Starting /dee2/code/volunteer_pipeline.sh SRR3207916 current disk space = 3050229751808 free memory = 1275967480 SRR3207916 SRAfilesize 49d0b455ce872b553464578ba673d4bd SRR3207916.sra SRR3207916.sra file validated SRR3207916 is single end SRR3207916 is conventional basespace SRR3207916 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207916_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.94825 34.0 33.0 34.0 31.0 34.0 2 33.223 34.0 34.0 34.0 31.0 34.0 3 33.368 34.0 34.0 34.0 31.0 34.0 4 36.61475 37.0 37.0 37.0 35.0 37.0 5 36.57875 37.0 37.0 37.0 35.0 37.0 6 36.47375 37.0 37.0 37.0 35.0 37.0 7 36.5435 37.0 37.0 37.0 35.0 37.0 8 36.5215 37.0 37.0 37.0 35.0 37.0 9 38.4055 39.0 39.0 39.0 37.0 39.0 10-11 38.413624999999996 39.0 39.0 39.0 37.0 39.0 12-13 38.3655 39.0 39.0 39.0 37.0 39.0 14-15 39.945875 41.0 40.0 41.0 38.0 41.0 16-17 39.926874999999995 41.0 40.0 41.0 38.0 41.0 18-19 39.775625000000005 41.0 40.0 41.0 38.0 41.0 20-21 39.828500000000005 41.0 40.0 41.0 38.0 41.0 22-23 39.72 41.0 40.0 41.0 37.5 41.0 24-25 39.677 41.0 40.0 41.0 37.0 41.0 26-27 39.451750000000004 41.0 39.5 41.0 36.5 41.0 28-29 39.20925 41.0 39.0 41.0 36.0 41.0 30-31 39.161625 41.0 39.0 41.0 36.0 41.0 32-33 39.404250000000005 41.0 39.5 41.0 37.0 41.0 34-35 39.479 41.0 40.0 41.0 37.0 41.0 36-37 39.454875 41.0 40.0 41.0 37.0 41.0 38-39 39.206 41.0 39.0 41.0 36.0 41.0 40-41 39.218875 41.0 39.0 41.0 36.0 41.0 42-43 39.168 41.0 39.0 41.0 36.0 41.0 44-45 39.056 40.5 39.0 41.0 36.0 41.0 46-47 38.966125 41.0 39.0 41.0 35.0 41.0 48-49 38.961 41.0 39.0 41.0 35.0 41.0 50-51 38.793625 40.5 39.0 41.0 35.0 41.0 52-53 38.530625 40.0 38.0 41.0 35.0 41.0 54-55 38.426375 40.0 38.0 41.0 34.5 41.0 56-57 38.267250000000004 40.0 38.0 41.0 34.0 41.0 58-59 37.995875 40.0 37.5 41.0 34.0 41.0 60-61 37.4935 40.0 36.5 41.0 33.0 41.0 62-63 37.225875 39.0 36.0 41.0 32.5 41.0 64-65 37.023125 39.0 36.0 40.5 32.5 41.0 66-67 36.727625 38.5 35.0 40.0 32.0 41.0 68-69 36.404875000000004 37.5 35.0 40.0 32.0 41.0 70-71 35.985749999999996 37.0 35.0 39.5 32.0 41.0 72-73 35.401624999999996 36.5 35.0 39.0 31.0 40.5 74-75 34.92675 36.0 34.5 38.5 30.5 40.0 76-77 33.643 35.0 33.0 37.0 29.0 39.0 78-79 34.03125 35.0 34.0 37.0 30.0 39.0 80-81 33.673125 35.0 34.0 36.5 29.5 38.0 82-83 33.56525 35.0 34.0 36.0 30.0 37.0 84-85 33.169624999999996 35.0 34.0 36.0 29.0 37.0 86-87 33.054375 35.0 34.0 35.0 29.0 36.5 88-89 32.89725 35.0 34.0 35.0 29.5 36.0 90-91 32.727000000000004 35.0 34.0 35.0 29.0 36.0 92-93 32.451375 35.0 34.0 35.0 29.0 36.0 94-95 32.28125 35.0 34.0 35.0 29.0 35.0 96-97 31.812875000000002 35.0 33.0 35.0 26.5 35.0 98-99 31.637875 35.0 33.0 35.0 26.5 35.0 100 31.2155 35.0 33.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 2.0 9 1.0 10 0.0 11 2.0 12 3.0 13 7.0 14 4.0 15 4.0 16 9.0 17 7.0 18 6.0 19 10.0 20 9.0 21 9.0 22 14.0 23 7.0 24 5.0 25 20.0 26 14.0 27 24.0 28 25.0 29 28.0 30 42.0 31 47.0 32 52.0 33 75.0 34 101.0 35 172.0 36 379.0 37 905.0 38 1682.0 39 335.