Starting /dee2/code/volunteer_pipeline.sh SRR3207911 current disk space = 3049907642368 free memory = 1579834108 SRR3207911 SRAfilesize 9b329267486a03fdd192aebe6f322ea4 SRR3207911.sra SRR3207911.sra file validated SRR3207911 is single end SRR3207911 is conventional basespace SRR3207911 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207911_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1255 34.0 33.0 34.0 31.0 34.0 2 33.37025 34.0 34.0 34.0 31.0 34.0 3 33.45475 34.0 34.0 34.0 31.0 34.0 4 36.66275 37.0 37.0 37.0 35.0 37.0 5 36.642 37.0 37.0 37.0 35.0 37.0 6 36.56775 37.0 37.0 37.0 35.0 37.0 7 36.6095 37.0 37.0 37.0 35.0 37.0 8 36.60725 37.0 37.0 37.0 35.0 37.0 9 38.49525 39.0 39.0 39.0 37.0 39.0 10-11 38.4845 39.0 39.0 39.0 37.0 39.0 12-13 38.435874999999996 39.0 39.0 39.0 37.0 39.0 14-15 40.058125000000004 41.0 40.0 41.0 38.0 41.0 16-17 40.032875000000004 41.0 40.0 41.0 38.0 41.0 18-19 39.872875 41.0 40.0 41.0 38.0 41.0 20-21 39.91 41.0 40.0 41.0 38.0 41.0 22-23 39.883250000000004 41.0 40.0 41.0 38.0 41.0 24-25 39.7755 41.0 40.0 41.0 38.0 41.0 26-27 39.589 41.0 40.0 41.0 37.5 41.0 28-29 39.388625000000005 41.0 40.0 41.0 37.0 41.0 30-31 39.30925 41.0 39.0 41.0 36.0 41.0 32-33 39.50475 41.0 40.0 41.0 37.0 41.0 34-35 39.535250000000005 41.0 40.0 41.0 37.0 41.0 36-37 39.48524999999999 41.0 40.0 41.0 37.0 41.0 38-39 39.389375 41.0 40.0 41.0 37.0 41.0 40-41 39.328375 41.0 40.0 41.0 37.0 41.0 42-43 39.28725 41.0 39.5 41.0 36.5 41.0 44-45 39.176625 41.0 39.0 41.0 36.0 41.0 46-47 39.100125000000006 41.0 39.0 41.0 35.0 41.0 48-49 39.108625 41.0 39.0 41.0 35.5 41.0 50-51 38.9965 40.5 39.0 41.0 35.5 41.0 52-53 38.749875 40.0 39.0 41.0 35.0 41.0 54-55 38.606375 40.0 38.0 41.0 35.0 41.0 56-57 38.437250000000006 40.0 38.0 41.0 34.5 41.0 58-59 38.13525 40.0 37.5 41.0 34.0 41.0 60-61 37.570750000000004 39.5 36.5 41.0 33.0 41.0 62-63 37.257625000000004 39.0 36.0 41.0 33.0 41.0 64-65 37.0925 39.0 36.0 41.0 32.5 41.0 66-67 36.923375 38.5 35.5 40.0 33.0 41.0 68-69 36.599999999999994 38.0 35.0 40.0 32.5 41.0 70-71 36.171125 37.0 35.0 39.5 32.0 41.0 72-73 35.64325 36.5 35.0 39.0 32.0 40.5 74-75 35.081875 36.0 35.0 38.5 31.0 40.0 76-77 33.863875 35.0 33.5 37.0 29.5 39.0 78-79 34.301125 35.0 34.0 37.0 30.5 39.0 80-81 33.944375 35.0 34.0 36.5 30.5 38.5 82-83 33.850625 35.0 34.0 36.0 31.0 37.0 84-85 33.481625 35.0 34.0 36.0 30.0 37.0 86-87 33.284125 35.0 34.0 35.0 30.0 36.5 88-89 33.059749999999994 35.0 34.0 35.0 30.0 36.0 90-91 32.910875000000004 35.0 34.0 35.0 30.0 36.0 92-93 32.715375 35.0 34.0 35.0 29.5 36.0 94-95 32.484750000000005 35.0 34.0 35.0 29.0 35.5 96-97 32.08575 35.0 33.0 35.0 29.0 35.0 98-99 31.924374999999998 35.0 33.0 35.0 29.0 35.0 100 31.5195 35.0 33.0 35.0 27.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 1.0 7 0.0 8 0.0 9 3.0 10 1.0 11 0.0 12 2.0 13 5.0 14 5.0 15 3.0 16 6.0 17 4.0 18 8.0 19 9.0 20 4.0 21 6.0 22 7.0 23 11.0 24 14.0 25 15.0 26 10.0 27 22.0 28 22.0 29 24.0 30 32.0 31 44.0 32 58.0 33 68.0 34 112.0 35 154.0 36 343.0 37 905.0 38 1733.0 39 368.