Starting /dee2/code/volunteer_pipeline.sh SRR3207909 current disk space = 3050294231040 free memory = 1180496940 SRR3207909 SRAfilesize 45e3935296aa996ab3657288a07384e7 SRR3207909.sra SRR3207909.sra file validated SRR3207909 is single end SRR3207909 is conventional basespace SRR3207909 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207909_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.11675 34.0 33.0 34.0 31.0 34.0 2 33.374 34.0 34.0 34.0 31.0 34.0 3 33.4205 34.0 34.0 34.0 31.0 34.0 4 36.68125 37.0 37.0 37.0 35.0 37.0 5 36.6275 37.0 37.0 37.0 35.0 37.0 6 36.56575 37.0 37.0 37.0 35.0 37.0 7 36.57775 37.0 37.0 37.0 35.0 37.0 8 36.609 37.0 37.0 37.0 35.0 37.0 9 38.517 39.0 39.0 39.0 37.0 39.0 10-11 38.470749999999995 39.0 39.0 39.0 37.0 39.0 12-13 38.414625 39.0 39.0 39.0 37.0 39.0 14-15 40.047625 41.0 40.0 41.0 38.0 41.0 16-17 40.002624999999995 41.0 40.0 41.0 38.0 41.0 18-19 39.93025 41.0 40.0 41.0 38.0 41.0 20-21 39.940125 41.0 40.0 41.0 38.0 41.0 22-23 39.842749999999995 41.0 40.0 41.0 38.0 41.0 24-25 39.768625 41.0 40.0 41.0 38.0 41.0 26-27 39.5975 41.0 40.0 41.0 37.5 41.0 28-29 39.362125 41.0 40.0 41.0 37.0 41.0 30-31 39.292375 41.0 39.5 41.0 36.5 41.0 32-33 39.493625 41.0 40.0 41.0 37.0 41.0 34-35 39.524375 41.0 40.0 41.0 37.0 41.0 36-37 39.485 41.0 40.0 41.0 37.0 41.0 38-39 39.35875 41.0 40.0 41.0 37.0 41.0 40-41 39.302625 41.0 40.0 41.0 36.5 41.0 42-43 39.275125 41.0 39.5 41.0 36.0 41.0 44-45 39.198499999999996 41.0 39.0 41.0 36.0 41.0 46-47 39.164874999999995 41.0 39.5 41.0 36.0 41.0 48-49 39.11725 41.0 39.0 41.0 36.0 41.0 50-51 38.945875 41.0 39.0 41.0 35.0 41.0 52-53 38.635000000000005 40.0 39.0 41.0 35.0 41.0 54-55 38.6175 40.0 38.0 41.0 35.0 41.0 56-57 38.464875 40.0 38.0 41.0 34.5 41.0 58-59 38.223749999999995 40.0 37.5 41.0 34.5 41.0 60-61 37.604749999999996 40.0 37.0 41.0 33.5 41.0 62-63 37.323 39.0 36.5 41.0 33.0 41.0 64-65 37.218875 39.0 36.0 41.0 33.0 41.0 66-67 36.951125000000005 39.0 35.5 40.0 33.0 41.0 68-69 36.652125 38.0 35.0 40.0 33.0 41.0 70-71 36.1225 37.0 35.0 39.5 32.0 41.0 72-73 35.599625 37.0 35.0 39.0 31.0 41.0 74-75 35.154624999999996 36.0 35.0 39.0 31.0 40.0 76-77 33.923125 35.0 33.5 37.0 29.5 39.0 78-79 34.331500000000005 35.0 34.0 37.0 30.5 39.0 80-81 33.933375 35.0 34.0 37.0 30.0 38.5 82-83 33.814750000000004 35.0 34.0 36.0 30.5 37.0 84-85 33.4465 35.0 34.0 36.0 30.0 37.0 86-87 33.320625 35.0 34.0 35.5 30.0 36.5 88-89 33.154250000000005 35.0 34.0 35.0 30.5 36.0 90-91 32.9065 35.0 34.0 35.0 30.0 36.0 92-93 32.598749999999995 35.0 34.0 35.0 29.0 36.0 94-95 32.5455 35.0 34.0 35.0 29.0 35.5 96-97 32.14325 35.0 33.5 35.0 28.5 35.0 98-99 32.026624999999996 35.0 33.0 35.0 29.0 35.0 100 31.6935 35.0 33.0 35.0 27.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 3.0 9 1.0 10 4.0 11 1.0 12 3.0 13 4.0 14 7.0 15 1.0 16 3.0 17 10.0 18 8.0 19 7.0 20 6.0 21 5.0 22 12.0 23 7.0 24 8.0 25 10.0 26 19.0 27 22.0 28 25.0 29 22.0 30 37.0 31 42.0 32 51.0 33 68.0 34 100.0 35 151.0 36 315.0 37 882.0 38 1732.0 39 432.