Starting /dee2/code/volunteer_pipeline.sh SRR3207915 current disk space = 3050111102976 free memory = 1501877056 SRR3207915 SRAfilesize e56179c86a7ae586863e3ea3ec310a5f SRR3207915.sra SRR3207915.sra file validated SRR3207915 is single end SRR3207915 is conventional basespace SRR3207915 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207915_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.946 34.0 33.0 34.0 31.0 34.0 2 33.305 34.0 34.0 34.0 31.0 34.0 3 33.4125 34.0 34.0 34.0 31.0 34.0 4 36.6415 37.0 37.0 37.0 35.0 37.0 5 36.60825 37.0 37.0 37.0 35.0 37.0 6 36.47475 37.0 37.0 37.0 35.0 37.0 7 36.55775 37.0 37.0 37.0 35.0 37.0 8 36.57925 37.0 37.0 37.0 35.0 37.0 9 38.49375 39.0 39.0 39.0 37.0 39.0 10-11 38.50175 39.0 39.0 39.0 37.0 39.0 12-13 38.4265 39.0 39.0 39.0 37.0 39.0 14-15 40.058 41.0 40.0 41.0 38.0 41.0 16-17 40.022625000000005 41.0 40.0 41.0 38.0 41.0 18-19 39.888625 41.0 40.0 41.0 38.0 41.0 20-21 39.910875000000004 41.0 40.0 41.0 38.0 41.0 22-23 39.793 41.0 40.0 41.0 38.0 41.0 24-25 39.7615 41.0 40.0 41.0 38.0 41.0 26-27 39.59025 41.0 40.0 41.0 37.5 41.0 28-29 39.351124999999996 41.0 39.5 41.0 36.5 41.0 30-31 39.24525 41.0 39.0 41.0 36.5 41.0 32-33 39.463875 41.0 40.0 41.0 37.0 41.0 34-35 39.439625 41.0 40.0 41.0 37.0 41.0 36-37 39.38425 41.0 40.0 41.0 37.0 41.0 38-39 39.104875 41.0 39.5 41.0 35.5 41.0 40-41 39.220749999999995 41.0 40.0 41.0 36.0 41.0 42-43 39.16975 41.0 39.5 41.0 36.0 41.0 44-45 39.004374999999996 41.0 39.0 41.0 35.0 41.0 46-47 38.922124999999994 41.0 39.0 41.0 35.0 41.0 48-49 38.872375 41.0 39.0 41.0 35.0 41.0 50-51 38.670125 40.5 39.0 41.0 35.0 41.0 52-53 38.458749999999995 40.0 38.0 41.0 35.0 41.0 54-55 38.31125 40.0 38.0 41.0 34.0 41.0 56-57 38.1275 40.0 38.0 41.0 34.0 41.0 58-59 37.92274999999999 40.0 37.5 41.0 34.0 41.0 60-61 37.369 39.5 36.5 41.0 32.5 41.0 62-63 37.04975 39.0 36.0 41.0 32.5 41.0 64-65 36.928 39.0 35.5 41.0 33.0 41.0 66-67 36.60025 38.5 35.0 40.0 32.0 41.0 68-69 36.287125 38.0 35.0 40.0 32.0 41.0 70-71 35.829125 37.0 35.0 39.5 31.0 41.0 72-73 35.36175 36.5 35.0 39.0 31.0 41.0 74-75 34.845 36.0 34.5 39.0 30.5 40.0 76-77 33.6035 35.0 33.5 37.0 28.5 39.0 78-79 34.13875 35.0 34.0 37.0 30.5 39.0 80-81 33.768875 35.0 34.0 37.0 30.0 39.0 82-83 33.67275 35.0 34.0 36.0 30.0 37.5 84-85 33.349374999999995 35.0 34.0 36.0 30.0 37.0 86-87 33.15675 35.0 34.0 35.5 30.0 37.0 88-89 32.93075 35.0 34.0 35.0 29.5 36.0 90-91 32.714875 35.0 34.0 35.0 29.0 36.0 92-93 32.47375 35.0 34.0 35.0 29.0 36.0 94-95 32.2575 35.0 34.0 35.0 29.0 35.5 96-97 31.82725 35.0 33.0 35.0 26.0 35.0 98-99 31.591625 35.0 33.0 35.0 26.5 35.0 100 31.3635 35.0 33.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 1.0 5 0.0 6 0.0 7 1.0 8 0.0 9 2.0 10 4.0 11 4.0 12 7.0 13 5.0 14 5.0 15 8.0 16 7.0 17 8.0 18 6.0 19 11.0 20 10.0 21 10.0 22 6.0 23 8.0 24 14.0 25 10.0 26 15.0 27 16.0 28 26.0 29 28.0 30 32.0 31 52.0 32 49.0 33 74.0 34 95.0 35 192.0 36 335.0 37 883.0 38 1616.0 39 459.