Starting /dee2/code/volunteer_pipeline.sh SRR3207913 current disk space = 3050166284288 free memory = 1481747276 SRR3207913 SRAfilesize 8e26c8d5162e793a73e8d83d7a4f95aa SRR3207913.sra SRR3207913.sra file validated SRR3207913 is single end SRR3207913 is conventional basespace SRR3207913 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207913_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.10875 34.0 33.0 34.0 31.0 34.0 2 33.222 34.0 34.0 34.0 31.0 34.0 3 33.377 34.0 34.0 34.0 31.0 34.0 4 36.63725 37.0 37.0 37.0 35.0 37.0 5 36.59575 37.0 37.0 37.0 35.0 37.0 6 36.58425 37.0 37.0 37.0 35.0 37.0 7 36.56075 37.0 37.0 37.0 35.0 37.0 8 36.533 37.0 37.0 37.0 35.0 37.0 9 38.46 39.0 39.0 39.0 37.0 39.0 10-11 38.2625 39.0 39.0 39.0 37.0 39.0 12-13 38.35925 39.0 39.0 39.0 37.0 39.0 14-15 39.986125 41.0 40.0 41.0 38.0 41.0 16-17 39.981875 41.0 40.0 41.0 38.0 41.0 18-19 40.007374999999996 41.0 40.0 41.0 38.0 41.0 20-21 39.932249999999996 41.0 40.0 41.0 38.0 41.0 22-23 39.829875 41.0 40.0 41.0 38.0 41.0 24-25 39.808875 41.0 40.0 41.0 38.0 41.0 26-27 39.815749999999994 41.0 40.0 41.0 38.0 41.0 28-29 39.70225 41.0 40.0 41.0 38.0 41.0 30-31 39.305499999999995 41.0 40.0 41.0 36.5 41.0 32-33 39.576499999999996 41.0 40.0 41.0 37.5 41.0 34-35 39.614875 41.0 40.0 41.0 37.5 41.0 36-37 39.667500000000004 41.0 40.0 41.0 38.0 41.0 38-39 39.499125 41.0 40.0 41.0 37.0 41.0 40-41 39.394375 41.0 40.0 41.0 37.0 41.0 42-43 39.346374999999995 40.5 39.5 41.0 37.0 41.0 44-45 39.205749999999995 40.5 39.0 41.0 36.0 41.0 46-47 39.157875000000004 41.0 39.0 41.0 36.0 41.0 48-49 39.1725 41.0 39.0 41.0 36.0 41.0 50-51 38.935 40.5 39.0 41.0 35.5 41.0 52-53 38.606375 40.0 39.0 41.0 35.0 41.0 54-55 38.67175 40.0 38.0 41.0 35.0 41.0 56-57 38.570625 40.0 38.0 41.0 35.0 41.0 58-59 38.145125 40.0 37.5 41.0 34.5 41.0 60-61 38.01475 40.0 37.0 41.0 34.0 41.0 62-63 37.842625 39.5 37.0 41.0 34.0 41.0 64-65 37.561125 39.0 36.0 41.0 34.0 41.0 66-67 37.252 39.0 36.0 40.0 34.0 41.0 68-69 36.835375 38.0 35.0 40.0 33.0 41.0 70-71 36.17675 37.0 35.0 39.0 32.0 41.0 72-73 35.86325 37.0 35.0 39.0 32.0 40.5 74-75 35.129125 36.0 34.5 38.5 31.0 39.5 76-77 34.26 35.0 33.5 37.0 30.5 39.0 78-79 34.650875 35.0 34.0 37.0 31.5 39.0 80-81 34.307125 35.0 34.0 36.5 31.0 38.5 82-83 34.011875 35.0 34.0 36.0 31.0 37.0 84-85 33.7505 35.0 34.0 36.0 31.0 37.0 86-87 33.334999999999994 35.0 34.0 35.0 30.5 36.0 88-89 33.2625 35.0 34.0 35.0 30.5 36.0 90-91 33.041125 35.0 34.0 35.0 30.0 36.0 92-93 32.708625 35.0 34.0 35.0 29.0 35.5 94-95 32.551 35.0 34.0 35.0 29.0 35.0 96-97 32.49925 35.0 34.0 35.0 29.0 35.0 98-99 32.32025 35.0 33.5 35.0 29.0 35.0 100 32.2095 35.0 33.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 2.0 11 1.0 12 2.0 13 4.0 14 4.0 15 1.0 16 1.0 17 2.0 18 7.0 19 4.0 20 8.0 21 5.0 22 4.0 23 7.0 24 13.0 25 9.0 26 17.0 27 15.0 28 14.0 29 26.0 30 33.0 31 43.0 32 56.0 33 68.0 34 97.0 35 154.0 36 338.0 37 947.0 38 1812.0 39 301.