Starting /dee2/code/volunteer_pipeline.sh SRR3207914 current disk space = 3049529434112 free memory = 1578256376 SRR3207914 SRAfilesize 42eb9de487a571f126ebbee5ae37e6ec SRR3207914.sra SRR3207914.sra file validated SRR3207914 is single end SRR3207914 is conventional basespace SRR3207914 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207914_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.09325 34.0 33.0 34.0 31.0 34.0 2 33.24675 34.0 34.0 34.0 31.0 34.0 3 33.38225 34.0 34.0 34.0 31.0 34.0 4 36.61025 37.0 37.0 37.0 35.0 37.0 5 36.57875 37.0 37.0 37.0 35.0 37.0 6 36.6025 37.0 37.0 37.0 35.0 37.0 7 36.602 37.0 37.0 37.0 35.0 37.0 8 36.59 37.0 37.0 37.0 35.0 37.0 9 38.49075 39.0 39.0 39.0 37.0 39.0 10-11 38.30775 39.0 39.0 39.0 37.0 39.0 12-13 38.400999999999996 39.0 39.0 39.0 37.0 39.0 14-15 40.01925 41.0 40.0 41.0 38.0 41.0 16-17 40.011125 41.0 40.0 41.0 38.0 41.0 18-19 39.992374999999996 41.0 40.0 41.0 38.0 41.0 20-21 39.953125 41.0 40.0 41.0 38.0 41.0 22-23 39.856625 41.0 40.0 41.0 38.0 41.0 24-25 39.845375 41.0 40.0 41.0 38.0 41.0 26-27 39.837875 41.0 40.0 41.0 38.0 41.0 28-29 39.725875 41.0 40.0 41.0 38.0 41.0 30-31 39.35725 41.0 39.5 41.0 36.5 41.0 32-33 39.653375 41.0 40.0 41.0 37.5 41.0 34-35 39.7235 41.0 40.0 41.0 38.0 41.0 36-37 39.644499999999994 41.0 40.0 41.0 37.5 41.0 38-39 39.53375 41.0 40.0 41.0 37.0 41.0 40-41 39.529125 41.0 40.0 41.0 37.0 41.0 42-43 39.348875 40.5 39.5 41.0 36.5 41.0 44-45 39.193375 40.5 39.0 41.0 36.0 41.0 46-47 39.121875 40.5 39.0 41.0 35.5 41.0 48-49 39.077749999999995 40.0 39.0 41.0 35.5 41.0 50-51 38.960625 40.0 39.0 41.0 35.0 41.0 52-53 38.673 40.0 38.5 41.0 35.0 41.0 54-55 38.65625 40.0 38.0 41.0 35.0 41.0 56-57 38.505875 40.0 38.0 41.0 35.0 41.0 58-59 38.188 40.0 37.5 41.0 34.5 41.0 60-61 38.054875 40.0 37.0 41.0 34.0 41.0 62-63 37.818625 39.0 36.5 41.0 34.0 41.0 64-65 37.544 39.0 36.0 40.5 34.0 41.0 66-67 37.245374999999996 39.0 36.0 40.0 34.0 41.0 68-69 36.852000000000004 37.5 35.0 40.0 33.0 41.0 70-71 36.171625000000006 37.0 35.0 39.0 32.0 41.0 72-73 35.876625000000004 36.5 35.0 39.0 32.5 40.5 74-75 35.209125 36.0 34.5 38.5 31.0 40.0 76-77 34.328625 35.0 33.5 37.0 30.5 39.0 78-79 34.652625 35.0 34.0 37.0 31.5 39.0 80-81 34.339875 35.0 34.0 36.5 31.0 38.5 82-83 34.140125 35.0 34.0 36.0 31.0 37.0 84-85 33.916624999999996 35.0 34.0 36.0 31.0 37.0 86-87 33.495625000000004 35.0 34.0 35.0 30.5 36.5 88-89 33.36525 35.0 34.0 35.0 30.5 36.0 90-91 33.068875000000006 35.0 34.0 35.0 29.5 36.0 92-93 32.82825 35.0 34.0 35.0 29.5 35.5 94-95 32.7425 35.0 34.0 35.0 29.5 35.0 96-97 32.666375 35.0 33.5 35.0 29.0 35.0 98-99 32.42175 35.0 33.0 35.0 29.0 35.0 100 32.26525 35.0 33.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 3.0 11 0.0 12 1.0 13 3.0 14 4.0 15 1.0 16 3.0 17 6.0 18 3.0 19 5.0 20 4.0 21 5.0 22 4.0 23 7.0 24 10.0 25 8.0 26 15.0 27 15.0 28 19.0 29 23.0 30 27.0 31 35.0 32 60.0 33 82.0 34 92.0 35 183.0 36 361.0 37 907.0 38 1785.0 39 328.