Starting /dee2/code/volunteer_pipeline.sh SRR3207907 current disk space = 3050395066368 free memory = 1437340168 SRR3207907 SRAfilesize 86dadf65b1cd59a1858c58287f6960ee SRR3207907.sra SRR3207907.sra file validated SRR3207907 is single end SRR3207907 is conventional basespace SRR3207907 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207907_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.95 34.0 33.0 34.0 31.0 34.0 2 33.2535 34.0 34.0 34.0 31.0 34.0 3 33.4405 34.0 34.0 34.0 31.0 34.0 4 36.64425 37.0 37.0 37.0 35.0 37.0 5 36.63825 37.0 37.0 37.0 35.0 37.0 6 36.62525 37.0 37.0 37.0 35.0 37.0 7 36.6165 37.0 37.0 37.0 35.0 37.0 8 36.63775 37.0 37.0 37.0 35.0 37.0 9 38.508 39.0 39.0 39.0 37.0 39.0 10-11 38.531625000000005 39.0 39.0 39.0 38.0 39.0 12-13 38.461 39.0 39.0 39.0 37.0 39.0 14-15 40.094125000000005 41.0 40.0 41.0 38.0 41.0 16-17 40.033500000000004 41.0 40.0 41.0 38.0 41.0 18-19 39.945375 41.0 40.0 41.0 38.0 41.0 20-21 39.993750000000006 41.0 40.0 41.0 38.0 41.0 22-23 39.927625000000006 41.0 40.0 41.0 38.0 41.0 24-25 39.895250000000004 41.0 40.0 41.0 38.0 41.0 26-27 39.782624999999996 41.0 40.0 41.0 38.0 41.0 28-29 39.60625 41.0 40.0 41.0 37.5 41.0 30-31 39.327875 41.0 39.0 41.0 36.5 41.0 32-33 39.503 41.0 40.0 41.0 37.0 41.0 34-35 39.576375 41.0 40.0 41.0 37.0 41.0 36-37 39.563 41.0 40.0 41.0 37.0 41.0 38-39 39.370125 41.0 40.0 41.0 36.0 41.0 40-41 39.26025 41.0 40.0 41.0 36.0 41.0 42-43 39.23075 41.0 40.0 41.0 36.0 41.0 44-45 39.164500000000004 41.0 39.5 41.0 36.0 41.0 46-47 39.02275 41.0 39.0 41.0 35.0 41.0 48-49 38.9895 41.0 39.0 41.0 35.0 41.0 50-51 38.649874999999994 40.5 38.5 41.0 34.5 41.0 52-53 38.438625 40.0 38.0 41.0 35.0 41.0 54-55 38.40875 40.0 38.0 41.0 35.0 41.0 56-57 38.06375 40.0 37.5 41.0 34.0 41.0 58-59 37.986000000000004 40.0 37.0 41.0 34.0 41.0 60-61 37.837375 40.0 37.0 41.0 34.0 41.0 62-63 37.445625 39.0 36.0 41.0 33.5 41.0 64-65 37.131875 39.0 35.5 41.0 33.0 41.0 66-67 36.715125 38.5 35.0 40.0 33.0 41.0 68-69 36.36387499999999 37.5 35.0 40.0 33.0 41.0 70-71 35.932500000000005 37.0 35.0 39.0 32.5 41.0 72-73 35.419125 36.5 35.0 39.0 31.0 40.5 74-75 34.992999999999995 36.0 35.0 38.5 31.0 39.5 76-77 33.961875 35.0 33.5 37.0 30.0 39.0 78-79 34.346875 35.0 34.0 37.0 31.5 39.0 80-81 34.053625 35.0 34.0 36.5 31.0 37.5 82-83 33.835375 35.0 34.0 36.0 31.0 37.0 84-85 33.576 35.0 34.0 36.0 31.0 37.0 86-87 33.349999999999994 35.0 34.0 35.0 31.0 36.0 88-89 33.141999999999996 35.0 34.0 35.0 30.5 36.0 90-91 32.953125 35.0 34.0 35.0 30.0 36.0 92-93 32.69775 35.0 34.0 35.0 30.0 35.5 94-95 32.541124999999994 35.0 34.0 35.0 29.0 35.0 96-97 32.459875 35.0 34.0 35.0 29.0 35.0 98-99 32.32825 35.0 33.5 35.0 29.0 35.0 100 32.07875 35.0 33.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 1.0 9 1.0 10 3.0 11 5.0 12 2.0 13 8.0 14 3.0 15 6.0 16 4.0 17 3.0 18 9.0 19 7.0 20 11.0 21 12.0 22 7.0 23 7.0 24 9.0 25 7.0 26 15.0 27 14.0 28 26.0 29 22.0 30 22.0 31 36.0 32 38.0 33 84.0 34 94.0 35 152.0 36 354.0 37 956.0 38 1721.0 39 359.0 40 1.