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.600902481825017 14.239157683629983 14.289295562797694 43.8706442717473 2 20.0 21.224999999999998 37.45 21.325 3 22.825 24.975 26.875 25.324999999999996 4 24.15 30.875000000000004 19.7 25.275 5 25.324999999999996 33.275 22.2 19.2 6 19.775000000000002 37.974999999999994 22.95 19.3 7 17.849999999999998 20.325 41.175 20.65 8 19.275000000000002 23.925 31.2 25.6 9 20.65 23.075000000000003 31.8 24.474999999999998 10-11 21.9375 34.025 22.725 21.3125 12-13 20.200000000000003 27.987499999999997 29.45 22.3625 14-15 21.45 28.812500000000004 27.762500000000003 21.975 16-17 22.275 27.6 26.950000000000003 23.175 18-19 22.8 27.8875 27.3625 21.95 20-21 21.4375 27.950000000000003 27.400000000000002 23.2125 22-23 21.85 28.075 27.5875 22.4875 24-25 21.575 28.15 27.975 22.3 26-27 21.6875 27.8875 27.6 22.825 28-29 21.462500000000002 28.462500000000002 27.900000000000002 22.175 30-31 21.5625 28.3625 27.675 22.400000000000002 32-33 21.9625 28.4 27.224999999999998 22.412499999999998 34-35 22.15 27.8125 27.3 22.7375 36-37 21.099999999999998 28.125 28.299999999999997 22.475 38-39 22.575 27.975 26.8 22.650000000000002 40-41 22.15 28.237499999999997 27.825 21.7875 42-43 22.175 28.15 27.975 21.7 44-45 21.2625 27.712500000000002 28.575 22.45 46-47 22.4875 27.287499999999998 28.199999999999996 22.025 48-49 21.912499999999998 27.8125 27.700000000000003 22.575 50-51 22.14017521902378 27.42177722152691 28.060075093867333 22.377972465581976 52-53 22.618600575791714 28.226311177869572 27.300037551633494 21.85505069470522 54-55 22.075 28.262500000000003 27.675 21.987499999999997 56-57 22.650000000000002 27.875 27.125 22.35 58-59 22.412499999999998 27.85 27.6625 22.075 60-61 21.275 28.3625 28.249999999999996 22.112499999999997 62-63 21.825 28.237499999999997 27.987499999999997 21.95 64-65 21.775 28.287499999999998 28.1125 21.825 66-67 22.35 27.525 27.712500000000002 22.412499999999998 68-69 22.400000000000002 28.3125 27.4125 21.875 70-71 22.05 28.425 27.875 21.65 72-73 22.0625 27.712500000000002 28.0875 22.1375 74-75 21.625 27.175 29.225 21.975 76-77 22.475 26.974999999999998 27.962500000000002 22.5875 78-79 21.7375 27.150000000000002 28.3375 22.775000000000002 80-81 22.3125 28.025 28.0875 21.575 82-83 21.912499999999998 28.15 28.025 21.912499999999998 84-85 22.2 28.4125 27.8625 21.525 86-87 21.8304576144036 28.507126781695426 27.406851712928233 22.255563890972745 88-89 22.98836190714554 28.24427480916031 27.44337379551996 21.323989488174195 90-91 21.867567905870573 28.151207910877456 27.888346476405058 22.092877706846913 92-93 21.6260162601626 28.317698561601002 27.504690431519702 22.551594746716695 94-95 22.693173293323333 27.68192048012003 28.28207051762941 21.342835708927232 96-97 21.03551775887944 27.851425712856425 28.85192596298149 22.26113056528264 98-99 22.366775081310983 27.658243682762073 28.521391043282463 21.453590192644484 100 21.625 28.749999999999996 27.55 22.075 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.5 24 1.5 25 3.0 26 5.0 27 6.0 28 5.5 29 9.0 30 14.0 31 17.0 32 27.0 33 35.0 34 43.5 35 64.0 36 83.0 37 100.0 38 125.0 39 164.0 40 188.5 41 220.5 42 269.0 43 290.5 44 292.5 45 273.0 46 254.5 47 254.0 48 233.0 49 190.5 50 171.0 51 153.0 52 116.5 53 93.0 54 74.5 55 57.5 56 38.0 57 21.0 58 19.0 59 17.0 60 15.0 61 12.0 62 8.0 63 6.0 64 5.0 65 4.5 66 3.5 67 3.0 68 3.0 69 1.5 70 1.0 71 1.0 72 1.0 73 2.0 74 1.0 75 0.