Starting /dee2/code/volunteer_pipeline.sh SRR3207917 current disk space = 3050272251904 free memory = 1444477272 SRR3207917 SRAfilesize 4a120912f3e5d77f49deb3a68195a723 SRR3207917.sra SRR3207917.sra file validated SRR3207917 is single end SRR3207917 is conventional basespace SRR3207917 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207917_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.04275 34.0 33.0 34.0 31.0 34.0 2 33.3055 34.0 34.0 34.0 31.0 34.0 3 33.4455 34.0 34.0 34.0 31.0 34.0 4 36.6625 37.0 37.0 37.0 35.0 37.0 5 36.59925 37.0 37.0 37.0 35.0 37.0 6 36.53375 37.0 37.0 37.0 35.0 37.0 7 36.59125 37.0 37.0 37.0 35.0 37.0 8 36.607 37.0 37.0 37.0 35.0 37.0 9 38.47975 39.0 39.0 39.0 37.0 39.0 10-11 38.468875 39.0 39.0 39.0 37.0 39.0 12-13 38.430125000000004 39.0 39.0 39.0 37.0 39.0 14-15 40.067625 41.0 40.0 41.0 38.0 41.0 16-17 40.031375 41.0 40.0 41.0 38.0 41.0 18-19 39.92375 41.0 40.0 41.0 38.0 41.0 20-21 39.94325 41.0 40.0 41.0 38.0 41.0 22-23 39.870625000000004 41.0 40.0 41.0 38.0 41.0 24-25 39.817750000000004 41.0 40.0 41.0 38.0 41.0 26-27 39.61525 41.0 40.0 41.0 37.5 41.0 28-29 39.420625 41.0 40.0 41.0 37.0 41.0 30-31 39.326125 41.0 39.5 41.0 36.5 41.0 32-33 39.514250000000004 41.0 40.0 41.0 37.0 41.0 34-35 39.598 41.0 40.0 41.0 37.5 41.0 36-37 39.522125 41.0 40.0 41.0 37.0 41.0 38-39 39.298500000000004 41.0 40.0 41.0 36.5 41.0 40-41 39.290375 41.0 40.0 41.0 37.0 41.0 42-43 39.278375 41.0 40.0 41.0 37.0 41.0 44-45 39.2085 41.0 39.0 41.0 36.5 41.0 46-47 39.11525 41.0 39.0 41.0 36.0 41.0 48-49 39.054375 41.0 39.0 41.0 35.5 41.0 50-51 38.95125 41.0 39.0 41.0 35.0 41.0 52-53 38.717749999999995 40.5 39.0 41.0 35.0 41.0 54-55 38.605000000000004 40.0 39.0 41.0 35.0 41.0 56-57 38.501 40.0 38.5 41.0 35.0 41.0 58-59 38.227625 40.0 38.0 41.0 34.5 41.0 60-61 37.63875 40.0 37.0 41.0 33.5 41.0 62-63 37.395624999999995 39.5 36.5 41.0 33.0 41.0 64-65 37.167375 39.0 36.0 41.0 33.0 41.0 66-67 36.867 39.0 36.0 40.5 32.5 41.0 68-69 36.638875 38.0 35.5 40.0 33.0 41.0 70-71 36.147499999999994 37.0 35.0 39.5 32.0 41.0 72-73 35.750249999999994 37.0 35.0 39.0 32.0 41.0 74-75 35.224625 36.0 35.0 39.0 31.0 40.0 76-77 33.991 35.0 33.5 37.0 29.5 39.0 78-79 34.311875 35.0 34.0 37.0 30.5 39.0 80-81 34.048500000000004 35.0 34.0 37.0 30.5 38.5 82-83 33.93775 35.0 34.0 36.0 31.0 37.0 84-85 33.59925 35.0 34.0 36.0 31.0 37.0 86-87 33.39075 35.0 34.0 35.5 30.5 36.5 88-89 33.16225 35.0 34.0 35.0 30.0 36.0 90-91 33.0315 35.0 34.0 35.0 30.0 36.0 92-93 32.842625 35.0 34.0 35.0 30.0 36.0 94-95 32.677875 35.0 34.0 35.0 29.5 35.5 96-97 32.303 35.0 33.5 35.0 29.0 35.0 98-99 32.076875 35.0 33.0 35.0 29.0 35.0 100 31.8655 35.0 33.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 3.0 9 2.0 10 4.0 11 2.0 12 5.0 13 6.0 14 6.0 15 7.0 16 2.0 17 3.0 18 8.0 19 4.0 20 4.0 21 9.0 22 11.0 23 11.0 24 4.0 25 6.0 26 15.0 27 23.0 28 17.0 29 25.0 30 28.0 31 44.0 32 53.0 33 76.0 34 85.0 35 164.0 36 290.0 37 908.0 38 1777.0 39 396.