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.12296110414053 17.41530740276035 14.705144291091592 41.75658720200753 2 20.175 24.85 36.075 18.9 3 21.046046046046047 27.25225225225225 26.851851851851855 24.84984984984985 4 24.9 33.1 19.900000000000002 22.1 5 22.625 36.85 22.175 18.35 6 19.3 36.475 25.1 19.125 7 17.349999999999998 19.025 42.05 21.575 8 18.925 23.400000000000002 30.55 27.125 9 20.8 22.35 32.225 24.625 10-11 23.2875 32.725 23.1 20.8875 12-13 20.075000000000003 26.525 30.4375 22.9625 14-15 21.1875 27.325 28.849999999999998 22.6375 16-17 21.45 29.25 27.025 22.275 18-19 21.4 28.475 27.787499999999998 22.3375 20-21 21.55 28.5625 27.125 22.7625 22-23 21.9 28.65 28.4 21.05 24-25 21.212500000000002 29.212500000000002 27.537499999999998 22.037499999999998 26-27 21.1875 28.749999999999996 27.487499999999997 22.575 28-29 21.625 28.5875 27.750000000000004 22.037499999999998 30-31 21.337500000000002 28.225 28.1 22.3375 32-33 21.0375 28.4 28.499999999999996 22.0625 34-35 21.5375 28.249999999999996 27.900000000000002 22.3125 36-37 21.987499999999997 28.462500000000002 27.8125 21.7375 38-39 21.212500000000002 27.962500000000002 28.599999999999998 22.225 40-41 22.1 28.7 27.737499999999997 21.462500000000002 42-43 20.7125 29.15 28.1 22.037499999999998 44-45 22.625 27.2625 28.0625 22.05 46-47 21.925 28.5625 28.0875 21.425 48-49 21.9 27.175 28.050000000000004 22.875 50-51 22.276422764227643 27.842401500938085 28.105065666041273 21.776110068792995 52-53 22.71703777833375 28.921691268451337 27.270452839629723 21.09081811358519 54-55 21.4125 27.9125 28.449999999999996 22.225 56-57 21.587500000000002 28.4125 27.775 22.225 58-59 21.837500000000002 28.025 28.212500000000002 21.925 60-61 21.1375 28.725 28.15 21.987499999999997 62-63 22.0125 28.6375 27.762500000000003 21.587500000000002 64-65 22.8125 27.6 27.05 22.537499999999998 66-67 21.275 28.499999999999996 28.0875 22.1375 68-69 21.587500000000002 28.375 27.275 22.7625 70-71 21.3625 28.9375 28.0875 21.6125 72-73 21.7 28.487499999999997 28.1125 21.7 74-75 21.475 27.9375 28.5875 22.0 76-77 20.599999999999998 29.862499999999997 28.075 21.462500000000002 78-79 21.725 28.8625 28.4375 20.974999999999998 80-81 21.5625 29.2 27.625 21.6125 82-83 22.2625 29.049999999999997 28.1625 20.525 84-85 21.825 28.1875 27.750000000000004 22.237499999999997 86-87 22.1875 28.799999999999997 27.437499999999996 21.575 88-89 21.823411705852926 28.114057028514257 28.289144572286144 21.773386693346673 90-91 21.513445903689806 28.717948717948715 28.392745465916196 21.37585991244528 92-93 22.033262473427534 28.810804051519316 27.84794297861698 21.30799049643616 94-95 21.3625 28.6375 27.962500000000002 22.037499999999998 96-97 21.65270658832354 28.22852856607076 28.453556694586823 21.665208151018877 98-99 22.473736868434216 28.864432216108053 27.60130065032516 21.060530265132567 100 22.461230615307652 26.96348174087044 29.239619809904955 21.335667833916958 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 1.0 20 2.0 21 1.5 22 0.5 23 2.0 24 4.0 25 7.5 26 10.0 27 7.5 28 11.5 29 17.5 30 20.0 31 27.0 32 39.5 33 57.0 34 73.0 35 90.0 36 118.0 37 127.0 38 144.5 39 170.0 40 180.0 41 208.0 42 241.0 43 270.5 44 268.5 45 270.5 46 261.0 47 220.0 48 204.5 49 185.0 50 141.0 51 117.5 52 100.0 53 76.0 54 56.5 55 43.0 56 42.5 57 35.0 58 25.5 59 16.5 60 14.5 61 15.5 62 10.5 63 7.5 64 11.5 65 11.5 66 9.5 67 7.5 68 4.5 69 3.0 70 1.0 71 1.0 72 2.0 73 1.5 74 0.5 75 0.5 76 0.5 77 0.5 78 0.5 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.0 3 0.1 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0625 52-53 0.075 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.05 90-91 0.0625 92-93 0.0375 94-95 0.0 96-97 0.0125 98-99 0.05 100 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84966173891256 99.625 2 0.12528188423953898 0.25 3 0.0 0.0 4 0.0 0.0 5 0.025056376847907794 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGC 5 0.125 TruSeq Adapter, Index 9 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88 0.