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.39899623588457 15.88456712672522 12.346298619824342 45.37013801756587 2 20.349999999999998 20.549999999999997 38.5 20.599999999999998 3 21.925 24.125 27.05 26.900000000000002 4 24.75 30.15 21.5 23.599999999999998 5 26.6 33.675 22.075 17.65 6 19.950000000000003 37.1 23.724999999999998 19.225 7 17.45 21.3 41.55 19.7 8 19.175 24.65 31.275 24.9 9 20.474999999999998 22.875 32.65 24.0 10-11 21.9375 33.1875 23.8875 20.9875 12-13 21.0375 26.487500000000004 28.925 23.549999999999997 14-15 22.162499999999998 27.787499999999998 28.7375 21.3125 16-17 22.537499999999998 27.925 26.85 22.6875 18-19 21.8125 28.299999999999997 27.275 22.6125 20-21 21.425 27.925 27.037499999999998 23.6125 22-23 21.3125 28.762500000000003 27.175 22.75 24-25 20.724999999999998 28.625 28.0875 22.5625 26-27 21.8625 27.800000000000004 28.449999999999996 21.8875 28-29 22.2625 27.8375 27.5625 22.3375 30-31 21.475 28.975 27.1125 22.4375 32-33 21.625 28.537499999999998 27.6375 22.2 34-35 23.225 27.6875 26.637499999999996 22.45 36-37 21.975 27.762500000000003 27.6 22.662499999999998 38-39 21.8625 27.8125 28.325 22.0 40-41 21.1625 27.787499999999998 28.275 22.775000000000002 42-43 21.5375 27.9125 27.6 22.95 44-45 22.55 27.1375 27.875 22.4375 46-47 21.512500000000003 28.1375 28.599999999999998 21.75 48-49 22.0 28.000000000000004 28.037499999999998 21.9625 50-51 21.838649155722326 27.504690431519702 26.941838649155724 23.714821763602252 52-53 21.82614133833646 28.843026891807376 26.966854283927454 22.363977485928704 54-55 21.65 28.599999999999998 27.2625 22.4875 56-57 21.6 27.8375 28.299999999999997 22.2625 58-59 22.1375 28.299999999999997 27.737499999999997 21.825 60-61 22.225 28.1875 27.35 22.237499999999997 62-63 21.987499999999997 27.400000000000002 28.487499999999997 22.125 64-65 22.05 27.537499999999998 27.737499999999997 22.675 66-67 22.1875 27.925 27.537499999999998 22.35 68-69 22.225 27.625 26.7625 23.3875 70-71 22.112499999999997 28.050000000000004 27.275 22.5625 72-73 21.2625 28.299999999999997 28.525 21.912499999999998 74-75 20.837500000000002 27.3375 29.275000000000002 22.55 76-77 22.625 26.950000000000003 28.299999999999997 22.125 78-79 22.425 28.449999999999996 27.675 21.45 80-81 21.45 28.4125 28.050000000000004 22.0875 82-83 21.725 28.725 28.1 21.45 84-85 21.912499999999998 27.9125 27.437499999999996 22.7375 86-87 22.252781597699713 27.678459807475935 27.728466058257283 22.340292536567073 88-89 21.82614133833646 29.018136335209505 27.417135709818634 21.7385866166354 90-91 22.38208432378331 26.748404854247465 28.76266733391718 22.106843488052043 92-93 21.76088044022011 28.42671335667834 27.688844422211105 22.123561780890444 94-95 22.043010752688172 27.656914228557138 28.51962990747687 21.780445111277817 96-97 22.330582645661416 27.68192048012003 27.85696424106027 22.13053263315829 98-99 21.73043260815204 28.432108027006752 28.432108027006752 21.405351337834457 100 22.775000000000002 28.749999999999996 26.0 22.475 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 2.0 24 3.0 25 3.0 26 5.0 27 7.0 28 5.5 29 6.5 30 10.5 31 15.5 32 24.5 33 36.5 34 50.0 35 75.5 36 95.5 37 106.5 38 130.5 39 165.0 40 207.5 41 223.5 42 236.0 43 281.0 44 286.0 45 265.5 46 258.5 47 246.5 48 227.5 49 191.0 50 157.5 51 136.0 52 113.5 53 91.5 54 71.0 55 53.0 56 40.0 57 30.0 58 27.0 59 20.0 60 15.5 61 16.5 62 11.0 63 7.0 64 5.0 65 3.5 66 5.5 67 8.0 68 6.0 69 5.0 70 3.5 71 0.5 72 0.5 73 1.0 74 1.0 75 1.0 76 1.0 77 1.5 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0625 52-53 0.0625 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0125 88-89 0.0625 90-91 0.08750000000000001 92-93 0.05 94-95 0.025 96-97 0.025 98-99 0.025 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79954898521673 99.575 2 0.17539463793535454 0.35000000000000003 3 0.025056376847907794 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.025 0.0 66-67 0.075 