Starting /dee2/code/volunteer_pipeline.sh SRR3207912 current disk space = 3049837449216 free memory = 1579123456 SRR3207912 SRAfilesize 491cd9804d79ae7ab47dd2072f5ac189 SRR3207912.sra SRR3207912.sra file validated SRR3207912 is single end SRR3207912 is conventional basespace SRR3207912 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207912_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0365 34.0 33.0 34.0 31.0 34.0 2 33.1945 34.0 34.0 34.0 31.0 34.0 3 33.33725 34.0 34.0 34.0 31.0 34.0 4 36.619 37.0 37.0 37.0 35.0 37.0 5 36.54025 37.0 37.0 37.0 35.0 37.0 6 36.55275 37.0 37.0 37.0 35.0 37.0 7 36.56175 37.0 37.0 37.0 35.0 37.0 8 36.5135 37.0 37.0 37.0 35.0 37.0 9 38.42575 39.0 39.0 39.0 37.0 39.0 10-11 38.213875 39.0 39.0 39.0 37.0 39.0 12-13 38.334 39.0 39.0 39.0 37.0 39.0 14-15 39.942125000000004 41.0 40.0 41.0 38.0 41.0 16-17 39.925625 41.0 40.0 41.0 38.0 41.0 18-19 39.917 41.0 40.0 41.0 38.0 41.0 20-21 39.869375 41.0 40.0 41.0 38.0 41.0 22-23 39.830124999999995 41.0 40.0 41.0 38.0 41.0 24-25 39.734125000000006 41.0 40.0 41.0 37.5 41.0 26-27 39.759125 41.0 40.0 41.0 37.5 41.0 28-29 39.608000000000004 41.0 40.0 41.0 37.0 41.0 30-31 39.1925 41.0 39.0 41.0 36.5 41.0 32-33 39.473375000000004 41.0 40.0 41.0 37.0 41.0 34-35 39.542125 41.0 40.0 41.0 37.0 41.0 36-37 39.547125 41.0 40.0 41.0 37.0 41.0 38-39 39.40625 41.0 40.0 41.0 37.0 41.0 40-41 39.308875 41.0 40.0 41.0 37.0 41.0 42-43 39.133125 40.5 39.0 41.0 35.5 41.0 44-45 38.9945 40.0 39.0 41.0 35.0 41.0 46-47 38.862125 40.5 39.0 41.0 35.5 41.0 48-49 38.840125 40.0 39.0 41.0 35.0 41.0 50-51 38.634625 40.0 38.5 41.0 35.0 41.0 52-53 38.39375 40.0 38.0 41.0 34.5 41.0 54-55 38.425375 40.0 38.0 41.0 35.0 41.0 56-57 38.33725 40.0 38.0 41.0 34.5 41.0 58-59 37.934875000000005 40.0 37.5 41.0 33.5 41.0 60-61 37.76475 40.0 37.0 41.0 34.0 41.0 62-63 37.552 39.0 36.0 41.0 34.0 41.0 64-65 37.264624999999995 39.0 36.0 40.5 33.5 41.0 66-67 36.976124999999996 38.5 35.0 40.0 33.0 41.0 68-69 36.596375 37.5 35.0 40.0 33.0 41.0 70-71 35.984625 37.0 35.0 39.0 32.0 41.0 72-73 35.6785 36.5 35.0 39.0 32.0 40.0 74-75 34.9595 36.0 34.5 38.5 30.5 39.5 76-77 33.9825 35.0 33.5 37.0 29.5 39.0 78-79 34.332750000000004 35.0 34.0 37.0 31.0 39.0 80-81 34.1155 35.0 34.0 36.5 31.0 37.5 82-83 33.752625 35.0 34.0 36.0 30.5 37.0 84-85 33.515874999999994 35.0 34.0 36.0 30.5 37.0 86-87 33.101124999999996 35.0 34.0 35.0 30.0 36.0 88-89 33.057874999999996 35.0 34.0 35.0 30.0 36.0 90-91 32.753375 35.0 34.0 35.0 29.5 36.0 92-93 32.519125 35.0 33.5 35.0 29.0 35.5 94-95 32.386624999999995 35.0 33.0 35.0 29.0 35.0 96-97 32.266625 35.0 33.0 35.0 29.0 35.0 98-99 32.102000000000004 35.0 33.0 35.0 29.0 35.0 100 31.864 35.0 33.0 35.0 28.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 0.0 10 4.0 11 3.0 12 4.0 13 5.0 14 1.0 15 4.0 16 6.0 17 9.0 18 8.0 19 5.0 20 6.0 21 7.0 22 4.0 23 5.0 24 12.0 25 8.0 26 13.0 27 18.0 28 32.0 29 30.0 30 27.0 31 39.0 32 60.0 33 62.0 34 115.0 35 180.0 36 363.0 37 925.0 38 1779.0 39 264.