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 27.77917822031762 14.847491807411142 14.091252835896142 43.282077136375094 2 21.65 20.05 34.825 23.474999999999998 3 22.35 23.724999999999998 26.625 27.3 4 25.8 29.349999999999998 20.125 24.725 5 25.0 34.075 22.075 18.85 6 21.15 35.125 24.4 19.325 7 17.1 21.825 41.15 19.925 8 19.75 24.175 29.299999999999997 26.775 9 20.849999999999998 23.799999999999997 32.2 23.150000000000002 10-11 23.599999999999998 33.0125 22.85 20.5375 12-13 22.0625 26.6 29.275000000000002 22.0625 14-15 21.6125 27.737499999999997 28.075 22.575 16-17 22.537499999999998 28.0875 26.887499999999996 22.4875 18-19 22.3125 28.025 27.275 22.3875 20-21 22.237499999999997 27.737499999999997 27.750000000000004 22.275 22-23 21.987499999999997 29.012500000000003 26.474999999999998 22.525000000000002 24-25 22.0125 28.375 27.0 22.6125 26-27 21.8875 27.987499999999997 26.8 23.325000000000003 28-29 22.9625 26.987499999999997 26.737499999999997 23.3125 30-31 21.712500000000002 28.3875 27.037499999999998 22.8625 32-33 22.25 27.712500000000002 27.487499999999997 22.55 34-35 22.912499999999998 27.487499999999997 26.5125 23.0875 36-37 22.5125 28.125 26.887499999999996 22.475 38-39 23.65 28.3125 25.5625 22.475 40-41 22.9875 28.0625 27.125 21.825 42-43 22.1 27.737499999999997 26.887499999999996 23.275000000000002 44-45 22.5625 27.675 27.575 22.1875 46-47 22.875 27.474999999999998 27.187499999999996 22.4625 48-49 21.875 27.800000000000004 26.575 23.75 50-51 22.489055659787365 27.82989368355222 27.141963727329582 22.539086929330832 52-53 22.13053263315829 28.769692423105774 27.66941735433858 21.43035758939735 54-55 22.95 27.425 27.200000000000003 22.425 56-57 21.9625 27.712500000000002 27.525 22.8 58-59 21.975 28.025 27.3875 22.6125 60-61 23.175 27.175 27.375 22.275 62-63 22.8875 27.3125 27.025 22.775000000000002 64-65 22.665333166645834 27.415926990873857 27.303412926615827 22.615326915864483 66-67 23.002875359419928 28.091011376422053 26.478309788723593 22.42780347543443 68-69 22.402800350043755 27.665958244780597 27.665958244780597 22.26528316039505 70-71 22.6 28.4125 27.125 21.8625 72-73 22.5625 27.2625 27.287499999999998 22.8875 74-75 22.043010752688172 28.307076769192296 27.481870467616904 22.168042010502624 76-77 23.400000000000002 27.9125 26.85 21.837500000000002 78-79 22.1875 27.075 27.9125 22.825 80-81 22.26528316039505 27.365920740092513 27.953494186773348 22.415301912739093 82-83 22.615326915864483 27.565945743217902 27.603450431303912 22.215276909613703 84-85 22.330582645661416 28.032008002000502 27.24431107776944 22.393098274568644 86-87 22.230557639409852 27.631907976994246 27.769442360590148 22.36809202300575 88-89 23.52941176470588 27.609511889862326 26.44555694618273 22.415519399249064 90-91 22.866082603254068 27.822277847309135 26.65832290362954 22.65331664580726 92-93 22.17913435076307 27.60820615461596 27.745809357017766 22.466850137603203 94-95 22.980745186296573 28.169542385596397 27.53188297074269 21.31782945736434 96-97 23.25581395348837 27.51937984496124 26.569142285571395 22.655663915978995 98-99 22.59597349005877 26.93510066274853 27.84794297861698 22.620982868575716 100 23.425 26.625 27.224999999999998 22.725 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 1.0 21 1.0 22 1.0 23 2.5 24 4.5 25 6.5 26 7.5 27 5.5 28 5.0 29 9.5 30 13.5 31 18.5 32 24.5 33 31.0 34 45.0 35 68.0 36 97.0 37 105.0 38 124.0 39 170.5 40 183.0 41 186.0 42 219.0 43 256.0 44 251.0 45 244.0 46 259.0 47 245.0 48 214.5 49 190.5 50 164.5 51 145.5 52 124.0 53 96.0 54 75.5 55 59.0 56 45.0 57 33.5 58 26.0 59 36.0 60 35.5 61 22.0 62 22.5 63 16.5 64 9.5 65 7.0 66 9.0 67 9.5 68 6.0 69 8.0 70 9.0 71 4.5 72 1.5 73 6.0 74 8.5 75 7.0 76 6.0 77 4.5 78 5.5 79 4.0 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8250000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0625 52-53 0.025 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0125 66-67 0.0125 