0.0 0.0 0.025 0.0 68-69 0.075 0.0 0.0 0.025 0.0 70-71 0.075 0.0 0.0 0.025 0.0 72-73 0.075 0.0 0.0 0.025 0.0 74-75 0.075 0.0 0.0 0.025 0.0 76-77 0.1 0.0 0.0 0.025 0.0 78-79 0.125 0.0 0.0 0.025 0.0 80-81 0.125 0.0 0.0 0.025 0.0 82-83 0.175 0.0 0.0 0.025 0.0 84-85 0.175 0.0 0.0 0.025 0.0 86-87 0.2 0.0 0.0 0.025 0.0 88 0.2 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1091223 spots for SRR3207914.sra Written 1091223 spots for SRR3207914.sra Read 1091223 spots for SRR3207914.sra Written 1091223 spots for SRR3207914.sra Read 1091223 spots for SRR3207914.sra Written 1091223 spots for SRR3207914.sra Read 1091223 spots for SRR3207914.sra Written 1091223 spots for SRR3207914.sra Read 1091223 spots for SRR3207914.sra Written 1091223 spots for SRR3207914.sra Read 1091223 spots for SRR3207914.sra Written 1091223 spots for SRR3207914.sra Read 1091223 spots for SRR3207914.sra Written 1091223 spots for SRR3207914.sra Read 1091223 spots for SRR3207914.sra Written 1091223 spots for SRR3207914.sra Read 1091223 spots for SRR3207914.sra Written 1091223 spots for SRR3207914.sra Read 1091223 spots for SRR3207914.sra Written 1091223 spots for SRR3207914.sra Read 1091223 spots for SRR3207914.sra Written 1091223 spots for SRR3207914.sra Read 1091223 spots for SRR3207914.sra Written 1091223 spots for SRR3207914.sra Read 1091223 spots for SRR3207914.sra Written 1091223 spots for SRR3207914.sra Read 1091229 spots for SRR3207914.sra Written 1091229 spots for SRR3207914.sra Read 1091223 spots for SRR3207914.sra Written 1091223 spots for SRR3207914.sra Read 1091223 spots for SRR3207914.sra Written 1091223 spots for SRR3207914.sra Read 1091223 spots for SRR3207914.sra Written 1091223 spots for SRR3207914.sra Read 1091223 spots for SRR3207914.sra Written 1091223 spots for SRR3207914.sra Read 1091223 spots for SRR3207914.sra Written 1091223 spots for SRR3207914.sra Read 1091223 spots for SRR3207914.sra Written 1091223 spots for SRR3207914.sra SRR ids: ['SRR3207914.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nag5v3b2 SRR3207914.sra spots: 21824466 blocks: [[1, 1091223], [1091224, 2182446], [2182447, 3273669], [3273670, 4364892], [4364893, 5456115], [5456116, 6547338], [6547339, 7638561], [7638562, 8729784], [8729785, 9821007], [9821008, 10912230], [10912231, 12003453], [12003454, 13094676], [13094677, 14185899], [14185900, 15277122], [15277123, 16368345], [16368346, 17459568], [17459569, 18550791], [18550792, 19642014], [19642015, 20733237], [20733238, 21824466]] SRR3207914 file size 5668757 SRR3207914 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207914 SRR3207914_1.fastq Input file: SRR3207914_1.fastq trimmed: SRR3207914-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 15:36:26 2025 >> started Tue Feb 11 15:36:37 2025 >> done (10.849s) 21824466 reads processed; of these: 5791 ( 0.03%) short reads filtered out after trimming by size control 20388 ( 0.09%) empty reads filtered out after trimming by size control 21798287 (99.88%) reads available; of these: 1905668 ( 8.74%) trimmed reads available after processing 19892619 (91.26%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 833 0.00% 19 951 0.00% 20 1076 0.00% 21 1426 0.01% 22 1816 0.01% 23 2419 0.01% 24 3163 0.01% 25 4015 0.02% 26 4267 0.02% 27 4082 0.02% 28 4132 0.02% 29 4251 0.02% 30 4363 0.02% 31 4156 0.02% 32 4165 0.02% 33 4222 0.02% 34 4552 0.02% 35 4733 0.02% 36 5098 0.02% 37 5318 0.02% 38 5544 0.03% 