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.125 52-53 0.13749999999999998 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.025 88-89 0.11249999999999999 90-91 0.13749999999999998 92-93 0.0625 94-95 0.025 96-97 0.05 98-99 0.075 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88 0.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 586654 spots for SRR3207913.sra Written 586654 spots for SRR3207913.sra Read 586654 spots for SRR3207913.sra Written 586654 spots for SRR3207913.sra Read 586654 spots for SRR3207913.sra Written 586654 spots for SRR3207913.sra Read 586654 spots for SRR3207913.sra Written 586654 spots for SRR3207913.sra Read 586654 spots for SRR3207913.sra Written 586654 spots for SRR3207913.sra Read 586654 spots for SRR3207913.sra Written 586654 spots for SRR3207913.sra Read 586654 spots for SRR3207913.sra Written 586654 spots for SRR3207913.sra Read 586654 spots for SRR3207913.sra Written 586654 spots for SRR3207913.sra Read 586654 spots for SRR3207913.sra Written 586654 spots for SRR3207913.sra Read 586654 spots for SRR3207913.sra Written 586654 spots for SRR3207913.sra Read 586654 spots for SRR3207913.sra Written 586654 spots for SRR3207913.sra Read 586654 spots for SRR3207913.sra Written 586654 spots for SRR3207913.sra Read 586670 spots for SRR3207913.sra Written 586670 spots for SRR3207913.sra Read 586654 spots for SRR3207913.sra Written 586654 spots for SRR3207913.sra Read 586654 spots for SRR3207913.sra Written 586654 spots for SRR3207913.sra Read 586654 spots for SRR3207913.sra Written 586654 spots for SRR3207913.sra Read 586654 spots for SRR3207913.sra Written 586654 spots for SRR3207913.sra Read 586654 spots for SRR3207913.sra Written 586654 spots for SRR3207913.sra Read 586654 spots for SRR3207913.sra Written 586654 spots for SRR3207913.sra Read 586654 spots for SRR3207913.sra Written 586654 spots for SRR3207913.sra SRR ids: ['SRR3207913.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qfjtgx3f SRR3207913.sra spots: 11733096 blocks: [[1, 586654], [586655, 1173308], [1173309, 1759962], [1759963, 2346616], [2346617, 2933270], [2933271, 3519924], [3519925, 4106578], [4106579, 4693232], [4693233, 5279886], [5279887, 5866540], [5866541, 6453194], [6453195, 7039848], [7039849, 7626502], [7626503, 8213156], [8213157, 8799810], [8799811, 9386464], [9386465, 9973118], [9973119, 10559772], [10559773, 11146426], [11146427, 11733096]] SRR3207913 file size 3042564 SRR3207913 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207913 SRR3207913_1.fastq Input file: SRR3207913_1.fastq trimmed: SRR3207913-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 14:15:35 2025 >> started Tue Feb 11 14:15:42 2025 >> done (6.881s) 11733096 reads processed; of these: 2728 ( 0.02%) short reads filtered out after trimming by size control 11268 ( 0.10%) empty reads filtered out after trimming by size control 11719100 (99.88%) reads available; of these: 1026929 ( 8.76%) trimmed reads available after processing 10692171 (91.24%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 430 0.00% 19 450 0.00% 20 580 0.00% 21 745 0.01% 22 906 0.01% 23 1290 0.01% 24 1668 0.01% 25 2237 0.02% 26 2335 0.02% 27 2261 0.02% 28 2407 0.02% 29 2496 0.02% 30 2488 0.02% 31 2355 0.02% 32 2165 0.02% 33 2292 0.02% 34 2317 0.02% 35 2429 0.02% 36 2611 0.02% 37 2818 0.02% 38 2969 0.03% 39 3139 0.03% 40 3337 0.03% 41 3456 0.03% 42 3561 