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.61961179732796 15.855810436097805 14.721451978825309 42.80312578774893 2 19.675 25.074999999999996 36.675000000000004 18.575 3 21.885942971485743 27.188594297148573 27.213606803401703 23.71185592796398 4 23.25 35.3 19.75 21.7 5 23.9 36.55 21.75 17.8 6 19.075 37.925 24.474999999999998 18.525 7 17.299999999999997 19.225 44.25 19.225 8 19.45 24.875 29.525000000000002 26.150000000000002 9 19.650000000000002 25.0 31.525 23.825 10-11 23.375 34.050000000000004 22.0625 20.5125 12-13 20.325 27.125 29.7125 22.8375 14-15 21.275 27.525 28.825 22.375 16-17 22.25 27.8875 28.037499999999998 21.825 18-19 21.15 29.012500000000003 28.075 21.762500000000003 20-21 21.75 28.425 28.199999999999996 21.625 22-23 21.8625 29.7 26.5625 21.875 24-25 21.1375 29.025000000000002 28.1 21.7375 26-27 21.8875 29.275000000000002 26.724999999999998 22.112499999999997 28-29 22.525000000000002 27.8375 27.9375 21.7 30-31 21.837500000000002 28.025 28.475 21.6625 32-33 21.512500000000003 28.025 28.6625 21.8 34-35 22.112499999999997 28.1 27.6875 22.1 36-37 20.7625 29.1375 27.462500000000002 22.6375 38-39 21.375 28.812500000000004 27.800000000000004 22.0125 40-41 21.8625 29.262500000000003 27.6125 21.2625 42-43 21.95 28.000000000000004 28.475 21.575 44-45 21.925 28.549999999999997 27.900000000000002 21.625 46-47 22.2125 28.325 27.925 21.5375 48-49 21.1875 30.0 27.250000000000004 21.5625 50-51 21.27127127127127 28.653653653653656 28.39089089089089 21.684184184184186 52-53 21.999749718433236 28.08159179076461 28.306845200850955 21.611813289951197 54-55 21.5 28.1625 28.237499999999997 22.1 56-57 22.112499999999997 27.825 28.599999999999998 21.462500000000002 58-59 20.849999999999998 28.4125 28.375 22.3625 60-61 22.162499999999998 27.8625 28.012500000000003 21.9625 62-63 21.8625 29.2 27.500000000000004 21.4375 64-65 22.325 28.5625 27.875 21.2375 66-67 21.1875 28.475 29.175 21.1625 68-69 21.7375 28.5875 28.287499999999998 21.3875 70-71 22.075 28.3125 28.0875 21.525 72-73 20.974999999999998 28.3875 27.875 22.7625 74-75 22.0875 28.037499999999998 28.325 21.55 76-77 22.3 28.1625 28.787499999999998 20.75 78-79 22.0 28.225 28.3875 21.3875 80-81 21.55 28.475 28.125 21.85 82-83 22.8375 28.875 27.5875 20.7 84-85 21.975 28.4 28.237499999999997 21.3875 86-87 21.915239404925615 29.078634829353668 27.378422302787847 21.627703462932867 88-89 21.6635397123202 28.567854909318324 28.142589118198874 21.6260162601626 90-91 22.031777805579882 29.100462905041912 27.73676967346428 21.130989615913926 92-93 21.575984990619137 29.0931832395247 28.080050031269543 21.250781738586618 94-95 21.987499999999997 28.4125 29.2375 20.3625 96-97 22.452806600825102 28.178522315289413 27.86598324790599 21.502687835979497 98-99 21.958234337876704 27.747905464549206 27.960485181943227 22.33337501563086 100 22.511255627813906 27.738869434717362 28.16408204102051 21.585792896448226 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 2.5 22 2.0 23 1.5 24 2.0 25 2.5 26 4.5 27 9.0 28 17.5 29 20.0 30 24.0 31 35.0 32 45.0 33 54.0 34 67.0 35 86.5 36 111.5 37 133.5 38 155.0 39 181.0 40 208.0 41 221.0 42 231.0 43 256.5 44 259.5 45 235.0 46 237.5 47 237.0 48 209.5 49 188.0 50 160.0 51 130.0 52 100.5 53 73.5 54 59.0 55 53.0 56 42.5 57 30.5 58 24.5 59 19.0 60 13.5 61 11.5 62 9.0 63 8.5 64 8.5 65 5.0 66 2.0 67 1.0 68 2.0 69 1.5 70 1.0 71 1.0 72 0.5 73 1.5 74 1.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8250000000000001 2 0.0 3 0.05 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.1 52-53 0.11249999999999999 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0125 88-89 0.0625 90-91 0.08750000000000001 92-93 0.0625 94-95 0.0 96-97 0.0125 98-99 0.0375 100 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74924774322969 99.45 2 0.22567703109327986 0.44999999999999996 3 0.0 0.0 4 0.025075225677031094 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88 0.