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.560926485397786 15.433031218529708 15.483383685800604 42.522658610271904 2 19.125 24.375 36.475 20.025000000000002 3 21.98599299649825 26.738369184592298 27.5887943971986 23.686843421710854 4 23.175 32.375 21.525 22.925 5 23.625 34.125 23.325000000000003 18.925 6 18.35 37.025000000000006 26.200000000000003 18.425 7 16.1 19.0 44.15 20.75 8 20.125 22.35 30.375000000000004 27.150000000000002 9 19.05 24.325 33.125 23.5 10-11 22.175 33.425 23.1625 21.2375 12-13 20.2625 26.4625 29.9375 23.3375 14-15 21.0125 26.8125 29.3875 22.787499999999998 16-17 21.625 27.3 27.950000000000003 23.125 18-19 21.9625 28.1375 27.9125 21.987499999999997 20-21 21.912499999999998 28.475 28.037499999999998 21.575 22-23 20.4375 29.037499999999998 28.3625 22.162499999999998 24-25 21.325 28.525 27.950000000000003 22.2 26-27 20.5125 29.512500000000003 27.762500000000003 22.2125 28-29 21.825 27.950000000000003 27.8125 22.412499999999998 30-31 21.975 28.6125 27.962500000000002 21.45 32-33 22.45 28.5625 28.199999999999996 20.7875 34-35 21.2875 28.775000000000002 27.775 22.162499999999998 36-37 21.5375 27.275 28.725 22.4625 38-39 22.1 28.4 27.425 22.075 40-41 22.400000000000002 28.1 27.525 21.975 42-43 21.2875 30.4 27.3375 20.974999999999998 44-45 21.3625 28.275 28.625 21.7375 46-47 21.987499999999997 27.987499999999997 28.1875 21.837500000000002 48-49 21.912499999999998 27.962500000000002 27.712500000000002 22.412499999999998 50-51 21.68584292146073 28.68934467233617 27.51375687843922 22.11105552776388 52-53 21.844113599399474 28.43738270987114 27.549105467283873 22.169398223445516 54-55 21.45 27.975 28.425 22.15 56-57 21.9625 28.349999999999998 28.037499999999998 21.65 58-59 21.712500000000002 28.4375 28.4375 21.4125 60-61 21.975 28.4 28.262500000000003 21.3625 62-63 21.55 28.8375 27.962500000000002 21.65 64-65 21.7875 29.375 27.8625 20.974999999999998 66-67 21.987499999999997 28.537499999999998 27.500000000000004 21.975 68-69 21.1625 29.462500000000002 28.4375 20.9375 70-71 21.912499999999998 27.950000000000003 28.275 21.8625 72-73 21.55 28.1375 28.5625 21.75 74-75 21.587500000000002 28.325 28.262500000000003 21.825 76-77 21.637500000000003 28.275 28.212500000000002 21.875 78-79 21.575 28.325 28.975 21.125 80-81 22.25 27.6 28.349999999999998 21.8 82-83 21.1375 28.3875 28.375 22.1 84-85 22.0875 28.4125 28.15 21.349999999999998 86-87 21.275 29.225 27.950000000000003 21.55 88-89 22.495935975990996 28.973365011879455 28.060522696011002 20.470176316118543 90-91 22.066549912434326 27.983487615711784 28.05854390793095 21.891418563922944 92-93 21.28298111791922 28.573214955608357 28.585719644866824 21.558084281605602 94-95 22.1375 27.85 28.287499999999998 21.725 96-97 21.4 29.375 27.787499999999998 21.4375 98-99 22.402800350043755 27.528441055131893 28.716089511188898 21.352669083635455 100 21.080270067516878 28.232058014503625 28.532133033258315 22.155538884721178 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 0.5 20 1.5 21 4.5 22 4.0 23 6.0 24 7.0 25 5.0 26 7.5 27 10.0 28 12.5 29 21.5 30 33.5 31 38.5 32 50.5 33 62.0 34 75.0 35 87.0 36 95.0 37 110.5 38 133.0 39 162.5 40 193.0 41 220.0 42 238.5 43 241.0 44 250.0 45 257.0 46 242.5 47 233.5 48 209.5 49 175.0 50 165.0 51 136.5 52 102.5 53 94.5 54 75.0 55 51.0 56 34.0 57 28.0 58 27.5 59 22.5 60 19.0 61 14.5 62 7.0 63 4.5 64 3.5 65 5.5 66 5.0 67 2.0 68 2.5 69 1.5 70 1.5 71 2.5 72 2.0 73 0.5 74 0.5 75 0.5 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7000000000000001 2 0.0 3 0.05 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.05 52-53 0.08750000000000001 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0375 90-91 0.075 92-93 0.0375 94-95 0.0 96-97 0.0 98-99 0.0125 100 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79954898521673 99.575 2 0.17539463793535454 0.35000000000000003 3 0.025056376847907794 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.0625 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88 0.