Starting /dee2/code/volunteer_pipeline.sh SRR3207910 current disk space = 3050094161920 free memory = 1580120864 SRR3207910 SRAfilesize c86ab103607e82fd82e87ef9ebdce9fa SRR3207910.sra SRR3207910.sra file validated SRR3207910 is single end SRR3207910 is conventional basespace SRR3207910 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207910_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0815 34.0 33.0 34.0 31.0 34.0 2 33.3345 34.0 34.0 34.0 31.0 34.0 3 33.399 34.0 34.0 34.0 31.0 34.0 4 36.6285 37.0 37.0 37.0 35.0 37.0 5 36.57925 37.0 37.0 37.0 35.0 37.0 6 36.4675 37.0 37.0 37.0 35.0 37.0 7 36.53075 37.0 37.0 37.0 35.0 37.0 8 36.59125 37.0 37.0 37.0 35.0 37.0 9 38.493 39.0 39.0 39.0 37.0 39.0 10-11 38.477625 39.0 39.0 39.0 37.0 39.0 12-13 38.436499999999995 39.0 39.0 39.0 37.0 39.0 14-15 39.998875 41.0 40.0 41.0 38.0 41.0 16-17 39.954625 41.0 40.0 41.0 38.0 41.0 18-19 39.834875 41.0 40.0 41.0 38.0 41.0 20-21 39.844375 41.0 40.0 41.0 38.0 41.0 22-23 39.77925 41.0 40.0 41.0 38.0 41.0 24-25 39.716499999999996 41.0 40.0 41.0 38.0 41.0 26-27 39.559375 41.0 40.0 41.0 37.0 41.0 28-29 39.320125000000004 41.0 39.5 41.0 36.5 41.0 30-31 39.24275 41.0 39.0 41.0 36.5 41.0 32-33 39.423874999999995 41.0 40.0 41.0 37.0 41.0 34-35 39.445125000000004 41.0 40.0 41.0 37.0 41.0 36-37 39.42675 41.0 40.0 41.0 37.0 41.0 38-39 39.0725 41.0 39.5 41.0 35.5 41.0 40-41 39.126374999999996 41.0 40.0 41.0 36.0 41.0 42-43 39.10325 41.0 39.5 41.0 36.0 41.0 44-45 38.980374999999995 41.0 39.0 41.0 35.0 41.0 46-47 38.921875 41.0 39.0 41.0 35.0 41.0 48-49 38.925625 41.0 39.0 41.0 35.0 41.0 50-51 38.797625 41.0 39.0 41.0 35.0 41.0 52-53 38.46775 40.5 39.0 41.0 35.0 41.0 54-55 38.336375 40.0 38.0 41.0 34.0 41.0 56-57 38.179249999999996 40.0 38.0 41.0 34.0 41.0 58-59 38.000375 40.0 37.5 41.0 34.0 41.0 60-61 37.444375 40.0 37.0 41.0 32.5 41.0 62-63 37.087125 39.5 36.0 41.0 32.0 41.0 64-65 36.94625 39.0 36.0 41.0 32.5 41.0 66-67 36.74575 39.0 35.5 40.0 32.0 41.0 68-69 36.418125 38.5 35.0 40.0 32.0 41.0 70-71 36.015625 37.0 35.0 39.5 32.0 41.0 72-73 35.519000000000005 37.0 35.0 39.0 31.0 41.0 74-75 34.974125 36.0 35.0 39.0 30.5 40.0 76-77 33.711 35.0 33.5 37.0 28.5 39.0 78-79 34.145250000000004 35.0 34.0 37.0 30.5 39.0 80-81 33.7385 35.0 34.0 37.0 29.5 38.5 82-83 33.59025 35.0 34.0 36.0 30.0 37.0 84-85 33.252375 35.0 34.0 36.0 30.0 37.0 86-87 33.069125 35.0 34.0 35.5 30.0 36.5 88-89 32.900499999999994 35.0 34.0 35.0 30.0 36.0 90-91 32.69975 35.0 34.0 35.0 29.5 36.0 92-93 32.517875000000004 35.0 34.0 35.0 29.0 36.0 94-95 32.334625 35.0 34.0 35.0 29.0 35.5 96-97 31.944250000000004 35.0 33.5 35.0 27.5 35.0 98-99 31.709249999999997 35.0 33.0 35.0 27.0 35.0 100 31.4435 35.0 33.0 35.0 26.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 2.0 6 0.0 7 1.0 8 1.0 9 2.0 10 3.0 11 7.0 12 3.0 13 4.0 14 1.0 15 8.0 16 5.0 17 12.0 18 14.0 19 9.0 20 9.0 21 11.0 22 8.0 23 7.0 24 19.0 25 12.0 26 16.0 27 23.0 28 18.0 29 31.0 30 34.0 31 35.0 32 51.0 33 66.0 34 103.0 35 148.0 36 337.0 37 829.0 38 1766.0 39 403.