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.345390605375535 15.749811605124343 12.861090178347148 46.04370761115298 2 18.675 24.8 38.525 18.0 3 21.156735102653982 27.265898848272407 27.391086629944915 24.18627941912869 4 23.65 34.075 20.349999999999998 21.925 5 23.925 36.425000000000004 21.875 17.775 6 18.3 36.725 26.05 18.925 7 17.2 18.925 44.125 19.75 8 18.6 22.925 31.900000000000002 26.575 9 19.85 23.125 33.050000000000004 23.974999999999998 10-11 23.375 32.8625 22.787499999999998 20.974999999999998 12-13 20.962500000000002 27.125 28.875 23.0375 14-15 21.775 27.6875 28.249999999999996 22.287499999999998 16-17 22.8875 28.037499999999998 26.5625 22.5125 18-19 21.7375 28.025 27.500000000000004 22.7375 20-21 22.5625 28.000000000000004 27.025 22.412499999999998 22-23 21.15 28.9125 27.875 22.0625 24-25 21.6875 28.849999999999998 27.625 21.837500000000002 26-27 21.85 28.65 27.900000000000002 21.6 28-29 21.275 28.3125 28.175 22.237499999999997 30-31 21.3875 29.2 27.1375 22.275 32-33 22.275 29.1625 27.450000000000003 21.1125 34-35 22.275 28.925 27.925 20.875 36-37 21.675 28.225 28.037499999999998 22.0625 38-39 22.575 28.325 26.937499999999996 22.162499999999998 40-41 22.650000000000002 28.5875 26.9125 21.85 42-43 21.6625 27.962500000000002 27.825 22.55 44-45 21.75 29.075 27.287499999999998 21.8875 46-47 22.6875 28.237499999999997 27.212500000000002 21.8625 48-49 21.55 28.4375 28.212500000000002 21.8 50-51 22.166624968726545 28.696522391793845 27.483112334250688 21.653740305228922 52-53 21.531339922432128 28.049543350431627 28.037032403352935 22.38208432378331 54-55 22.025 28.425 27.8375 21.712500000000002 56-57 22.7 27.3 28.000000000000004 22.0 58-59 22.1375 27.950000000000003 28.262500000000003 21.65 60-61 22.3 27.775 27.525 22.400000000000002 62-63 22.1875 28.050000000000004 27.6125 22.15 64-65 21.125 28.8875 28.000000000000004 21.987499999999997 66-67 21.975 28.15 27.250000000000004 22.625 68-69 21.95 29.3875 27.375 21.2875 70-71 22.8 28.512500000000003 27.3625 21.325 72-73 21.3125 27.825 28.487499999999997 22.375 74-75 22.225 27.375 28.4125 21.987499999999997 76-77 21.9375 27.325 28.537499999999998 22.2 78-79 21.775 27.712500000000002 28.825 21.6875 80-81 22.35 28.0625 28.1375 21.45 82-83 22.9375 28.0625 28.000000000000004 21.0 84-85 22.075 28.7 27.5125 21.712500000000002 86-87 22.4625 28.075 28.0875 21.375 88-89 21.620607727897962 29.185944729273476 27.997999249718646 21.195448293109916 90-91 21.660830415207606 28.35167583791896 27.838919459729865 22.14857428714357 92-93 21.48037009252313 27.981995498874717 28.719679919979995 21.817954488622153 94-95 21.375 28.525 28.15 21.95 96-97 21.727715964495562 27.928491061382672 28.22852856607076 22.115264408051004 98-99 21.517879469867466 28.469617404351087 27.981995498874717 22.030507626906726 100 21.48037009252313 29.207301825456366 26.906726681670417 22.405601400350086 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 1.5 23 2.0 24 3.0 25 3.0 26 5.0 27 8.5 28 12.0 29 16.5 30 22.5 31 27.5 32 38.0 33 54.0 34 70.5 35 89.0 36 97.5 37 115.0 38 143.5 39 165.5 40 193.0 41 234.5 42 250.0 43 253.5 44 261.0 45 249.5 46 239.5 47 228.0 48 213.0 49 180.5 50 151.0 51 142.0 52 111.0 53 72.0 54 58.0 55 53.5 56 44.0 57 37.5 58 28.5 59 18.0 60 15.5 61 15.5 62 14.5 63 11.0 64 6.5 65 8.0 66 7.5 67 3.5 68 4.0 69 2.5 70 2.5 71 3.0 72 2.5 73 2.0 74 1.0 75 0.5 76 0.0 77 0.5 78 1.0 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.475 2 0.0 3 0.15 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.075 52-53 0.08750000000000001 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0375 90-91 0.05 92-93 0.025 94-95 0.0 96-97 0.0125 98-99 0.025 100 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82460536206464 99.6 2 0.15033826108744675 0.3 3 0.0 0.0 4 0.025056376847907794 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.037500000000000006 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.0625 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88 0.