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1265326 spots for SRR3207917.sra Written 1265326 spots for SRR3207917.sra Read 1265326 spots for SRR3207917.sra Written 1265326 spots for SRR3207917.sra Read 1265326 spots for SRR3207917.sra Written 1265326 spots for SRR3207917.sra Read 1265326 spots for SRR3207917.sra Written 1265326 spots for SRR3207917.sra Read 1265326 spots for SRR3207917.sra Written 1265326 spots for SRR3207917.sra Read 1265326 spots for SRR3207917.sra Written 1265326 spots for SRR3207917.sra Read 1265326 spots for SRR3207917.sra Written 1265326 spots for SRR3207917.sra Read 1265326 spots for SRR3207917.sra Written 1265326 spots for SRR3207917.sra Read 1265326 spots for SRR3207917.sra Written 1265326 spots for SRR3207917.sra Read 1265326 spots for SRR3207917.sra Written 1265326 spots for SRR3207917.sra Read 1265326 spots for SRR3207917.sra Written 1265326 spots for SRR3207917.sra Read 1265326 spots for SRR3207917.sra Written 1265326 spots for SRR3207917.sra Read 1265326 spots for SRR3207917.sra Written 1265326 spots for SRR3207917.sra Read 1265326 spots for SRR3207917.sra Written 1265326 spots for SRR3207917.sra Read 1265330 spots for SRR3207917.sra Written 1265330 spots for SRR3207917.sra Read 1265326 spots for SRR3207917.sra Written 1265326 spots for SRR3207917.sra Read 1265326 spots for SRR3207917.sra Written 1265326 spots for SRR3207917.sra Read 1265326 spots for SRR3207917.sra Written 1265326 spots for SRR3207917.sra Read 1265326 spots for SRR3207917.sra Written 1265326 spots for SRR3207917.sra Read 1265326 spots for SRR3207917.sra Written 1265326 spots for SRR3207917.sra SRR ids: ['SRR3207917.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_b_j9ou6g SRR3207917.sra spots: 25306524 blocks: [[1, 1265326], [1265327, 2530652], [2530653, 3795978], [3795979, 5061304], [5061305, 6326630], [6326631, 7591956], [7591957, 8857282], [8857283, 10122608], [10122609, 11387934], [11387935, 12653260], [12653261, 13918586], [13918587, 15183912], [15183913, 16449238], [16449239, 17714564], [17714565, 18979890], [18979891, 20245216], [20245217, 21510542], [21510543, 22775868], [22775869, 24041194], [24041195, 25306524]] SRR3207917 file size 6574939 SRR3207917 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207917 SRR3207917_1.fastq Input file: SRR3207917_1.fastq trimmed: SRR3207917-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 14:27:26 2025 >> started Tue Feb 11 14:27:39 2025 >> done (12.900s) 25306524 reads processed; of these: 5330 ( 0.02%) short reads filtered out after trimming by size control 38105 ( 0.15%) empty reads filtered out after trimming by size control 25263089 (99.83%) reads available; of these: 2067888 ( 8.19%) trimmed reads available after processing 23195201 (91.81%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 971 0.00% 19 1155 0.00% 20 1461 0.01% 21 1776 0.01% 22 2433 0.01% 23 3316 0.01% 24 4073 0.02% 25 5488 0.02% 26 5343 0.02% 27 5211 0.02% 28 5369 0.02% 29 5305 0.02% 30 5219 0.02% 31 5144 0.02% 32 5379 0.02% 33 5533 0.02% 34 5984 0.02% 35 6203 0.02% 36 6383 0.03% 37 6659 0.03% 38 7136 0.03% 39 7526 0.03% 40 7883 0.03% 41 7975 0.03% 42 8726 0.03% 43 8995 0.04% 44 9681 0.04% 45 9902 