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.18745275888133 18.74527588813303 13.63063744016125 43.43663391282439 2 18.85 25.25 37.225 18.675 3 19.73980485364023 28.096072054040533 27.120340255191394 25.04378283712785 4 23.175 32.4 22.7 21.725 5 24.2 33.35 23.65 18.8 6 18.65 36.199999999999996 26.1 19.05 7 17.75 19.900000000000002 40.9 21.45 8 17.825 25.05 32.475 24.65 9 20.349999999999998 22.650000000000002 32.300000000000004 24.7 10-11 22.787499999999998 32.35 23.775 21.087500000000002 12-13 20.4 27.224999999999998 29.4875 22.8875 14-15 20.6875 28.287499999999998 28.0625 22.9625 16-17 21.5625 28.249999999999996 28.1375 22.05 18-19 22.1375 28.025 28.1375 21.7 20-21 22.3375 27.675 28.15 21.837500000000002 22-23 20.875 29.212500000000002 28.449999999999996 21.462500000000002 24-25 21.525 28.0625 27.9125 22.5 26-27 20.7375 28.249999999999996 29.25 21.762500000000003 28-29 22.025 28.212500000000002 27.525 22.237499999999997 30-31 21.5 27.8125 28.6875 22.0 32-33 21.6625 28.7375 28.15 21.45 34-35 22.175 28.375 28.15 21.3 36-37 22.25 28.012500000000003 27.1625 22.575 38-39 20.75 28.6125 27.750000000000004 22.8875 40-41 21.8 28.237499999999997 28.1625 21.8 42-43 21.4375 27.975 28.3375 22.25 44-45 21.987499999999997 28.799999999999997 27.950000000000003 21.2625 46-47 22.075 28.7375 27.400000000000002 21.7875 48-49 21.3125 27.762500000000003 28.012500000000003 22.912499999999998 50-51 21.85389041781336 28.84663497623217 27.282962221666253 22.016512384288216 52-53 22.069310646815964 29.438258476166645 27.849368197172524 20.643062679844864 54-55 22.537499999999998 28.1625 27.737499999999997 21.5625 56-57 21.4375 28.249999999999996 27.650000000000002 22.662499999999998 58-59 22.6375 28.275 27.474999999999998 21.6125 60-61 22.8375 27.3625 27.825 21.975 62-63 21.9375 28.4375 27.6375 21.987499999999997 64-65 22.225 28.775000000000002 27.775 21.224999999999998 66-67 22.162499999999998 28.025 28.525 21.2875 68-69 22.2125 27.750000000000004 28.1 21.9375 70-71 21.65 28.6625 27.05 22.6375 72-73 21.075 28.0625 28.349999999999998 22.5125 74-75 21.6 27.85 28.299999999999997 22.25 76-77 21.837500000000002 28.487499999999997 27.275 22.400000000000002 78-79 21.775 27.9125 28.275 22.037499999999998 80-81 22.2 28.475 27.925 21.4 82-83 21.675 28.625 27.725 21.975 84-85 22.175 29.6875 26.400000000000002 21.7375 86-87 22.1875 28.225 28.3125 21.275 88-89 21.6635397123202 28.230143839899934 27.992495309568483 22.11382113821138 90-91 20.993369198048292 28.5124483923433 27.999499562116853 22.494682847491553 92-93 21.823411705852926 28.176588294147077 27.951475737868936 22.048524262131068 94-95 22.2 28.012500000000003 27.8875 21.9 96-97 22.127765970746342 27.715964495561945 28.27853481685211 21.877734716839605 98-99 21.833187445291983 28.260597724146553 28.198074277854197 21.708140552707263 100 21.76088044022011 28.46423211605803 27.71385692846423 22.061030515257627 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 2.0 18 3.0 19 3.0 20 4.0 21 4.5 22 4.5 23 9.0 24 12.0 25 10.0 26 15.0 27 24.5 28 32.0 29 34.5 30 38.0 31 53.5 32 58.0 33 57.5 34 73.0 35 91.0 36 115.0 37 125.5 38 126.5 39 150.5 40 178.5 41 191.5 42 200.0 43 222.0 44 231.5 45 218.0 46 205.5 47 198.5 48 183.0 49 159.5 50 148.0 51 133.0 52 110.0 53 90.0 54 72.5 55 60.5 56 55.5 57 52.0 58 42.5 59 38.5 60 32.0 61 19.5 62 21.0 63 19.5 64 10.0 65 8.0 66 9.0 67 10.0 68 6.5 69 3.0 70 3.0 71 1.5 72 2.5 73 3.0 74 3.0 75 3.0 76 2.0 77 2.0 78 1.5 79 0.0 80 1.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.775 2 0.0 3 0.075 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.075 52-53 0.08750000000000001 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0625 90-91 0.08750000000000001 92-93 0.05 94-95 0.0 96-97 0.0125 98-99 0.0375 100 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.874749498998 99.675 2 0.1002004008016032 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0250501002004008 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGC 5 0.125 TruSeq Adapter, Index 1 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.325 0.0 0.0 0.0 0.0 88 0.