Starting /dee2/code/volunteer_pipeline.sh SRR3207908 current disk space = 3050263842816 free memory = 1441575320 SRR3207908 SRAfilesize 8b95a32c406ddf846a906fb7cefa2c15 SRR3207908.sra SRR3207908.sra file validated SRR3207908 is single end SRR3207908 is conventional basespace SRR3207908 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207908_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.71125 34.0 33.0 34.0 31.0 34.0 2 33.16925 34.0 34.0 34.0 31.0 34.0 3 33.41875 34.0 34.0 34.0 31.0 34.0 4 36.647 37.0 37.0 37.0 35.0 37.0 5 36.64075 37.0 37.0 37.0 35.0 37.0 6 36.6645 37.0 37.0 37.0 35.0 37.0 7 36.66675 37.0 37.0 37.0 35.0 37.0 8 36.6605 37.0 37.0 37.0 35.0 37.0 9 38.548 39.0 39.0 39.0 38.0 39.0 10-11 38.588499999999996 39.0 39.0 39.0 38.0 39.0 12-13 38.519625 39.0 39.0 39.0 37.5 39.0 14-15 40.132125 41.0 40.0 41.0 38.0 41.0 16-17 40.025875 41.0 40.0 41.0 38.0 41.0 18-19 39.972625 41.0 40.0 41.0 38.0 41.0 20-21 40.02275 41.0 40.0 41.0 38.0 41.0 22-23 39.932875 41.0 40.0 41.0 38.0 41.0 24-25 39.94975 41.0 40.0 41.0 38.0 41.0 26-27 39.760000000000005 41.0 40.0 41.0 38.0 41.0 28-29 39.633750000000006 41.0 40.0 41.0 37.5 41.0 30-31 39.352125 41.0 39.5 41.0 36.5 41.0 32-33 39.5635 41.0 40.0 41.0 37.5 41.0 34-35 39.631375 41.0 40.0 41.0 37.5 41.0 36-37 39.641000000000005 41.0 40.0 41.0 37.5 41.0 38-39 39.520375 41.0 40.0 41.0 37.0 41.0 40-41 39.511875 41.0 40.0 41.0 37.0 41.0 42-43 39.397125 41.0 40.0 41.0 37.0 41.0 44-45 39.256 41.0 40.0 41.0 36.5 41.0 46-47 39.1995 41.0 39.5 41.0 36.0 41.0 48-49 39.1825 41.0 39.5 41.0 36.0 41.0 50-51 38.85125 40.5 38.5 41.0 35.5 41.0 52-53 38.643125 40.0 39.0 41.0 35.0 41.0 54-55 38.61825 40.0 38.0 41.0 35.0 41.0 56-57 38.304125 40.0 37.5 41.0 34.5 41.0 58-59 38.186 40.0 37.5 41.0 34.0 41.0 60-61 38.034375 40.0 37.0 41.0 34.5 41.0 62-63 37.68475 39.5 36.5 41.0 34.0 41.0 64-65 37.317750000000004 39.0 36.0 41.0 34.0 41.0 66-67 36.960375 39.0 35.0 40.0 33.0 41.0 68-69 36.63575 37.5 35.0 40.0 33.0 41.0 70-71 36.19425 37.0 35.0 39.0 33.0 41.0 72-73 35.78825 37.0 35.0 39.0 32.0 40.5 74-75 35.392875000000004 36.0 35.0 38.5 32.0 39.5 76-77 34.259874999999994 35.0 33.5 37.0 30.5 39.0 78-79 34.639375 35.0 34.5 37.0 32.0 39.0 80-81 34.261250000000004 35.0 34.0 36.5 31.5 37.5 82-83 34.057375 35.0 34.0 36.0 31.5 37.0 84-85 33.738749999999996 35.0 34.0 36.0 31.5 37.0 86-87 33.576750000000004 35.0 34.0 35.0 31.0 36.0 88-89 33.333375000000004 35.0 34.0 35.0 31.0 36.0 90-91 33.1395 35.0 34.0 35.0 31.0 36.0 92-93 32.98025 35.0 34.0 35.0 30.0 36.0 94-95 32.817625 35.0 34.0 35.0 30.0 35.0 96-97 32.68575 35.0 34.0 35.0 30.0 35.0 98-99 32.402125 35.0 33.5 35.0 29.5 35.0 100 32.19375 35.0 33.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 3.0 10 3.0 11 5.0 12 2.0 13 5.0 14 3.0 15 2.0 16 6.0 17 9.0 18 4.0 19 6.0 20 7.0 21 3.0 22 6.0 23 6.0 24 5.0 25 13.0 26 12.0 27 14.0 28 20.0 29 23.0 30 29.0 31 33.0 32 46.0 33 60.0 34 79.0 35 151.0 36 330.0 37 933.0 38 1846.0 39 335.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.855507504451793 14.525566013736963 15.00890358687357 42.61002289493768 2 21.775 21.925 34.599999999999994 21.7 3 22.45 24.45 26.625 26.474999999999998 4 25.174999999999997 30.075000000000003 20.775 23.974999999999998 5 25.3 33.575 22.6 18.525 6 21.325 36.775000000000006 21.45 20.45 7 18.3 19.45 41.5 20.75 8 19.45 24.375 30.2 25.974999999999998 9 19.975 23.974999999999998 31.3 24.75 10-11 22.0875 32.9625 23.6875 21.2625 12-13 21.025 26.775 29.8875 22.3125 14-15 21.2 27.6375 28.525 22.6375 16-17 21.825 