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.451807228915662 15.737951807228914 13.152610441767068 45.657630522088354 2 18.575 23.9 39.85 17.675 3 21.065799349512133 28.171128346259692 27.120340255191394 23.642732049036777 4 22.875 33.775 21.275 22.075 5 22.8 36.6 22.275 18.325 6 16.85 38.125 25.224999999999998 19.8 7 16.45 19.125 42.85 21.575 8 18.0 23.65 31.85 26.5 9 20.0 24.4 32.574999999999996 23.025000000000002 10-11 22.7125 33.2375 22.4625 21.587500000000002 12-13 19.825 27.3625 29.75 23.0625 14-15 21.325 28.975 28.1625 21.5375 16-17 21.875 27.650000000000002 28.5625 21.912499999999998 18-19 21.2875 29.125 27.224999999999998 22.3625 20-21 22.225 29.125 27.0125 21.637500000000003 22-23 21.099999999999998 29.062500000000004 27.6375 22.2 24-25 21.25 28.3375 28.012500000000003 22.400000000000002 26-27 21.099999999999998 27.950000000000003 28.3125 22.6375 28-29 21.224999999999998 29.1125 27.537499999999998 22.125 30-31 21.375 29.2375 27.237499999999997 22.15 32-33 21.45 28.625 28.237499999999997 21.6875 34-35 21.8 28.325 27.437499999999996 22.4375 36-37 21.099999999999998 27.9125 28.375 22.6125 38-39 21.65 29.049999999999997 27.800000000000004 21.5 40-41 21.475 29.3875 27.675 21.462500000000002 42-43 20.275000000000002 28.4375 28.962500000000002 22.325 44-45 22.05 27.975 27.750000000000004 22.225 46-47 22.15 28.499999999999996 27.1125 22.237499999999997 48-49 21.099999999999998 28.449999999999996 28.449999999999996 22.0 50-51 22.05679969973727 27.974477667959462 27.398974102339547 22.569748529963718 52-53 21.917636750531983 28.013518588058577 28.364000500688448 21.70484416072099 54-55 21.275 26.987499999999997 29.25 22.4875 56-57 21.2375 29.037499999999998 27.625 22.1 58-59 21.45 28.15 29.525000000000002 20.875 60-61 22.45 27.800000000000004 28.375 21.375 62-63 21.2375 28.462500000000002 28.15 22.15 64-65 21.4375 28.875 27.750000000000004 21.9375 66-67 21.3 28.762500000000003 28.525 21.4125 68-69 21.4875 28.875 27.925 21.712500000000002 70-71 22.3625 28.525 27.8375 21.275 72-73 21.4 28.212500000000002 28.6375 21.75 74-75 21.975 27.900000000000002 28.775000000000002 21.349999999999998 76-77 22.1 28.15 28.125 21.625 78-79 21.475 27.8875 28.3375 22.3 80-81 21.0375 27.525 28.8625 22.575 82-83 22.525000000000002 28.3875 26.7125 22.375 84-85 22.0125 28.675 27.537499999999998 21.775 86-87 21.9777472184023 28.253531691461433 28.066008251031377 21.702712839104887 88-89 21.758159309741153 28.448168063023633 28.160560210078778 21.633112417156433 90-91 22.423711855927962 28.05152576288144 27.55127563781891 21.973486743371687 92-93 22.483431286732525 28.335625859697387 28.060522696011002 21.12042015755908 94-95 22.112499999999997 27.6375 28.725 21.525 96-97 22.215276909613703 28.528566070758842 27.94099262407801 21.315164395549445 98-99 21.783168688258097 29.423533825184446 27.19769913717644 21.595598349381017 100 22.28614307153577 27.763881940970485 29.289644822411205 20.66033016508254 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 0.5 18 0.5 19 1.0 20 1.0 21 1.0 22 2.0 23 3.5 24 5.5 25 7.5 26 7.0 27 7.0 28 15.5 29 23.0 30 26.5 31 34.5 32 43.0 33 57.5 34 72.0 35 80.5 36 99.5 37 120.5 38 144.5 39 186.0 40 217.0 41 224.0 42 229.0 43 249.5 44 266.5 45 258.0 46 240.5 47 224.0 48 191.5 49 167.0 50 156.0 51 129.5 52 99.0 53 83.0 54 69.5 55 48.5 56 38.5 57 34.5 58 25.0 59 18.5 60 13.5 61 12.0 62 12.5 63 8.5 64 6.5 65 6.0 66 6.0 67 5.5 68 4.0 69 3.0 70 3.5 71 2.0 72 0.5 73 1.0 74 1.0 75 0.5 76 0.0 77 0.5 78 1.0 79 0.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.0 3 0.075 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.08750000000000001 52-53 0.13749999999999998 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0125 88-89 0.0375 90-91 0.05 92-93 0.0375 94-95 0.0 96-97 0.0125 98-99 0.0375 100 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0125 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88 0.