68-69 0.0125 70-71 0.0 72-73 0.0 74-75 0.025 76-77 0.0 78-79 0.0 80-81 0.0125 82-83 0.0125 84-85 0.025 86-87 0.025 88-89 0.125 90-91 0.125 92-93 0.075 94-95 0.025 96-97 0.025 98-99 0.0375 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1166077738516 98.175 2 0.8076728924785461 1.6 3 0.0757193336698637 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1492003 spots for SRR3207907.sra Written 1492003 spots for SRR3207907.sra Read 1492003 spots for SRR3207907.sra Written 1492003 spots for SRR3207907.sra Read 1492003 spots for SRR3207907.sra Written 1492003 spots for SRR3207907.sra Read 1492003 spots for SRR3207907.sra Written 1492003 spots for SRR3207907.sra Read 1492003 spots for SRR3207907.sra Written 1492003 spots for SRR3207907.sra Read 1492003 spots for SRR3207907.sra Written 1492003 spots for SRR3207907.sra Read 1492003 spots for SRR3207907.sra Written 1492003 spots for SRR3207907.sra Read 1492003 spots for SRR3207907.sra Written 1492003 spots for SRR3207907.sra Read 1492003 spots for SRR3207907.sra Written 1492003 spots for SRR3207907.sra Read 1492003 spots for SRR3207907.sra Written 1492003 spots for SRR3207907.sra Read 1492003 spots for SRR3207907.sra Written 1492003 spots for SRR3207907.sra Read 1492003 spots for SRR3207907.sra Written 1492003 spots for SRR3207907.sra Read 1492016 spots for SRR3207907.sra Written 1492016 spots for SRR3207907.sra Read 1492003 spots for SRR3207907.sra Written 1492003 spots for SRR3207907.sra Read 1492003 spots for SRR3207907.sra Written 1492003 spots for SRR3207907.sra Read 1492003 spots for SRR3207907.sra Written 1492003 spots for SRR3207907.sra Read 1492003 spots for SRR3207907.sra Written 1492003 spots for SRR3207907.sra Read 1492003 spots for SRR3207907.sra Written 1492003 spots for SRR3207907.sra Read 1492003 spots for SRR3207907.sra Written 1492003 spots for SRR3207907.sra Read 1492003 spots for SRR3207907.sra Written 1492003 spots for SRR3207907.sra SRR ids: ['SRR3207907.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ueu9y6ay SRR3207907.sra spots: 29840073 blocks: [[1, 1492003], [1492004, 2984006], [2984007, 4476009], [4476010, 5968012], [5968013, 7460015], [7460016, 8952018], [8952019, 10444021], [10444022, 11936024], [11936025, 13428027], [13428028, 14920030], [14920031, 16412033], [16412034, 17904036], [17904037, 19396039], [19396040, 20888042], [20888043, 22380045], [22380046, 23872048], [23872049, 25364051], [25364052, 26856054], [26856055, 28348057], [28348058, 29840073]] SRR3207907 file size 7754767 SRR3207907 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207907 SRR3207907_1.fastq Input file: SRR3207907_1.fastq trimmed: SRR3207907-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 13:39:50 2025 >> started Tue Feb 11 13:40:05 2025 >> done (15.115s) 29840073 reads processed; of these: 3461 ( 0.01%) short reads filtered out after trimming by size control 94458 ( 0.32%) empty reads filtered out after trimming by size control 29742154 (99.67%) reads available; of these: 2642051 ( 8.88%) trimmed reads available after processing 27100103 (91.12%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 829 0.00% 19 1002 0.00% 20 1271 0.00% 21 1764 0.01% 22 2382 0.01% 23 3092 0.01% 24 4113 0.01% 25 5698 0.02% 26 5883 0.02% 27 5885 0.02% 28 6469 0.02% 29 6900 0.02% 30 6932 0.02% 31 6445 0.02% 32 6351 0.02% 33 6327 0.02% 34 6965 0.02% 35 7284 0.02% 36 7849 0.03% 37 8045 0.03% 38 8571 0.03% 39 8974 0.03% 40 9201 0.03% 41 9406 0.03% 