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.062248995983936 14.683734939759036 13.855421686746988 43.398594377510044 2 20.5 23.05 34.875 21.575 3 22.25 24.75 26.200000000000003 26.8 4 25.900000000000002 30.675 18.375 25.05 5 25.900000000000002 33.800000000000004 21.525 18.775 6 19.325 38.324999999999996 23.5 18.85 7 17.45 20.474999999999998 40.75 21.325 8 19.925 24.05 30.775000000000002 25.25 9 20.95 23.075000000000003 31.45 24.525 10-11 22.625 33.2375 22.8875 21.25 12-13 21.925 26.85 28.475 22.75 14-15 21.775 27.8625 27.55 22.8125 16-17 21.3125 28.512500000000003 26.924999999999997 23.25 18-19 23.25 26.8125 27.3875 22.55 20-21 22.275 28.299999999999997 27.287499999999998 22.1375 22-23 22.725 28.15 27.125 22.0 24-25 22.0625 28.425 27.6125 21.9 26-27 22.537499999999998 28.287499999999998 26.7125 22.4625 28-29 21.95 27.700000000000003 27.700000000000003 22.650000000000002 30-31 22.2 28.0875 28.012500000000003 21.7 32-33 22.3875 27.925 27.5875 22.1 34-35 22.412499999999998 28.462500000000002 27.05 22.075 36-37 22.425 28.287499999999998 26.6125 22.675 38-39 22.45 28.175 27.750000000000004 21.625 40-41 22.4625 27.875 27.675 21.987499999999997 42-43 22.112499999999997 27.6875 28.3875 21.8125 44-45 21.712500000000002 28.125 27.250000000000004 22.912499999999998 46-47 22.237499999999997 27.737499999999997 26.987499999999997 23.0375 48-49 22.5 27.450000000000003 27.5625 22.4875 50-51 22.886443221610804 27.613806903451728 27.40120060030015 22.098549274637318 52-53 23.42714196372733 28.61788617886179 25.941213258286428 22.013758599124454 54-55 21.6 28.575 27.2625 22.5625 56-57 22.675 28.1 26.375 22.85 58-59 22.6375 27.825 27.650000000000002 21.8875 60-61 23.1 27.575 26.987499999999997 22.3375 62-63 22.025 27.6375 28.275 22.0625 64-65 21.337500000000002 27.125 28.299999999999997 23.2375 66-67 21.525 27.8625 27.762500000000003 22.85 68-69 22.237499999999997 27.5875 27.400000000000002 22.775000000000002 70-71 21.9375 27.925 27.1125 23.025000000000002 72-73 22.925 27.150000000000002 27.750000000000004 22.175 74-75 22.1 27.5625 28.3125 22.025 76-77 22.325 27.500000000000004 27.737499999999997 22.4375 78-79 21.6625 27.625 27.700000000000003 23.0125 80-81 21.2875 27.950000000000003 27.437499999999996 23.325000000000003 82-83 22.8375 27.925 26.900000000000002 22.3375 84-85 22.275 27.6125 27.55 22.5625 86-87 21.61520190023753 28.20352544068008 27.91598949868734 22.26528316039505 88-89 21.951219512195124 28.530331457160724 27.066916823014388 22.451532207629768 90-91 22.554415811858895 28.171128346259692 27.695771828871653 21.57868401300976 92-93 21.93322495935976 27.897961735650867 28.273102413405027 21.895710891584343 94-95 22.0875 27.500000000000004 27.700000000000003 22.7125 96-97 22.380595148787197 28.394598649662417 26.994248562140534 22.230557639409852 98-99 22.19582343378767 28.76078529448543 27.58534450418907 21.458046767537827 100 22.925 27.875 27.175 22.025 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 0.5 25 1.0 26 2.0 27 2.5 28 5.0 29 9.5 30 8.5 31 13.0 32 22.0 33 35.5 34 45.5 35 63.0 36 87.0 37 94.5 38 120.5 39 156.0 40 184.5 41 217.0 42 238.0 43 262.5 44 275.0 45 276.5 46 273.5 47 267.5 48 247.5 49 196.0 50 166.0 51 141.0 52 116.0 53 99.0 54 80.5 55 63.0 56 47.5 57 36.0 58 23.0 59 17.0 60 15.5 61 13.5 62 13.5 63 9.5 64 6.5 65 7.0 66 5.5 67 5.5 68 5.0 69 4.0 70 3.0 71 3.0 72 2.0 73 2.0 74 2.5 75 2.0 76 1.5 77 0.5 78 1.0 79 0.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.05 52-53 0.0625 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0125 88-89 0.0625 90-91 0.075 92-93 0.0375 94-95 0.0 96-97 0.025 98-99 0.0375 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88 0.