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1251266 spots for SRR3207910.sra Written 1251266 spots for SRR3207910.sra Read 1251266 spots for SRR3207910.sra Written 1251266 spots for SRR3207910.sra Read 1251266 spots for SRR3207910.sra Written 1251266 spots for SRR3207910.sra Read 1251266 spots for SRR3207910.sra Written 1251266 spots for SRR3207910.sra Read 1251266 spots for SRR3207910.sra Written 1251266 spots for SRR3207910.sra Read 1251266 spots for SRR3207910.sra Written 1251266 spots for SRR3207910.sra Read 1251266 spots for SRR3207910.sra Written 1251266 spots for SRR3207910.sra Read 1251266 spots for SRR3207910.sra Written 1251266 spots for SRR3207910.sra Read 1251266 spots for SRR3207910.sra Written 1251266 spots for SRR3207910.sra Read 1251266 spots for SRR3207910.sra Written 1251266 spots for SRR3207910.sra Read 1251266 spots for SRR3207910.sra Written 1251266 spots for SRR3207910.sra Read 1251266 spots for SRR3207910.sra Written 1251266 spots for SRR3207910.sra Read 1251266 spots for SRR3207910.sra Written 1251266 spots for SRR3207910.sra Read 1251266 spots for SRR3207910.sra Written 1251266 spots for SRR3207910.sra Read 1251266 spots for SRR3207910.sra Written 1251266 spots for SRR3207910.sra Read 1251268 spots for SRR3207910.sra Written 1251268 spots for SRR3207910.sra Read 1251266 spots for SRR3207910.sra Written 1251266 spots for SRR3207910.sra Read 1251266 spots for SRR3207910.sra Written 1251266 spots for SRR3207910.sra Read 1251266 spots for SRR3207910.sra Written 1251266 spots for SRR3207910.sra Read 1251266 spots for SRR3207910.sra Written 1251266 spots for SRR3207910.sra SRR ids: ['SRR3207910.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o1mttai1 SRR3207910.sra spots: 25025322 blocks: [[1, 1251266], [1251267, 2502532], [2502533, 3753798], [3753799, 5005064], [5005065, 6256330], [6256331, 7507596], [7507597, 8758862], [8758863, 10010128], [10010129, 11261394], [11261395, 12512660], [12512661, 13763926], [13763927, 15015192], [15015193, 16266458], [16266459, 17517724], [17517725, 18768990], [18768991, 20020256], [20020257, 21271522], [21271523, 22522788], [22522789, 23774054], [23774055, 25025322]] SRR3207910 file size 6501755 SRR3207910 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207910 SRR3207910_1.fastq Input file: SRR3207910_1.fastq trimmed: SRR3207910-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 14:34:58 2025 >> started Tue Feb 11 14:35:10 2025 >> done (12.125s) 25025322 reads processed; of these: 6261 ( 0.03%) short reads filtered out after trimming by size control 24156 ( 0.10%) empty reads filtered out after trimming by size control 24994905 (99.88%) reads available; of these: 2075449 ( 8.30%) trimmed reads available after processing 22919456 (91.70%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1100 0.00% 19 1255 0.01% 20 1553 0.01% 21 2020 0.01% 22 2639 0.01% 23 3399 0.01% 24 4417 0.02% 25 5775 0.02% 26 5752 0.02% 27 5427 0.02% 28 5579 0.02% 29 5473 0.02% 30 5483 0.02% 31 5483 0.02% 32 5492 0.02% 33 5705 0.02% 34 6141 0.02% 35 6365 0.03% 36 6820 0.03% 37 6953 0.03% 38 7559 0.03% 39 7772 0.03% 40 8072 0.03% 41 8374 0.03% 42 8910 0.04% 43 9281 0.04% 44 9944 0.04% 45 10084 0.04% 46 10420 0.04% 47 