42 9861 0.03% 43 10485 0.04% 44 10908 0.04% 45 11265 0.04% 46 11588 0.04% 47 12260 0.04% 48 12596 0.04% 49 13675 0.05% 50 14310 0.05% 51 14604 0.05% 52 15272 0.05% 53 16054 0.05% 54 18110 0.06% 55 17792 0.06% 56 18842 0.06% 57 19053 0.06% 58 20061 0.07% 59 19791 0.07% 60 19456 0.07% 61 20087 0.07% 62 20240 0.07% 63 20097 0.07% 64 20393 0.07% 65 20497 0.07% 66 20230 0.07% 67 21274 0.07% 68 22365 0.08% 69 22226 0.07% 70 22094 0.07% 71 23925 0.08% 72 23879 0.08% 73 24890 0.08% 74 24314 0.08% 75 24228 0.08% 76 17045 0.06% 77 19417 0.07% 78 22985 0.08% 79 25077 0.08% 80 26931 0.09% 81 29546 0.10% 82 32742 0.11% 83 34053 0.11% 84 35400 0.12% 85 38748 0.13% 86 42463 0.14% 87 47387 0.16% 88 48905 0.16% 89 54932 0.18% 90 59592 0.20% 91 64783 0.22% 92 77476 0.26% 93 86821 0.29% 94 100868 0.34% 95 123325 0.41% 96 150726 0.51% 97 186423 0.63% 98 244760 0.82% 99 317286 1.07% 100 27100103 91.12% 29742154 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=39 prefix-density=0.21 prefix-fanout=1.9 sequence=CGCGCTTGGTTGAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=37 fanout-score=106.75 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=11.1 sequence=TTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCATCCAGAGCCGCAGCCACAGTTTCCTCCACAGCAAGACATTTTCTGTTG Started job on | Feb 11 13:40:22 Started mapping on | Feb 11 13:40:22 Finished on | Feb 11 13:41:08 Mapping speed, Million of reads per hour | 2327.65 Number of input reads | 29742154 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 24436271 Uniquely mapped reads % | 82.16% Average mapped length | 98.41 Number of splices: Total | 6565503 Number of splices: Annotated (sjdb) | 6423226 Number of splices: GT/AG | 6457260 Number of splices: GC/AG | 88359 Number of splices: AT/AC | 7708 Number of splices: Non-canonical | 12176 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 2.02 Insertion rate per base | 0.01% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 802499 % of reads mapped to multiple loci | 2.70% Number of reads mapped to too many loci | 3650642 % of reads mapped to too many loci | 12.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.84% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4503384 4503384 4503384 N_multimapping 802499 802499 802499 N_noFeature 1189170 12759182 12678485 N_ambiguous 279692 45686 46806 UnstrandedReadsAssigned:22967409 PositiveStrandReadsAssigned:11631403 NegativeStrandReadsAssigned:11710980 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207907 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207907-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,742,154 reads, 26,829,646 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,281 rounds 52401 SRR3207907.ke.tsv 34699 SRR3207907.se.tsv 87100 total ==> SRR3207907.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1216 29.7134 Potri.005G024800.1.v4.1 1035 936 690.028 34.5688 Potri.004G059700.1.v4.1 961 862 52 2.82872 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 606.664 10.0026 Potri.016G087400.1.v4.1 270 171 975 267.364 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 104.642 2.9312 Potri.012G127500.1.v4.1 977 878 5127 273.818 ==> SRR3207907.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2090 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 507 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 31 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 11 SRR3207907 completed mapping pipeline successfully