28.237499999999997 26.637499999999996 23.3 18-19 22.6875 28.1875 27.075 22.05 20-21 22.6375 28.487499999999997 26.1 22.775000000000002 22-23 21.975 28.8625 26.2625 22.900000000000002 24-25 22.537499999999998 28.1875 26.950000000000003 22.325 26-27 22.9875 27.750000000000004 27.1 22.162499999999998 28-29 21.2375 28.775000000000002 28.1875 21.8 30-31 22.8125 27.462500000000002 27.187499999999996 22.537499999999998 32-33 23.200000000000003 26.787499999999998 27.900000000000002 22.112499999999997 34-35 22.225 28.125 27.212500000000002 22.4375 36-37 21.837500000000002 28.012500000000003 28.237499999999997 21.912499999999998 38-39 22.025 28.0875 27.625 22.2625 40-41 22.8 27.5125 26.937499999999996 22.75 42-43 21.3125 29.075 27.0875 22.525000000000002 44-45 22.4375 28.749999999999996 27.175 21.637500000000003 46-47 22.8375 26.775 28.237499999999997 22.15 48-49 22.675 27.762500000000003 26.55 23.0125 50-51 22.305576394098527 27.60690172543136 27.46936734183546 22.61815453863466 52-53 21.837066700037543 27.831310224002003 28.394443749217867 21.937179326742584 54-55 22.275 27.212500000000002 27.762500000000003 22.75 56-57 22.8125 28.712500000000002 26.325 22.15 58-59 21.65 29.3875 27.025 21.9375 60-61 22.075 27.737499999999997 27.6875 22.5 62-63 21.375 28.025 28.075 22.525000000000002 64-65 21.94024253031629 27.65345668208526 28.416052006500813 21.990248781097637 66-67 22.702837854731843 28.166020752594072 27.00337542192774 22.127765970746342 68-69 22.425 27.1375 27.925 22.5125 70-71 22.375 28.1875 27.6625 21.775 72-73 22.037499999999998 28.6625 27.250000000000004 22.05 74-75 22.4875 28.3125 27.175 22.025 76-77 22.4875 27.8625 27.150000000000002 22.5 78-79 22.7375 27.35 27.5125 22.400000000000002 80-81 22.96537067133392 27.640955119389925 27.990998874859358 21.402675334416802 82-83 22.3125 27.712500000000002 28.025 21.95 84-85 22.665333166645834 26.92836604575572 28.216027003375423 22.190273784223027 86-87 22.077759719964995 27.928491061382672 27.65345668208526 22.340292536567073 88-89 22.545954733024885 28.02300862823559 27.79792422158309 21.633112417156433 90-91 22.28614307153577 28.414207103551774 27.48874437218609 21.810905452726363 92-93 22.208328123046144 28.123046142303366 27.485306990121295 22.1833187445292 94-95 22.490311288911112 27.50343792974122 27.928491061382672 22.077759719964995 96-97 22.405601400350086 27.33183295823956 27.94448612153038 22.31807951987997 98-99 22.015251906488313 28.84110513814227 27.265908238529818 21.877734716839605 100 22.875 27.775 26.525 22.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 1.0 22 0.0 23 1.0 24 1.5 25 2.0 26 2.5 27 4.0 28 5.5 29 5.0 30 11.5 31 19.5 32 25.0 33 33.0 34 43.0 35 58.0 36 87.5 37 108.0 38 126.5 39 168.5 40 193.0 41 201.0 42 228.0 43 264.0 44 277.0 45 275.5 46 267.5 47 255.5 48 232.0 49 206.5 50 173.0 51 137.5 52 116.5 53 99.5 54 76.0 55 50.5 56 45.5 57 39.5 58 29.5 59 22.5 60 19.0 61 16.0 62 15.0 63 10.0 64 6.0 65 7.5 66 6.0 67 3.5 68 2.5 69 3.0 70 4.0 71 2.5 72 1.0 73 2.0 74 1.5 75 0.5 76 0.5 77 1.0 78 1.0 79 1.0 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.725 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.025 52-53 0.11249999999999999 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0125 66-67 0.0125 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0125 82-83 0.0 84-85 0.0125 86-87 0.0125 88-89 0.0375 90-91 0.05 92-93 0.0375 94-95 0.0125 96-97 0.025 98-99 0.0125 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1795709 spots for SRR3207908.sra Written 1795709 