39 5872 0.03% 40 6260 0.03% 41 6447 0.03% 42 6734 0.03% 43 7107 0.03% 44 7517 0.03% 45 7993 0.04% 46 8256 0.04% 47 8819 0.04% 48 9164 0.04% 49 9744 0.04% 50 10299 0.05% 51 10568 0.05% 52 10803 0.05% 53 11512 0.05% 54 12358 0.06% 55 13011 0.06% 56 13647 0.06% 57 13978 0.06% 58 14463 0.07% 59 14793 0.07% 60 14693 0.07% 61 15118 0.07% 62 15897 0.07% 63 15639 0.07% 64 15801 0.07% 65 15927 0.07% 66 16001 0.07% 67 16567 0.08% 68 16904 0.08% 69 16762 0.08% 70 17078 0.08% 71 17334 0.08% 72 17881 0.08% 73 18668 0.09% 74 18198 0.08% 75 18140 0.08% 76 13523 0.06% 77 15469 0.07% 78 17661 0.08% 79 19789 0.09% 80 21348 0.10% 81 22868 0.10% 82 24809 0.11% 83 27894 0.13% 84 28723 0.13% 85 32561 0.15% 86 33809 0.16% 87 36962 0.17% 88 39525 0.18% 89 41807 0.19% 90 47082 0.22% 91 53928 0.25% 92 61874 0.28% 93 70983 0.33% 94 91326 0.42% 95 113956 0.52% 96 111486 0.51% 97 130091 0.60% 98 146053 0.67% 99 151606 0.70% 100 19892619 91.26% 21798287 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=10.58 fanout-score-rank=12 prefix-density=0.08 prefix-fanout=10.6 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTATGCCGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=17 fanout-score=298.24 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=28.5 sequence=TTCTTCTTCTTT Started job on | Feb 11 15:36:55 Started mapping on | Feb 11 15:36:55 Finished on | Feb 11 15:37:20 Mapping speed, Million of reads per hour | 3138.95 Number of input reads | 21798287 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 20147374 Uniquely mapped reads % | 92.43% Average mapped length | 98.27 Number of splices: Total | 5943723 Number of splices: Annotated (sjdb) | 5815874 Number of splices: GT/AG | 5845794 Number of splices: GC/AG | 81861 Number of splices: AT/AC | 6834 Number of splices: Non-canonical | 9234 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 2.05 Insertion rate per base | 0.01% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 518604 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 671957 % of reads mapped to too many loci | 3.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.10% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1132309 1132309 1132309 N_multimapping 518604 518604 518604 N_noFeature 958861 10449555 10540095 N_ambiguous 192715 38100 38353 UnstrandedReadsAssigned:18995798 PositiveStrandReadsAssigned:9659719 NegativeStrandReadsAssigned:9568926 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207914 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207914-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,798,287 reads, 19,950,554 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,243 rounds 52401 SRR3207914.ke.tsv 34699 SRR3207914.se.tsv 87100 total ==> SRR3207914.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 893 33.539 Potri.005G024800.1.v4.1 1035 936 569 43.8137 Potri.004G059700.1.v4.1 961 862 16 1.33778 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 478.22 12.1191 Potri.016G087400.1.v4.1 270 171 707 297.987 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 140.553 6.05141 Potri.012G127500.1.v4.1 977 878 3020 247.905 ==> SRR3207914.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1631 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 286 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 21 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 17 SRR3207914 completed mapping pipeline successfully