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 778408 spots for SRR3207911.sra Written 778408 spots for SRR3207911.sra Read 778408 spots for SRR3207911.sra Written 778408 spots for SRR3207911.sra Read 778408 spots for SRR3207911.sra Written 778408 spots for SRR3207911.sra Read 778408 spots for SRR3207911.sra Written 778408 spots for SRR3207911.sra Read 778408 spots for SRR3207911.sra Written 778408 spots for SRR3207911.sra Read 778408 spots for SRR3207911.sra Written 778408 spots for SRR3207911.sra Read 778408 spots for SRR3207911.sra Written 778408 spots for SRR3207911.sra Read 778408 spots for SRR3207911.sra Written 778408 spots for SRR3207911.sra Read 778408 spots for SRR3207911.sra Written 778408 spots for SRR3207911.sra Read 778408 spots for SRR3207911.sra Written 778408 spots for SRR3207911.sra Read 778408 spots for SRR3207911.sra Written 778408 spots for SRR3207911.sra Read 778408 spots for SRR3207911.sra Written 778408 spots for SRR3207911.sra Read 778422 spots for SRR3207911.sra Written 778422 spots for SRR3207911.sra Read 778408 spots for SRR3207911.sra Written 778408 spots for SRR3207911.sra Read 778408 spots for SRR3207911.sra Written 778408 spots for SRR3207911.sra Read 778408 spots for SRR3207911.sra Written 778408 spots for SRR3207911.sra Read 778408 spots for SRR3207911.sra Written 778408 spots for SRR3207911.sra Read 778408 spots for SRR3207911.sra Written 778408 spots for SRR3207911.sra Read 778408 spots for SRR3207911.sra Written 778408 spots for SRR3207911.sra Read 778408 spots for SRR3207911.sra Written 778408 spots for SRR3207911.sra SRR ids: ['SRR3207911.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ijw1nf7q SRR3207911.sra spots: 15568174 blocks: [[1, 778408], [778409, 1556816], [1556817, 2335224], [2335225, 3113632], [3113633, 3892040], [3892041, 4670448], [4670449, 5448856], [5448857, 6227264], [6227265, 7005672], [7005673, 7784080], [7784081, 8562488], [8562489, 9340896], [9340897, 10119304], [10119305, 10897712], [10897713, 11676120], [11676121, 12454528], [12454529, 13232936], [13232937, 14011344], [14011345, 14789752], [14789753, 15568174]] SRR3207911 file size 4040618 SRR3207911 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207911 SRR3207911_1.fastq Input file: SRR3207911_1.fastq trimmed: SRR3207911-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 14:57:55 2025 >> started Tue Feb 11 14:58:02 2025 >> done (7.661s) 15568174 reads processed; of these: 2707 ( 0.02%) short reads filtered out after trimming by size control 28515 ( 0.18%) empty reads filtered out after trimming by size control 15536952 (99.80%) reads available; of these: 1357418 ( 8.74%) trimmed reads available after processing 14179534 (91.26%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 490 0.00% 19 565 0.00% 20 778 0.01% 21 1000 0.01% 22 1359 0.01% 23 1907 0.01% 24 2421 0.02% 25 3097 0.02% 26 3243 0.02% 27 3147 0.02% 28 3067 0.02% 29 3118 0.02% 30 3209 0.02% 31 3109 0.02% 32 3154 0.02% 33 3142 0.02% 34 3522 0.02% 35 3652 0.02% 36 3939 0.03% 37 4016 0.03% 38 4304 0.03% 39 4570 0.03% 40 4669 0.03% 41 5001 0.03% 42 5373 0.03% 43 5622 0.04% 