0.04% 46 10221 0.04% 47 10662 0.04% 48 10990 0.04% 49 11421 0.05% 50 12508 0.05% 51 12834 0.05% 52 13140 0.05% 53 13963 0.06% 54 14629 0.06% 55 15267 0.06% 56 15847 0.06% 57 16399 0.06% 58 17106 0.07% 59 17286 0.07% 60 17416 0.07% 61 17283 0.07% 62 17181 0.07% 63 17588 0.07% 64 17156 0.07% 65 17595 0.07% 66 17980 0.07% 67 18134 0.07% 68 18791 0.07% 69 18507 0.07% 70 18995 0.08% 71 19509 0.08% 72 19999 0.08% 73 20215 0.08% 74 20849 0.08% 75 20743 0.08% 76 14939 0.06% 77 16944 0.07% 78 19325 0.08% 79 21634 0.09% 80 22876 0.09% 81 25480 0.10% 82 27956 0.11% 83 30071 0.12% 84 30655 0.12% 85 33806 0.13% 86 35278 0.14% 87 38068 0.15% 88 40985 0.16% 89 44567 0.18% 90 49573 0.20% 91 56161 0.22% 92 61971 0.25% 93 70639 0.28% 94 82557 0.33% 95 100251 0.40% 96 125679 0.50% 97 142561 0.56% 98 165828 0.66% 99 163641 0.65% 100 23195201 91.81% 25263089 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=10.47 fanout-score-rank=12 prefix-density=0.07 prefix-fanout=10.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAAT criterion=fanout-score sequence-density=0.04 sequence-density-rank=18 fanout-score=266.12 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=27.4 sequence=TTCTTCTTCTTT Started job on | Feb 11 14:28:06 Started mapping on | Feb 11 14:28:06 Finished on | Feb 11 14:28:52 Mapping speed, Million of reads per hour | 1977.11 Number of input reads | 25263089 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 22285324 Uniquely mapped reads % | 88.21% Average mapped length | 98.19 Number of splices: Total | 6030156 Number of splices: Annotated (sjdb) | 5901659 Number of splices: GT/AG | 5932037 Number of splices: GC/AG | 78096 Number of splices: AT/AC | 7372 Number of splices: Non-canonical | 12651 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 1.96 Insertion rate per base | 0.01% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 590231 % of reads mapped to multiple loci | 2.34% Number of reads mapped to too many loci | 235312 % of reads mapped to too many loci | 0.93% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.51% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2387534 2387534 2387534 N_multimapping 590231 590231 590231 N_noFeature 1096954 11623327 11592128 N_ambiguous 248712 40931 41325 UnstrandedReadsAssigned:20939658 PositiveStrandReadsAssigned:10621066 NegativeStrandReadsAssigned:10651871 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207917 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207917-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,263,089 reads, 21,650,368 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,254 rounds 52401 SRR3207917.ke.tsv 34699 SRR3207917.se.tsv 87100 total ==> SRR3207917.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1279 43.3384 Potri.005G024800.1.v4.1 1035 936 554 38.4868 Potri.004G059700.1.v4.1 961 862 89 6.71368 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 500.968 11.454 Potri.016G087400.1.v4.1 270 171 847 322.081 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 87 3.37941 Potri.012G127500.1.v4.1 977 878 3834 283.946 ==> SRR3207917.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1889 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 333 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 87 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 4 SRR3207917 completed mapping pipeline successfully