0.03% 43 3797 0.03% 44 4080 0.03% 45 4115 0.04% 46 4395 0.04% 47 4744 0.04% 48 4919 0.04% 49 4987 0.04% 50 5469 0.05% 51 5460 0.05% 52 5901 0.05% 53 6155 0.05% 54 6734 0.06% 55 6921 0.06% 56 7302 0.06% 57 7489 0.06% 58 7960 0.07% 59 7811 0.07% 60 7866 0.07% 61 8134 0.07% 62 8215 0.07% 63 8118 0.07% 64 8463 0.07% 65 8303 0.07% 66 8444 0.07% 67 8758 0.07% 68 9169 0.08% 69 9027 0.08% 70 9187 0.08% 71 9489 0.08% 72 9800 0.08% 73 10229 0.09% 74 9901 0.08% 75 9721 0.08% 76 7435 0.06% 77 8213 0.07% 78 9576 0.08% 79 10622 0.09% 80 11534 0.10% 81 12370 0.11% 82 13412 0.11% 83 14950 0.13% 84 15358 0.13% 85 17251 0.15% 86 18628 0.16% 87 19751 0.17% 88 21484 0.18% 89 22623 0.19% 90 25481 0.22% 91 28980 0.25% 92 33280 0.28% 93 38094 0.33% 94 49116 0.42% 95 61997 0.53% 96 60710 0.52% 97 70503 0.60% 98 79050 0.67% 99 81706 0.70% 100 10692171 91.24% 11719100 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=33 prefix-density=0.04 prefix-fanout=2.1 sequence=TCGTATGCCGTCTTCTGCTTGAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=19 fanout-score=301.92 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=28.1 sequence=TTCTTCTTCTTT Started job on | Feb 11 14:16:00 Started mapping on | Feb 11 14:16:00 Finished on | Feb 11 14:16:14 Mapping speed, Million of reads per hour | 3013.48 Number of input reads | 11719100 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 11050754 Uniquely mapped reads % | 94.30% Average mapped length | 98.26 Number of splices: Total | 3250022 Number of splices: Annotated (sjdb) | 3178538 Number of splices: GT/AG | 3196065 Number of splices: GC/AG | 45042 Number of splices: AT/AC | 3772 Number of splices: Non-canonical | 5143 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 2.02 Insertion rate per base | 0.01% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 281374 % of reads mapped to multiple loci | 2.40% Number of reads mapped to too many loci | 203640 % of reads mapped to too many loci | 1.74% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.56% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 386972 386972 386972 N_multimapping 281374 281374 281374 N_noFeature 515110 5718720 5784026 N_ambiguous 105980 21588 21452 UnstrandedReadsAssigned:10429664 PositiveStrandReadsAssigned:5310446 NegativeStrandReadsAssigned:5245276 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207913 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207913-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,719,100 reads, 10,807,836 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,208 rounds 52401 SRR3207913.ke.tsv 34699 SRR3207913.se.tsv 87100 total ==> SRR3207913.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 664 46.1664 Potri.005G024800.1.v4.1 1035 936 386 55.023 Potri.004G059700.1.v4.1 961 862 14 2.16697 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 264.662 12.4164 Potri.016G087400.1.v4.1 270 171 294 229.395 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 55 4.3837 Potri.012G127500.1.v4.1 977 878 1422 216.092 ==> SRR3207913.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 690 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 152 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR3207913 completed mapping pipeline successfully