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1112356 spots for SRR3207912.sra Written 1112356 spots for SRR3207912.sra Read 1112356 spots for SRR3207912.sra Written 1112356 spots for SRR3207912.sra Read 1112356 spots for SRR3207912.sra Written 1112356 spots for SRR3207912.sra Read 1112356 spots for SRR3207912.sra Written 1112356 spots for SRR3207912.sra Read 1112356 spots for SRR3207912.sra Written 1112356 spots for SRR3207912.sra Read 1112356 spots for SRR3207912.sra Written 1112356 spots for SRR3207912.sra Read 1112356 spots for SRR3207912.sra Written 1112356 spots for SRR3207912.sra Read 1112356 spots for SRR3207912.sra Written 1112356 spots for SRR3207912.sra Read 1112356 spots for SRR3207912.sra Written 1112356 spots for SRR3207912.sra Read 1112356 spots for SRR3207912.sra Written 1112356 spots for SRR3207912.sra Read 1112363 spots for SRR3207912.sra Written 1112363 spots for SRR3207912.sra Read 1112356 spots for SRR3207912.sra Written 1112356 spots for SRR3207912.sra Read 1112356 spots for SRR3207912.sra Written 1112356 spots for SRR3207912.sra Read 1112356 spots for SRR3207912.sra Written 1112356 spots for SRR3207912.sra Read 1112356 spots for SRR3207912.sra Written 1112356 spots for SRR3207912.sra Read 1112356 spots for SRR3207912.sra Written 1112356 spots for SRR3207912.sra Read 1112356 spots for SRR3207912.sra Written 1112356 spots for SRR3207912.sra Read 1112356 spots for SRR3207912.sra Written 1112356 spots for SRR3207912.sra Read 1112356 spots for SRR3207912.sra Written 1112356 spots for SRR3207912.sra Read 1112356 spots for SRR3207912.sra Written 1112356 spots for SRR3207912.sra SRR ids: ['SRR3207912.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3bmjcma1 SRR3207912.sra spots: 22247127 blocks: [[1, 1112356], [1112357, 2224712], [2224713, 3337068], [3337069, 4449424], [4449425, 5561780], [5561781, 6674136], [6674137, 7786492], [7786493, 8898848], [8898849, 10011204], [10011205, 11123560], [11123561, 12235916], [12235917, 13348272], [13348273, 14460628], [14460629, 15572984], [15572985, 16685340], [16685341, 17797696], [17797697, 18910052], [18910053, 20022408], [20022409, 21134764], [21134765, 22247127]] SRR3207912 file size 5778746 SRR3207912 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207912 SRR3207912_1.fastq Input file: SRR3207912_1.fastq trimmed: SRR3207912-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 15:04:46 2025 >> started Tue Feb 11 15:05:03 2025 >> done (16.194s) 22247127 reads processed; of these: 2814 ( 0.01%) short reads filtered out after trimming by size control 13068 ( 0.06%) empty reads filtered out after trimming by size control 22231245 (99.93%) reads available; of these: 2029913 ( 9.13%) trimmed reads available after processing 20201332 (90.87%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 547 0.00% 19 673 0.00% 20 898 0.00% 21 1226 0.01% 22 1647 0.01% 23 2278 0.01% 24 3000 0.01% 25 4016 0.02% 26 4411 0.02% 27 4570 0.02% 28 4774 0.02% 29 5174 0.02% 30 4935 0.02% 31 4618 0.02% 32 4199 0.02% 33 4444 0.02% 34 4455 0.02% 35 4917 0.02% 36 5072 0.02% 37 5298 0.02% 38 5703 0.03% 39 6016 0.03% 40 6293 0.03% 41 6533 0.03% 42 6943 0.03% 43 7313 0.03% 44 7840 0.04% 45 8143 0.04% 46 8470 0.04% 47 9035 0.04% 48 9378 