 35.0 34.0 36.5 31.0 37.5 82-83 34.04175 35.0 34.0 36.0 32.0 37.0 84-85 33.75375 35.0 34.0 36.0 31.0 37.0 86-87 33.529875000000004 35.0 34.0 35.0 31.0 36.0 88-89 33.278375 35.0 34.0 35.0 31.0 36.0 90-91 33.008624999999995 35.0 34.0 35.0 30.5 36.0 92-93 32.923500000000004 35.0 34.0 35.0 31.0 35.5 94-95 32.774625 35.0 34.0 35.0 30.0 35.0 96-97 32.628 35.0 34.0 35.0 30.0 35.0 98-99 32.398375 35.0 34.0 35.0 29.5 35.0 100 32.192 35.0 33.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 8.0 13 3.0 14 7.0 15 2.0 16 9.0 17 5.0 18 8.0 19 5.0 20 2.0 21 6.0 22 8.0 23 6.0 24 4.0 25 13.0 26 18.0 27 16.0 28 19.0 29 22.0 30 26.0 31 39.0 32 46.0 33 61.0 34 85.0 35 154.0 36 274.0 37 923.0 38 1867.0 39 362.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.252081756245268 14.408276558163008 13.146606106484986 45.19303557910674 2 20.474999999999998 21.75 36.875 20.9 3 21.224999999999998 25.25 26.700000000000003 26.825 4 25.55 30.175 20.225 24.05 5 24.675 34.775 22.275 18.275 6 19.45 36.5 23.674999999999997 20.375 7 16.2 20.9 43.0 19.900000000000002 8 18.05 24.825 30.425 26.700000000000003 9 18.525 23.625 32.025 25.825 10-11 22.0125 33.3625 23.6625 20.962500000000002 12-13 21.0625 26.275 29.125 23.5375 14-15 21.4875 28.8375 27.325 22.35 16-17 22.1 28.6125 27.537499999999998 21.75 18-19 21.725 27.450000000000003 28.725 22.1 20-21 21.337500000000002 28.325 27.125 23.2125 22-23 21.7875 28.3125 27.875 22.025 24-25 21.512500000000003 29.45 26.437500000000004 22.6 26-27 21.2625 28.999999999999996 26.987499999999997 22.75 28-29 21.55 28.799999999999997 27.3375 22.3125 30-31 21.05 28.875 28.012500000000003 22.0625 32-33 21.5 29.725 26.7625 22.0125 34-35 21.3625 29.0875 27.05 22.5 36-37 21.3625 28.262500000000003 28.4375 21.9375 38-39 22.0875 28.012500000000003 27.725 22.175 40-41 21.775 28.675 27.325 22.225 42-43 21.475 27.875 28.487499999999997 22.162499999999998 44-45 21.75 28.287499999999998 27.6125 22.35 46-47 21.2375 28.125 27.762500000000003 22.875 48-49 21.8875 28.1875 27.5125 22.412499999999998 50-51 21.7385866166354 28.855534709193247 27.066916823014388 22.338961851156974 52-53 22.097097097097095 28.365865865865864 27.289789789789793 22.24724724724725 54-55 21.9 28.575 27.437499999999996 22.0875 56-57 22.1 29.125 26.55 22.225 58-59 21.8875 28.237499999999997 28.0625 21.8125 60-61 21.9 28.499999999999996 27.537499999999998 22.0625 62-63 21.5625 28.5625 27.450000000000003 22.425 64-65 21.9625 28.6375 27.525 21.875 66-67 21.85 28.237499999999997 28.012500000000003 21.9 68-69 21.637500000000003 28.95 26.8625 22.55 70-71 22.325 28.0875 27.962500000000002 21.625 72-73 21.75 28.225 27.962500000000002 22.0625 74-75 21.725 28.212500000000002 28.0875 21.975 76-77 22.8125 26.85 28.299999999999997 22.037499999999998 78-79 21.9625 27.950000000000003 28.175 21.912499999999998 80-81 22.0875 28.0875 28.1 21.725 82-83 22.237499999999997 27.5125 27.987499999999997 22.2625 84-85 21.95 28.262500000000003 28.537499999999998 21.25 86-87 22.3 27.487499999999997 27.8625 22.35 88-89 22.495935975990996 27.947980492684753 27.710391396773794 21.845692134550458 90-91 22.95758788940323 27.323908419867383 28.912798698861504 20.805704991867884 92-93 23.080770192548137 27.131782945736433 28.107026756689173 21.680420105026258 94-95 21.8625 27.700000000000003 28.325 22.112499999999997 96-97 22.3 28.575 27.8125 21.3125 98-99 21.349999999999998 28.449999999999996 28.6125 21.587500000000002 100 21.975 28.975 26.224999999999998 22.