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1158728 spots for SRR3207916.sra Written 1158728 spots for SRR3207916.sra Read 1158728 spots for SRR3207916.sra Written 1158728 spots for SRR3207916.sra Read 1158728 spots for SRR3207916.sra Written 1158728 spots for SRR3207916.sra Read 1158728 spots for SRR3207916.sra Written 1158728 spots for SRR3207916.sra Read 1158728 spots for SRR3207916.sra Written 1158728 spots for SRR3207916.sra Read 1158728 spots for SRR3207916.sra Written 1158728 spots for SRR3207916.sra Read 1158728 spots for SRR3207916.sra Written 1158728 spots for SRR3207916.sra Read 1158728 spots for SRR3207916.sra Written 1158728 spots for SRR3207916.sra Read 1158728 spots for SRR3207916.sra Written 1158728 spots for SRR3207916.sra Read 1158728 spots for SRR3207916.sra Written 1158728 spots for SRR3207916.sra Read 1158728 spots for SRR3207916.sra Written 1158728 spots for SRR3207916.sra Read 1158728 spots for SRR3207916.sra Written 1158728 spots for SRR3207916.sra Read 1158728 spots for SRR3207916.sra Written 1158728 spots for SRR3207916.sra Read 1158728 spots for SRR3207916.sra Written 1158728 spots for SRR3207916.sra Read 1158728 spots for SRR3207916.sra Written 1158728 spots for SRR3207916.sra Read 1158728 spots for SRR3207916.sra Written 1158728 spots for SRR3207916.sra Read 1158731 spots for SRR3207916.sra Written 1158731 spots for SRR3207916.sra Read 1158728 spots for SRR3207916.sra Written 1158728 spots for SRR3207916.sra Read 1158728 spots for SRR3207916.sra Written 1158728 spots for SRR3207916.sra Read 1158728 spots for SRR3207916.sra Written 1158728 spots for SRR3207916.sra SRR ids: ['SRR3207916.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wappeyhc SRR3207916.sra spots: 23174563 blocks: [[1, 1158728], [1158729, 2317456], [2317457, 3476184], [3476185, 4634912], [4634913, 5793640], [5793641, 6952368], [6952369, 8111096], [8111097, 9269824], [9269825, 10428552], [10428553, 11587280], [11587281, 12746008], [12746009, 13904736], [13904737, 15063464], [15063465, 16222192], [16222193, 17380920], [17380921, 18539648], [18539649, 19698376], [19698377, 20857104], [20857105, 22015832], [22015833, 23174563]] SRR3207916 file size 6020100 SRR3207916 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207916 SRR3207916_1.fastq Input file: SRR3207916_1.fastq trimmed: SRR3207916-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 14:21:39 2025 >> started Tue Feb 11 14:21:55 2025 >> done (15.842s) 23174563 reads processed; of these: 4042 ( 0.02%) short reads filtered out after trimming by size control 69298 ( 0.30%) empty reads filtered out after trimming by size control 23101223 (99.68%) reads available; of these: 2076415 ( 8.99%) trimmed reads available after processing 21024808 (91.01%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 772 0.00% 19 995 0.00% 20 1207 0.01% 21 1527 0.01% 22 2013 0.01% 23 2875 0.01% 24 3598 0.02% 25 4886 0.02% 26 4712 0.02% 27 4756 0.02% 28 4824 0.02% 29 4897 0.02% 30 4836 0.02% 31 4751 0.02% 32 4759 0.02% 33 4944 0.02% 34 5243 0.02% 35 5693 0.02% 36 5895 0.03% 37 6085 0.03% 38 6657 0.03% 39 7094 0.03% 40 7335 0.03% 41 7678 0.03% 42 7995 0.03% 43 8533 0.04% 44 9137 