0.04% 49 9976 0.04% 50 10856 0.05% 51 10693 0.05% 52 11292 0.05% 53 11881 0.05% 54 12899 0.06% 55 13442 0.06% 56 14221 0.06% 57 14589 0.07% 58 15350 0.07% 59 15439 0.07% 60 15497 0.07% 61 15711 0.07% 62 16231 0.07% 63 15977 0.07% 64 16394 0.07% 65 16528 0.07% 66 16553 0.07% 67 17205 0.08% 68 17997 0.08% 69 18099 0.08% 70 17752 0.08% 71 18449 0.08% 72 18924 0.09% 73 19541 0.09% 74 19653 0.09% 75 19298 0.09% 76 14460 0.07% 77 16562 0.07% 78 18819 0.08% 79 21159 0.10% 80 22942 0.10% 81 24579 0.11% 82 26614 0.12% 83 29715 0.13% 84 31106 0.14% 85 34638 0.16% 86 36784 0.17% 87 39753 0.18% 88 42593 0.19% 89 44845 0.20% 90 50603 0.23% 91 57437 0.26% 92 66508 0.30% 93 76299 0.34% 94 98684 0.44% 95 123280 0.55% 96 120282 0.54% 97 139330 0.63% 98 157535 0.71% 99 162120 0.73% 100 20201332 90.87% 22231245 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=2.60 fanout-score-rank=32 prefix-density=0.03 prefix-fanout=2.6 sequence=TCGTATGCCGTCTTCTGCTTGAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=12 fanout-score=225.67 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=26.1 sequence=AAGAAGAAGAAA Started job on | Feb 11 15:05:32 Started mapping on | Feb 11 15:05:32 Finished on | Feb 11 15:06:00 Mapping speed, Million of reads per hour | 2858.30 Number of input reads | 22231245 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 20625534 Uniquely mapped reads % | 92.78% Average mapped length | 98.25 Number of splices: Total | 5853105 Number of splices: Annotated (sjdb) | 5726765 Number of splices: GT/AG | 5757109 Number of splices: GC/AG | 79922 Number of splices: AT/AC | 6784 Number of splices: Non-canonical | 9290 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 1.99 Insertion rate per base | 0.01% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 551169 % of reads mapped to multiple loci | 2.48% Number of reads mapped to too many loci | 583651 % of reads mapped to too many loci | 2.63% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.11% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1054542 1054542 1054542 N_multimapping 551169 551169 551169 N_noFeature 914884 10631822 10770172 N_ambiguous 219801 41055 40676 UnstrandedReadsAssigned:19490849 PositiveStrandReadsAssigned:9952657 NegativeStrandReadsAssigned:9814686 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207912 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207912-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,231,245 reads, 20,409,950 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,245 rounds 52401 SRR3207912.ke.tsv 34699 SRR3207912.se.tsv 87100 total ==> SRR3207912.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1388 48.5588 Potri.005G024800.1.v4.1 1035 936 783.041 56.1645 Potri.004G059700.1.v4.1 961 862 9 0.700953 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 468.761 11.0656 Potri.016G087400.1.v4.1 270 171 728 285.818 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 152 6.09596 Potri.012G127500.1.v4.1 977 878 3405 260.361 ==> SRR3207912.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1494 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 361 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 26 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 22 SRR3207912 completed mapping pipeline successfully