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 847963 spots for SRR3207909.sra Written 847963 spots for SRR3207909.sra Read 847963 spots for SRR3207909.sra Written 847963 spots for SRR3207909.sra Read 847963 spots for SRR3207909.sra Written 847963 spots for SRR3207909.sra Read 847963 spots for SRR3207909.sra Written 847963 spots for SRR3207909.sra Read 847963 spots for SRR3207909.sra Written 847963 spots for SRR3207909.sra Read 847963 spots for SRR3207909.sra Written 847963 spots for SRR3207909.sra Read 847963 spots for SRR3207909.sra Written 847963 spots for SRR3207909.sra Read 847963 spots for SRR3207909.sra Written 847963 spots for SRR3207909.sra Read 847963 spots for SRR3207909.sra Written 847963 spots for SRR3207909.sra Read 847963 spots for SRR3207909.sra Written 847963 spots for SRR3207909.sra Read 847963 spots for SRR3207909.sra Written 847963 spots for SRR3207909.sra Read 847963 spots for SRR3207909.sra Written 847963 spots for SRR3207909.sra Read 847963 spots for SRR3207909.sra Written 847963 spots for SRR3207909.sra Read 847963 spots for SRR3207909.sra Written 847963 spots for SRR3207909.sra Read 847979 spots for SRR3207909.sra Written 847979 spots for SRR3207909.sra Read 847963 spots for SRR3207909.sra Written 847963 spots for SRR3207909.sra Read 847963 spots for SRR3207909.sra Written 847963 spots for SRR3207909.sra Read 847963 spots for SRR3207909.sra Written 847963 spots for SRR3207909.sra Read 847963 spots for SRR3207909.sra Written 847963 spots for SRR3207909.sra Read 847963 spots for SRR3207909.sra Written 847963 spots for SRR3207909.sra SRR ids: ['SRR3207909.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_21e6xn59 SRR3207909.sra spots: 16959276 blocks: [[1, 847963], [847964, 1695926], [1695927, 2543889], [2543890, 3391852], [3391853, 4239815], [4239816, 5087778], [5087779, 5935741], [5935742, 6783704], [6783705, 7631667], [7631668, 8479630], [8479631, 9327593], [9327594, 10175556], [10175557, 11023519], [11023520, 11871482], [11871483, 12719445], [12719446, 13567408], [13567409, 14415371], [14415372, 15263334], [15263335, 16111297], [16111298, 16959276]] SRR3207909 file size 4402641 SRR3207909 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207909 SRR3207909_1.fastq Input file: SRR3207909_1.fastq trimmed: SRR3207909-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 13:49:02 2025 >> started Tue Feb 11 13:49:16 2025 >> done (13.631s) 16959276 reads processed; of these: 3516 ( 0.02%) short reads filtered out after trimming by size control 33555 ( 0.20%) empty reads filtered out after trimming by size control 16922205 (99.78%) reads available; of these: 1442293 ( 8.52%) trimmed reads available after processing 15479912 (91.48%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 563 0.00% 19 683 0.00% 20 925 0.01% 21 1188 0.01% 22 1585 0.01% 23 2152 0.01% 24 2729 0.02% 25 3569 0.02% 26 3553 0.02% 27 3488 0.02% 28 3400 0.02% 29 3703 0.02% 30 3576 0.02% 31 3570 0.02% 32 3435 0.02% 33 3733 0.02% 34 3858 0.02% 35 4028 0.02% 36 4474 0.03% 37 4480 0.03% 38 4915 0.03% 39 5142 0.03% 40 5203 0.03% 41 5453 0.03% 42 5753 0.03% 43 6089 0.04% 44 6468 