10951 0.04% 48 11378 0.05% 49 12189 0.05% 50 12861 0.05% 51 13361 0.05% 52 13482 0.05% 53 14229 0.06% 54 14870 0.06% 55 15585 0.06% 56 16206 0.06% 57 16451 0.07% 58 17305 0.07% 59 17510 0.07% 60 17286 0.07% 61 17245 0.07% 62 17386 0.07% 63 17752 0.07% 64 17524 0.07% 65 17844 0.07% 66 18230 0.07% 67 18295 0.07% 68 19110 0.08% 69 18548 0.07% 70 19008 0.08% 71 19628 0.08% 72 19805 0.08% 73 20576 0.08% 74 20709 0.08% 75 20699 0.08% 76 14875 0.06% 77 17001 0.07% 78 19382 0.08% 79 21595 0.09% 80 23230 0.09% 81 25519 0.10% 82 27788 0.11% 83 30164 0.12% 84 30520 0.12% 85 34052 0.14% 86 35323 0.14% 87 37755 0.15% 88 40513 0.16% 89 44175 0.18% 90 49203 0.20% 91 56007 0.22% 92 62225 0.25% 93 70741 0.28% 94 82363 0.33% 95 99752 0.40% 96 124675 0.50% 97 141654 0.57% 98 165558 0.66% 99 162109 0.65% 100 22919456 91.70% 24994905 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=13.05 fanout-score-rank=20 prefix-density=0.09 prefix-fanout=13.0 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCTTATCTCGTATGC criterion=fanout-score sequence-density=0.04 sequence-density-rank=13 fanout-score=306.39 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=28.1 sequence=TTCTTCTTCTTC Started job on | Feb 11 14:35:30 Started mapping on | Feb 11 14:35:31 Finished on | Feb 11 14:36:08 Mapping speed, Million of reads per hour | 2431.94 Number of input reads | 24994905 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 22484141 Uniquely mapped reads % | 89.95% Average mapped length | 98.13 Number of splices: Total | 6227370 Number of splices: Annotated (sjdb) | 6090822 Number of splices: GT/AG | 6123821 Number of splices: GC/AG | 82668 Number of splices: AT/AC | 7416 Number of splices: Non-canonical | 13465 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 1.95 Insertion rate per base | 0.02% Insertion average length | 1.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 628200 % of reads mapped to multiple loci | 2.51% Number of reads mapped to too many loci | 283801 % of reads mapped to too many loci | 1.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.39% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1882564 1882564 1882564 N_multimapping 628200 628200 628200 N_noFeature 1172200 11796242 11712260 N_ambiguous 233720 42877 43388 UnstrandedReadsAssigned:21078221 PositiveStrandReadsAssigned:10645022 NegativeStrandReadsAssigned:10728493 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207910 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207910-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,994,905 reads, 21,839,140 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,098 rounds 52401 SRR3207910.ke.tsv 34699 SRR3207910.se.tsv 87100 total ==> SRR3207910.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1093 36.1522 Potri.005G024800.1.v4.1 1035 936 983 66.6603 Potri.004G059700.1.v4.1 961 862 65 4.78625 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 582.738 13.0057 Potri.016G087400.1.v4.1 270 171 845.961 314.01 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 91 3.45045 Potri.012G127500.1.v4.1 977 878 3774 272.833 ==> SRR3207910.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1604 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 346 Potri.001G212900.v4.1 22 Potri.001G182400.v4.1 51 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR3207910 completed mapping pipeline successfully