44 5832 0.04% 45 5966 0.04% 46 6273 0.04% 47 6648 0.04% 48 6914 0.04% 49 7272 0.05% 50 7677 0.05% 51 7907 0.05% 52 8173 0.05% 53 8695 0.06% 54 9603 0.06% 55 9753 0.06% 56 10109 0.07% 57 10570 0.07% 58 10775 0.07% 59 10759 0.07% 60 10898 0.07% 61 11030 0.07% 62 11048 0.07% 63 11418 0.07% 64 11035 0.07% 65 11345 0.07% 66 11474 0.07% 67 11741 0.08% 68 12083 0.08% 69 12025 0.08% 70 12237 0.08% 71 12743 0.08% 72 13054 0.08% 73 13272 0.09% 74 13574 0.09% 75 13531 0.09% 76 9834 0.06% 77 10900 0.07% 78 12665 0.08% 79 14361 0.09% 80 15239 0.10% 81 16552 0.11% 82 18407 0.12% 83 19825 0.13% 84 20344 0.13% 85 22308 0.14% 86 23572 0.15% 87 24992 0.16% 88 27046 0.17% 89 29621 0.19% 90 33279 0.21% 91 37937 0.24% 92 41785 0.27% 93 47699 0.31% 94 55522 0.36% 95 67620 0.44% 96 84742 0.55% 97 96246 0.62% 98 110594 0.71% 99 109420 0.70% 100 14179534 91.26% 15536952 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=17 prefix-density=0.17 prefix-fanout=2.3 sequence=TCTCATCACTCACAAGCAAGTCGTGGCGTAGGAATTGAATTAATGAACTTGGTGGCAGCAAGGAAGGCGTTGTAGGAGGCTAA criterion=fanout-score sequence-density=0.09 sequence-density-rank=30 fanout-score=8.36 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=8.4 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCTACATCTCGTATGC Started job on | Feb 11 14:58:21 Started mapping on | Feb 11 14:58:22 Finished on | Feb 11 14:58:44 Mapping speed, Million of reads per hour | 2542.41 Number of input reads | 15536952 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 14019177 Uniquely mapped reads % | 90.23% Average mapped length | 98.20 Number of splices: Total | 3953981 Number of splices: Annotated (sjdb) | 3867142 Number of splices: GT/AG | 3888379 Number of splices: GC/AG | 52032 Number of splices: AT/AC | 4521 Number of splices: Non-canonical | 9049 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 2.00 Insertion rate per base | 0.01% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 466720 % of reads mapped to multiple loci | 3.00% Number of reads mapped to too many loci | 419113 % of reads mapped to too many loci | 2.70% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.06% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1051055 1051055 1051055 N_multimapping 466720 466720 466720 N_noFeature 739147 7335911 7340563 N_ambiguous 138965 28481 28905 UnstrandedReadsAssigned:13141065 PositiveStrandReadsAssigned:6654785 NegativeStrandReadsAssigned:6649709 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207911 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207911-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,536,952 reads, 13,864,161 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,015 rounds 52401 SRR3207911.ke.tsv 34699 SRR3207911.se.tsv 87100 total ==> SRR3207911.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 848 41.8836 Potri.005G024800.1.v4.1 1035 936 828 83.845 Potri.004G059700.1.v4.1 961 862 22 2.41901 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 356.753 11.8894 Potri.016G087400.1.v4.1 270 171 510 282.681 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 85 4.81267 Potri.012G127500.1.v4.1 977 878 4265 460.413 ==> SRR3207911.se.tsv <== Potri.001G166300.v4.1 2 Potri.001G448400.v4.1 586 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 181 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR3207911 completed mapping pipeline successfully