spots for SRR3207908.sra Read 1795709 spots for SRR3207908.sra Written 1795709 spots for SRR3207908.sra Read 1795709 spots for SRR3207908.sra Written 1795709 spots for SRR3207908.sra Read 1795709 spots for SRR3207908.sra Written 1795709 spots for SRR3207908.sra Read 1795709 spots for SRR3207908.sra Written 1795709 spots for SRR3207908.sra Read 1795709 spots for SRR3207908.sra Written 1795709 spots for SRR3207908.sra Read 1795709 spots for SRR3207908.sra Written 1795709 spots for SRR3207908.sra Read 1795709 spots for SRR3207908.sra Written 1795709 spots for SRR3207908.sra Read 1795709 spots for SRR3207908.sra Written 1795709 spots for SRR3207908.sra Read 1795709 spots for SRR3207908.sra Written 1795709 spots for SRR3207908.sra Read 1795709 spots for SRR3207908.sra Written 1795709 spots for SRR3207908.sra Read 1795709 spots for SRR3207908.sra Written 1795709 spots for SRR3207908.sra Read 1795709 spots for SRR3207908.sra Written 1795709 spots for SRR3207908.sra Read 1795709 spots for SRR3207908.sra Written 1795709 spots for SRR3207908.sra Read 1795709 spots for SRR3207908.sra Written 1795709 spots for SRR3207908.sra Read 1795709 spots for SRR3207908.sra Written 1795709 spots for SRR3207908.sra Read 1795719 spots for SRR3207908.sra Written 1795719 spots for SRR3207908.sra Read 1795709 spots for SRR3207908.sra Written 1795709 spots for SRR3207908.sra Read 1795709 spots for SRR3207908.sra Written 1795709 spots for SRR3207908.sra Read 1795709 spots for SRR3207908.sra Written 1795709 spots for SRR3207908.sra SRR ids: ['SRR3207908.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q2qa_7cb SRR3207908.sra spots: 35914190 blocks: [[1, 1795709], [1795710, 3591418], [3591419, 5387127], [5387128, 7182836], [7182837, 8978545], [8978546, 10774254], [10774255, 12569963], [12569964, 14365672], [14365673, 16161381], [16161382, 17957090], [17957091, 19752799], [19752800, 21548508], [21548509, 23344217], [23344218, 25139926], [25139927, 26935635], [26935636, 28731344], [28731345, 30527053], [30527054, 32322762], [32322763, 34118471], [34118472, 35914190]] SRR3207908 file size 9335499 SRR3207908 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207908 SRR3207908_1.fastq Input file: SRR3207908_1.fastq trimmed: SRR3207908-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 13:50:28 2025 >> started Tue Feb 11 13:50:47 2025 >> done (18.447s) 35914190 reads processed; of these: 7225 ( 0.02%) short reads filtered out after trimming by size control 27272 ( 0.08%) empty reads filtered out after trimming by size control 35879693 (99.90%) reads available; of these: 3074687 ( 8.57%) trimmed reads available after processing 32805006 (91.43%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1367 0.00% 19 1677 0.00% 20 2086 0.01% 21 2528 0.01% 22 3413 0.01% 23 4226 0.01% 24 5489 0.02% 25 7360 0.02% 26 7272 0.02% 27 7038 0.02% 28 7756 0.02% 29 7788 0.02% 30 7834 0.02% 31 7504 0.02% 32 7630 0.02% 33 8048 0.02% 34 8622 0.02% 35 8789 0.02% 36 9419 0.03% 37 9700 0.03% 38 10372 0.03% 39 10776 0.03% 40 11557 0.03% 41 11815 0.03% 42 12191 0.03% 43 12675 0.04% 44 13530 0.04% 45 13868 0.04% 46 14438 0.04% 47 15034 0.04% 48 15754 0.04% 49 16714 0.05% 50 17441 0.05% 51 18083 0.05% 52 18712 0.05% 53 19934 0.06% 54 21563 0.06% 55 21846 0.06% 56 22402 0.06% 57 22790 0.06% 58 24104 0.07% 59 23597 0.07% 60 23459 0.07% 61 24370 0.07% 62 24854 0.07% 63 23754 0.07% 64 24037 0.07% 65 23992 0.07% 66 24181 0.07% 67 25012 0.07% 68 26238 0.07% 69 25609 0.07% 70 25465 0.07% 71 26788 0.07% 