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1649864 spots for SRR3207915.sra Written 1649864 spots for SRR3207915.sra Read 1649864 spots for SRR3207915.sra Written 1649864 spots for SRR3207915.sra Read 1649864 spots for SRR3207915.sra Written 1649864 spots for SRR3207915.sra Read 1649864 spots for SRR3207915.sra Written 1649864 spots for SRR3207915.sra Read 1649864 spots for SRR3207915.sra Written 1649864 spots for SRR3207915.sra Read 1649864 spots for SRR3207915.sra Written 1649864 spots for SRR3207915.sra Read 1649864 spots for SRR3207915.sra Written 1649864 spots for SRR3207915.sra Read 1649864 spots for SRR3207915.sra Written 1649864 spots for SRR3207915.sra Read 1649867 spots for SRR3207915.sra Written 1649867 spots for SRR3207915.sra Read 1649864 spots for SRR3207915.sra Written 1649864 spots for SRR3207915.sra Read 1649864 spots for SRR3207915.sra Written 1649864 spots for SRR3207915.sra Read 1649864 spots for SRR3207915.sra Written 1649864 spots for SRR3207915.sra Read 1649864 spots for SRR3207915.sra Written 1649864 spots for SRR3207915.sra Read 1649864 spots for SRR3207915.sra Written 1649864 spots for SRR3207915.sra Read 1649864 spots for SRR3207915.sra Written 1649864 spots for SRR3207915.sra Read 1649864 spots for SRR3207915.sra Written 1649864 spots for SRR3207915.sra Read 1649864 spots for SRR3207915.sra Written 1649864 spots for SRR3207915.sra Read 1649864 spots for SRR3207915.sra Written 1649864 spots for SRR3207915.sra Read 1649864 spots for SRR3207915.sra Written 1649864 spots for SRR3207915.sra Read 1649864 spots for SRR3207915.sra Written 1649864 spots for SRR3207915.sra SRR ids: ['SRR3207915.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tgeh1fv7 SRR3207915.sra spots: 32997283 blocks: [[1, 1649864], [1649865, 3299728], [3299729, 4949592], [4949593, 6599456], [6599457, 8249320], [8249321, 9899184], [9899185, 11549048], [11549049, 13198912], [13198913, 14848776], [14848777, 16498640], [16498641, 18148504], [18148505, 19798368], [19798369, 21448232], [21448233, 23098096], [23098097, 24747960], [24747961, 26397824], [26397825, 28047688], [28047689, 29697552], [29697553, 31347416], [31347417, 32997283]] SRR3207915 file size 8576382 SRR3207915 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207915 SRR3207915_1.fastq Input file: SRR3207915_1.fastq trimmed: SRR3207915-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 14:35:09 2025 >> started Tue Feb 11 14:35:27 2025 >> done (18.124s) 32997283 reads processed; of these: 8584 ( 0.03%) short reads filtered out after trimming by size control 98160 ( 0.30%) empty reads filtered out after trimming by size control 32890539 (99.68%) reads available; of these: 3158344 ( 9.60%) trimmed reads available after processing 29732195 (90.40%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1594 0.00% 19 1928 0.01% 20 2394 0.01% 21 2861 0.01% 22 3872 0.01% 23 5257 0.02% 24 6668 0.02% 25 8653 0.03% 26 8456 0.03% 27 8316 0.03% 28 8333 0.03% 29 8325 0.03% 30 8312 0.03% 31 8350 0.03% 32 8280 0.03% 33 8861 0.03% 34 9253 0.03% 35 9582 0.03% 36 10484 0.03% 37 10586 0.03% 38 11309 0.03% 39 12047 0.04% 40 12262 0.04% 41 12743 0.04% 42 13422 0.04% 43 14218 0.04% 44 14797 0.04% 45 15080 0.05% 46 15815 0.05% 47 16433 0.05% 48 17204 0.05% 