0.04% 45 9168 0.04% 46 9837 0.04% 47 10016 0.04% 48 10544 0.05% 49 11068 0.05% 50 12072 0.05% 51 12552 0.05% 52 12832 0.06% 53 13470 0.06% 54 14426 0.06% 55 15026 0.07% 56 15672 0.07% 57 16077 0.07% 58 17070 0.07% 59 16684 0.07% 60 16742 0.07% 61 17216 0.07% 62 16946 0.07% 63 17442 0.08% 64 17088 0.07% 65 17439 0.08% 66 17895 0.08% 67 18002 0.08% 68 18807 0.08% 69 18781 0.08% 70 19424 0.08% 71 19907 0.09% 72 20472 0.09% 73 20831 0.09% 74 21034 0.09% 75 20698 0.09% 76 15308 0.07% 77 17077 0.07% 78 19416 0.08% 79 21935 0.09% 80 23434 0.10% 81 25678 0.11% 82 28502 0.12% 83 30711 0.13% 84 31432 0.14% 85 34491 0.15% 86 35731 0.15% 87 38655 0.17% 88 41292 0.18% 89 45908 0.20% 90 51000 0.22% 91 57844 0.25% 92 63659 0.28% 93 72908 0.32% 94 84194 0.36% 95 102025 0.44% 96 128060 0.55% 97 145434 0.63% 98 168032 0.73% 99 164754 0.71% 100 21024808 91.01% 23101223 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=1.45 fanout-score-rank=41 prefix-density=0.03 prefix-fanout=1.5 sequence=TCGTATGCCGTCTTCTGCTTGAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=12 fanout-score=247.92 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=27.7 sequence=TTCTTCTTCTTTT Started job on | Feb 11 14:22:15 Started mapping on | Feb 11 14:22:15 Finished on | Feb 11 14:22:55 Mapping speed, Million of reads per hour | 2079.11 Number of input reads | 23101223 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 20839128 Uniquely mapped reads % | 90.21% Average mapped length | 98.11 Number of splices: Total | 5467041 Number of splices: Annotated (sjdb) | 5348817 Number of splices: GT/AG | 5378407 Number of splices: GC/AG | 69878 Number of splices: AT/AC | 6919 Number of splices: Non-canonical | 11837 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 1.96 Insertion rate per base | 0.02% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 611531 % of reads mapped to multiple loci | 2.65% Number of reads mapped to too many loci | 326240 % of reads mapped to too many loci | 1.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.72% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1650564 1650564 1650564 N_multimapping 611531 611531 611531 N_noFeature 1044812 10871731 10863047 N_ambiguous 233207 42217 42153 UnstrandedReadsAssigned:19561109 PositiveStrandReadsAssigned:9925180 NegativeStrandReadsAssigned:9933928 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207916 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207916-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,101,223 reads, 20,360,581 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,273 rounds 52401 SRR3207916.ke.tsv 34699 SRR3207916.se.tsv 87100 total ==> SRR3207916.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2750 98.8693 Potri.005G024800.1.v4.1 1035 936 1598 117.789 Potri.004G059700.1.v4.1 961 862 145 11.6055 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 553.087 13.4174 Potri.016G087400.1.v4.1 270 171 790 318.739 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 80 3.29715 Potri.012G127500.1.v4.1 977 878 2101 165.096 ==> SRR3207916.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1535 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 265 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 70 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 14 SRR3207916 completed mapping pipeline successfully