72 27443 0.08% 73 27758 0.08% 74 27672 0.08% 75 27800 0.08% 76 19306 0.05% 77 22690 0.06% 78 27151 0.08% 79 29587 0.08% 80 31726 0.09% 81 34320 0.10% 82 37298 0.10% 83 39689 0.11% 84 41036 0.11% 85 44494 0.12% 86 48933 0.14% 87 54761 0.15% 88 55691 0.16% 89 61438 0.17% 90 67046 0.19% 91 74526 0.21% 92 87353 0.24% 93 98769 0.28% 94 115088 0.32% 95 139079 0.39% 96 173954 0.48% 97 212599 0.59% 98 283398 0.79% 99 371581 1.04% 100 32805006 91.43% 35879693 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=1.91 fanout-score-rank=35 prefix-density=0.07 prefix-fanout=1.9 sequence=CCGGCGATGCGCTCCTGGCCTTAACTGGCCGGGTCGTGCCTCCGGTGCTGTTACTTTGAAGAAATTAGAGTGCTCAAAGCAAGCCTACGCTCTGGATACATTAGCATGGGATAACATCATAGGATTTCGATCCTATTGTGTTGGCCTTCGGGATCGGAGTAATGATTAACAGGGACAGTCGGGGGCATTCGTATTTCATAGTCAGAGGTGAAATTCTTGGATTTATGAAAGACGAACAACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAAGAACGAAAGTTGGGGGCTCGAAGACGATCAGATACCGTCCTAGTCTCAACCATAAACGATGCCGACCAGGGATTGGCGGATGTTGCTTTTAGGACTCCGCCAGCACCTTATGAGAAATCAAAGTTTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACCACCAGGAGTGGAGCCTGCGGCTTAATTTGAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=147.48 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=13.1 sequence=TTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCATCCAGAGCCGCAGCCACAGTTTCCTCCACAGCAAGACATTTTCTGT Started job on | Feb 11 13:51:04 Started mapping on | Feb 11 13:51:04 Finished on | Feb 11 13:51:51 Mapping speed, Million of reads per hour | 2748.23 Number of input reads | 35879693 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 32854140 Uniquely mapped reads % | 91.57% Average mapped length | 98.32 Number of splices: Total | 9095274 Number of splices: Annotated (sjdb) | 8918814 Number of splices: GT/AG | 8949701 Number of splices: GC/AG | 119220 Number of splices: AT/AC | 11294 Number of splices: Non-canonical | 15059 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 1.96 Insertion rate per base | 0.01% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 913884 % of reads mapped to multiple loci | 2.55% Number of reads mapped to too many loci | 1332694 % of reads mapped to too many loci | 3.71% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.16% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2111669 2111669 2111669 N_multimapping 913884 913884 913884 N_noFeature 1281140 17089054 16806329 N_ambiguous 360101 59065 61800 UnstrandedReadsAssigned:31212899 PositiveStrandReadsAssigned:15706021 NegativeStrandReadsAssigned:15986011 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207908 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207908-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,879,693 reads, 33,096,163 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,294 rounds 52401 SRR3207908.ke.tsv 34699 SRR3207908.se.tsv 87100 total ==> SRR3207908.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2935 60.6298 Potri.005G024800.1.v4.1 1035 936 1134 48.0275 Potri.004G059700.1.v4.1 961 862 91 4.18492 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 800.439 11.1571 Potri.016G087400.1.v4.1 270 171 1473.47 341.584 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 273 6.46487 Potri.012G127500.1.v4.1 977 878 6580 297.087 ==> SRR3207908.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2796 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 659 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 46 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 24 SRR3207908 completed mapping pipeline successfully