0.04% 45 6633 0.04% 46 7081 0.04% 47 7203 0.04% 48 7543 0.04% 49 7997 0.05% 50 8525 0.05% 51 8768 0.05% 52 9078 0.05% 53 9637 0.06% 54 10073 0.06% 55 10810 0.06% 56 10965 0.06% 57 11295 0.07% 58 11839 0.07% 59 11920 0.07% 60 11824 0.07% 61 11835 0.07% 62 11712 0.07% 63 12081 0.07% 64 12047 0.07% 65 12378 0.07% 66 12323 0.07% 67 12618 0.07% 68 13092 0.08% 69 13019 0.08% 70 13337 0.08% 71 13815 0.08% 72 14000 0.08% 73 14285 0.08% 74 14493 0.09% 75 14682 0.09% 76 10488 0.06% 77 11930 0.07% 78 13622 0.08% 79 15038 0.09% 80 16018 0.09% 81 17593 0.10% 82 19615 0.12% 83 21197 0.13% 84 21423 0.13% 85 23025 0.14% 86 24539 0.15% 87 26405 0.16% 88 28813 0.17% 89 31063 0.18% 90 35345 0.21% 91 39326 0.23% 92 43570 0.26% 93 49875 0.29% 94 57893 0.34% 95 70270 0.42% 96 88268 0.52% 97 100770 0.60% 98 117266 0.69% 99 114318 0.68% 100 15479912 91.48% 16922205 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=15.55 fanout-score-rank=12 prefix-density=0.11 prefix-fanout=15.6 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGCCGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=20 fanout-score=292.49 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=27.2 sequence=TTCTTCTTCTTC Started job on | Feb 11 13:49:37 Started mapping on | Feb 11 13:49:37 Finished on | Feb 11 13:50:08 Mapping speed, Million of reads per hour | 1965.16 Number of input reads | 16922205 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 14992333 Uniquely mapped reads % | 88.60% Average mapped length | 98.15 Number of splices: Total | 4046741 Number of splices: Annotated (sjdb) | 3960196 Number of splices: GT/AG | 3979212 Number of splices: GC/AG | 53649 Number of splices: AT/AC | 4559 Number of splices: Non-canonical | 9321 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 2.00 Insertion rate per base | 0.02% Insertion average length | 1.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 446910 % of reads mapped to multiple loci | 2.64% Number of reads mapped to too many loci | 224077 % of reads mapped to too many loci | 1.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.43% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1482962 1482962 1482962 N_multimapping 446910 446910 446910 N_noFeature 762763 7837227 7819887 N_ambiguous 154518 28058 28747 UnstrandedReadsAssigned:14075052 PositiveStrandReadsAssigned:7127048 NegativeStrandReadsAssigned:7143699 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207909 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207909-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,922,205 reads, 14,627,551 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,174 rounds 52401 SRR3207909.ke.tsv 34699 SRR3207909.se.tsv 87100 total ==> SRR3207909.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 754 36.7495 Potri.005G024800.1.v4.1 1035 936 869 86.8359 Potri.004G059700.1.v4.1 961 862 29 3.14663 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 377.452 12.4133 Potri.016G087400.1.v4.1 270 171 578 316.146 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 58 3.24062 Potri.012G127500.1.v4.1 977 878 4509 480.332 ==> SRR3207909.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1286 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 220 Potri.001G212900.v4.1 10 Potri.001G182400.v4.1 26 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3207909 completed mapping pipeline successfully