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 0.5 23 1.0 24 1.0 25 2.0 26 4.5 27 6.5 28 8.5 29 10.0 30 13.5 31 17.0 32 25.5 33 39.5 34 46.5 35 72.0 36 100.5 37 108.5 38 132.0 39 172.5 40 210.0 41 245.0 42 267.0 43 266.5 44 264.5 45 264.5 46 252.5 47 249.0 48 232.5 49 187.0 50 155.5 51 137.0 52 108.5 53 85.5 54 69.5 55 52.0 56 38.0 57 30.5 58 25.0 59 18.5 60 16.5 61 14.5 62 10.5 63 6.5 64 7.0 65 5.0 66 2.5 67 3.0 68 3.0 69 2.5 70 2.5 71 1.0 72 0.0 73 1.5 74 1.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.9249999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0625 52-53 0.1 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0375 90-91 0.08750000000000001 92-93 0.025 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88 0.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1024031 spots for SRR3207906.sra Written 1024031 spots for SRR3207906.sra Read 1024031 spots for SRR3207906.sra Written 1024031 spots for SRR3207906.sra Read 1024031 spots for SRR3207906.sra Written 1024031 spots for SRR3207906.sra Read 1024031 spots for SRR3207906.sra Written 1024031 spots for SRR3207906.sra Read 1024031 spots for SRR3207906.sra Written 1024031 spots for SRR3207906.sra Read 1024031 spots for SRR3207906.sra Written 1024031 spots for SRR3207906.sra Read 1024031 spots for SRR3207906.sra Written 1024031 spots for SRR3207906.sra Read 1024031 spots for SRR3207906.sra Written 1024031 spots for SRR3207906.sra Read 1024031 spots for SRR3207906.sra Written 1024031 spots for SRR3207906.sra Read 1024031 spots for SRR3207906.sra Written 1024031 spots for SRR3207906.sra Read 1024031 spots for SRR3207906.sra Written 1024031 spots for SRR3207906.sra Read 1024031 spots for SRR3207906.sra Written 1024031 spots for SRR3207906.sra Read 1024031 spots for SRR3207906.sra Written 1024031 spots for SRR3207906.sra Read 1024031 spots for SRR3207906.sra Written 1024031 spots for SRR3207906.sra Read 1024031 spots for SRR3207906.sra Written 1024031 spots for SRR3207906.sra Read 1024031 spots for SRR3207906.sra Written 1024031 spots for SRR3207906.sra Read 1024048 spots for SRR3207906.sra Written 1024048 spots for SRR3207906.sra Read 1024031 spots for SRR3207906.sra Written 1024031 spots for SRR3207906.sra Read 1024031 spots for SRR3207906.sra Written 1024031 spots for SRR3207906.sra Read 1024031 spots for SRR3207906.sra Written 1024031 spots for SRR3207906.sra SRR ids: ['SRR3207906.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qhdxn4gn SRR3207906.sra spots: 20480637 blocks: [[1, 1024031], [1024032, 2048062], [2048063, 3072093], [3072094, 4096124], [4096125, 5120155], [5120156, 6144186], [6144187, 7168217], [7168218, 8192248], [8192249, 9216279], [9216280, 10240310], [10240311, 11264341], [11264342, 12288372], [12288373, 13312403], [13312404, 14336434], [14336435, 15360465], [15360466, 16384496], [16384497, 17408527], [17408528, 18432558], [18432559, 19456589], [19456590, 20480637]] SRR3207906 file size 5319054 SRR3207906 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207906 SRR3207906_1.fastq Input file: SRR3207906_1.fastq trimmed: SRR3207906-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 13:51:35 2025 >> started Tue Feb 11 13:51:44 2025 >> done (9.217s) 20480637 reads processed; of these: 3211 ( 0.02%) short reads filtered out after trimming by size control 22942 ( 0.11%) empty reads filtered out after trimming by size control 20454484 (99.87%) reads available; of these: 1703866 ( 8.33%) trimmed reads available after processing 18750618 (91.67%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 582 0.00% 19 770 0.00% 20 849 0.00% 21 1119 0.01% 22 1593 0.01% 23 2058 0.01% 24 2618 0.01% 25 3728 0.02% 26 3962 0.02% 27 3835 0.02% 28 4363 0.02% 29 