49 18133 0.06% 50 19084 0.06% 51 19914 0.06% 52 20281 0.06% 53 21636 0.07% 54 23285 0.07% 55 23787 0.07% 56 24937 0.08% 57 25624 0.08% 58 26980 0.08% 59 26802 0.08% 60 26422 0.08% 61 26935 0.08% 62 26915 0.08% 63 27338 0.08% 64 27205 0.08% 65 27893 0.08% 66 27886 0.08% 67 28553 0.09% 68 29442 0.09% 69 29159 0.09% 70 29204 0.09% 71 30732 0.09% 72 31079 0.09% 73 31289 0.10% 74 31356 0.10% 75 31599 0.10% 76 22844 0.07% 77 25876 0.08% 78 29172 0.09% 79 32975 0.10% 80 35258 0.11% 81 38808 0.12% 82 43407 0.13% 83 46291 0.14% 84 47305 0.14% 85 51900 0.16% 86 54500 0.17% 87 58230 0.18% 88 62948 0.19% 89 69003 0.21% 90 76736 0.23% 91 85975 0.26% 92 94870 0.29% 93 108213 0.33% 94 125628 0.38% 95 153300 0.47% 96 187354 0.57% 97 212696 0.65% 98 246229 0.75% 99 239661 0.73% 100 29732195 90.40% 32890539 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=14.67 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=14.7 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGT criterion=fanout-score sequence-density=0.15 sequence-density-rank=1 fanout-score=14.67 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=14.7 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGT Started job on | Feb 11 14:35:49 Started mapping on | Feb 11 14:35:49 Finished on | Feb 11 14:38:08 Mapping speed, Million of reads per hour | 851.84 Number of input reads | 32890539 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 22792499 Uniquely mapped reads % | 69.30% Average mapped length | 97.98 Number of splices: Total | 6050619 Number of splices: Annotated (sjdb) | 5923446 Number of splices: GT/AG | 5949639 Number of splices: GC/AG | 79790 Number of splices: AT/AC | 7114 Number of splices: Non-canonical | 14076 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.02% Deletion average length | 1.92 Insertion rate per base | 0.02% Insertion average length | 1.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 819157 % of reads mapped to multiple loci | 2.49% Number of reads mapped to too many loci | 1381345 % of reads mapped to too many loci | 4.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 23.98% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 9278883 9278883 9278883 N_multimapping 819157 819157 819157 N_noFeature 1477395 12071453 11998693 N_ambiguous 288265 44231 44655 UnstrandedReadsAssigned:21026839 PositiveStrandReadsAssigned:10676815 NegativeStrandReadsAssigned:10749151 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207915 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207915-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,890,539 reads, 22,958,258 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,115 rounds 52401 SRR3207915.ke.tsv 34699 SRR3207915.se.tsv 87100 total ==> SRR3207915.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1730.59 52.3841 Potri.005G024800.1.v4.1 1035 936 735 45.6133 Potri.004G059700.1.v4.1 961 862 67 4.51489 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 604.269 12.3419 Potri.016G087400.1.v4.1 270 171 913 310.138 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 99 3.43526 Potri.012G127500.1.v4.1 977 878 4712 311.738 ==> SRR3207915.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 1327 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 315 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 39 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 20 SRR3207915 completed mapping pipeline successfully