4938 0.02% 30 4900 0.02% 31 4428 0.02% 32 3920 0.02% 33 4137 0.02% 34 4407 0.02% 35 4634 0.02% 36 4846 0.02% 37 4958 0.02% 38 5264 0.03% 39 5484 0.03% 40 5883 0.03% 41 5847 0.03% 42 6238 0.03% 43 6529 0.03% 44 7022 0.03% 45 7184 0.04% 46 7498 0.04% 47 7825 0.04% 48 8026 0.04% 49 8728 0.04% 50 9116 0.04% 51 9280 0.05% 52 9804 0.05% 53 10469 0.05% 54 11497 0.06% 55 11726 0.06% 56 12065 0.06% 57 12228 0.06% 58 12975 0.06% 59 12910 0.06% 60 12922 0.06% 61 13170 0.06% 62 13482 0.07% 63 12944 0.06% 64 13176 0.06% 65 13135 0.06% 66 13308 0.07% 67 13891 0.07% 68 14794 0.07% 69 14142 0.07% 70 14008 0.07% 71 14540 0.07% 72 15074 0.07% 73 15331 0.07% 74 15122 0.07% 75 15220 0.07% 76 10748 0.05% 77 12593 0.06% 78 14858 0.07% 79 16367 0.08% 80 17593 0.09% 81 18737 0.09% 82 20511 0.10% 83 21870 0.11% 84 22380 0.11% 85 24208 0.12% 86 26819 0.13% 87 29887 0.15% 88 31119 0.15% 89 33755 0.17% 90 37183 0.18% 91 41160 0.20% 92 48478 0.24% 93 55099 0.27% 94 64889 0.32% 95 78003 0.38% 96 98164 0.48% 97 121327 0.59% 98 162095 0.79% 99 211521 1.03% 100 18750618 91.67% 20454484 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=17.30 fanout-score-rank=13 prefix-density=0.13 prefix-fanout=17.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCC criterion=fanout-score sequence-density=0.04 sequence-density-rank=20 fanout-score=297.72 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=28.2 sequence=TTCTTCTTCTTC Started job on | Feb 11 13:52:02 Started mapping on | Feb 11 13:52:02 Finished on | Feb 11 13:52:25 Mapping speed, Million of reads per hour | 3201.57 Number of input reads | 20454484 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 19413193 Uniquely mapped reads % | 94.91% Average mapped length | 98.34 Number of splices: Total | 5566984 Number of splices: Annotated (sjdb) | 5461341 Number of splices: GT/AG | 5479349 Number of splices: GC/AG | 72729 Number of splices: AT/AC | 6075 Number of splices: Non-canonical | 8831 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 1.97 Insertion rate per base | 0.01% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 483318 % of reads mapped to multiple loci | 2.36% Number of reads mapped to too many loci | 218027 % of reads mapped to too many loci | 1.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.65% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 557973 557973 557973 N_multimapping 483318 483318 483318 N_noFeature 743613 10022346 9980639 N_ambiguous 222394 33943 35033 UnstrandedReadsAssigned:18447186 PositiveStrandReadsAssigned:9356904 NegativeStrandReadsAssigned:9397521 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207906 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207906-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,454,484 reads, 19,031,187 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,220 rounds 52401 SRR3207906.ke.tsv 34699 SRR3207906.se.tsv 87100 total ==> SRR3207906.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 722 26.881 Potri.005G024800.1.v4.1 1035 936 219 16.7167 Potri.004G059700.1.v4.1 961 862 52 4.31001 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 431.634 10.8435 Potri.016G087400.1.v4.1 270 171 1007 420.742 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 116.6 4.97654 Potri.012G127500.1.v4.1 977 878 3406 277.161 ==> SRR3207906.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2512 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 426 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 49 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR3207906 completed mapping pipeline successfully