Starting /dee2/code/volunteer_pipeline.sh SRR3207918 current disk space = 3049892859904 free memory = 1489021832 SRR3207918 SRAfilesize c10e860640eee840e97a25c66fb9763c SRR3207918.sra SRR3207918.sra file validated SRR3207918 is single end SRR3207918 is conventional basespace SRR3207918 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207918_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.83225 34.0 31.0 34.0 31.0 34.0 2 32.99175 34.0 33.0 34.0 31.0 34.0 3 33.179 34.0 34.0 34.0 31.0 34.0 4 36.42075 37.0 37.0 37.0 35.0 37.0 5 36.4535 37.0 37.0 37.0 35.0 37.0 6 36.41825 37.0 37.0 37.0 35.0 37.0 7 36.48025 37.0 37.0 37.0 35.0 37.0 8 36.465 37.0 37.0 37.0 35.0 37.0 9 38.30875 39.0 39.0 39.0 37.0 39.0 10-11 38.25212500000001 39.0 39.0 39.0 37.0 39.0 12-13 38.03 39.0 38.5 39.0 36.0 39.0 14-15 39.5745 41.0 40.0 41.0 37.0 41.0 16-17 39.509625 41.0 40.0 41.0 36.5 41.0 18-19 39.63225 41.0 40.0 41.0 37.0 41.0 20-21 39.668499999999995 41.0 40.0 41.0 37.0 41.0 22-23 39.612750000000005 41.0 40.0 41.0 37.0 41.0 24-25 39.1565 41.0 39.0 41.0 35.5 41.0 26-27 38.943375 41.0 39.0 41.0 35.0 41.0 28-29 39.060874999999996 41.0 39.0 41.0 35.5 41.0 30-31 38.91975 40.5 39.0 41.0 35.0 41.0 32-33 39.251999999999995 41.0 39.0 41.0 36.0 41.0 34-35 39.177625 41.0 39.0 41.0 36.0 41.0 36-37 39.083375000000004 41.0 39.5 41.0 35.5 41.0 38-39 38.952 41.0 39.0 41.0 35.0 41.0 40-41 38.5405 40.0 38.5 41.0 34.0 41.0 42-43 38.807 40.0 39.0 41.0 35.0 41.0 44-45 38.515375 40.0 38.5 41.0 34.0 41.0 46-47 38.483625 40.0 38.0 41.0 34.5 41.0 48-49 38.446375 40.0 38.0 41.0 34.5 41.0 50-51 38.235 40.0 38.0 41.0 33.5 41.0 52-53 38.280249999999995 40.0 38.0 41.0 34.0 41.0 54-55 38.178 40.0 38.0 41.0 34.0 41.0 56-57 37.708 40.0 37.0 41.0 33.0 41.0 58-59 37.596375 40.0 37.0 41.0 32.5 41.0 60-61 37.249125 39.5 36.5 41.0 32.0 41.0 62-63 37.009125 39.0 36.0 41.0 32.0 41.0 64-65 36.733125 39.0 35.5 40.5 32.0 41.0 66-67 35.95125 38.0 35.0 40.0 30.0 41.0 68-69 35.964125 37.5 35.0 40.0 31.0 41.0 70-71 35.41875 37.0 35.0 39.0 30.5 41.0 72-73 35.10325 36.5 35.0 39.0 30.5 40.0 74-75 34.678250000000006 36.0 34.0 38.5 30.0 39.5 76-77 33.481125 35.0 33.0 36.5 29.0 39.0 78-79 34.019125 35.0 34.0 37.0 30.0 39.0 80-81 33.905875 35.0 34.0 36.5 31.0 38.0 82-83 33.507374999999996 35.0 34.0 36.0 30.0 37.0 84-85 33.220125 35.0 34.0 36.0 30.0 37.0 86-87 32.693124999999995 35.0 34.0 35.0 29.0 36.0 88-89 32.526250000000005 35.0 34.0 35.0 28.0 36.0 90-91 32.200125 35.0 33.5 35.0 27.5 36.0 92-93 32.058625 35.0 33.0 35.0 27.0 35.5 94-95 31.9435 35.0 33.0 35.0 27.0 35.0 96-97 31.634875 35.0 33.0 35.0 26.0 35.0 98-99 31.459375 35.0 33.0 35.0 25.0 35.0 100 31.31575 35.0 33.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 2.0 9 1.0 10 3.0 11 5.0 12 5.0 13 4.0 14 13.0 15 11.0 16 12.0 17 5.0 18 8.0 19 8.0 20 6.0 21 10.0 22 9.0 23 14.0 24 12.0 25 13.0 26 22.0 27 23.0 28 35.0 29 22.0 30 44.0 31 61.0 32 61.0 33 84.0 34 139.0 35 220.0 36 364.0 37 871.0 38 1647.0 39 265.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.525 14.6 14.625 43.25 2 20.474999999999998 20.4 37.2 21.925 3 23.05 24.7 25.174999999999997 27.075 4 24.15 30.599999999999998 20.825 24.425 5 25.074999999999996 33.925 22.55 18.45 6 20.8 36.449999999999996 24.025 18.725 7 17.299999999999997 20.45 41.699999999999996 20.549999999999997 8 19.35 23.674999999999997 32.45 24.525 9 19.900000000000002 22.25 33.825 24.025 10-11 22.3875 32.85 24.025 20.7375 12-13 20.9375 27.650000000000002 28.537499999999998 22.875 14-15 20.963704630788484 28.448060075093867 28.64831038798498 21.939924906132667 16-17 22.25 27.725 27.425 22.6 18-19 21.8 27.35 28.449999999999996 22.400000000000002 20-21 21.9625 27.987499999999997 28.3875 21.6625 22-23 22.1875 28.8875 26.6625 22.2625 24-25 21.6875 28.6625 27.3 22.35 26-27 22.537499999999998 28.575 26.8 22.0875 28-29 22.237499999999997 28.249999999999996 28.287499999999998 21.224999999999998 30-31 21.85 28.0625 27.400000000000002 22.6875 32-33 21.5 28.225 28.249999999999996 22.025 34-35 21.1375 28.1875 28.512500000000003 22.162499999999998 36-37 21.625 27.5875 28.65 22.1375 38-39 21.8875 28.4 27.150000000000002 22.5625 40-41 21.3875 28.775000000000002 27.3 22.537499999999998 42-43 21.675 27.6125 28.287499999999998 22.425 44-45 22.1375 28.037499999999998 27.3375 22.4875 46-47 21.425 28.15 27.975 22.45 48-49 21.3875 28.212500000000002 27.975 22.425 50-51 22.1 27.725 27.625 22.55 52-53 21.605401350337583 28.832208052013 27.28182045511378 22.280570142535634 54-55 22.3 28.4375 26.525 22.7375 56-57 21.712500000000002 28.225 28.225 21.837500000000002 58-59 22.0625 28.462500000000002 27.375 22.1 60-61 21.7875 28.6625 27.3375 22.2125 62-63 22.2625 28.512500000000003 27.1375 22.0875 64-65 21.3625 28.95 27.8875 21.8 66-67 22.225 28.825 26.85 22.1 68-69 22.400000000000002 28.537499999999998 27.287499999999998 21.775 70-71 21.95 28.3125 28.249999999999996 21.4875 72-73 21.425 28.249999999999996 28.487499999999997 21.837500000000002 74-75 21.587500000000002 28.775000000000002 27.712500000000002 21.925 76-77 21.75 28.9125 27.625 21.712500000000002 78-79 21.337500000000002 28.775000000000002 26.787499999999998 23.1 80-81 21.75 28.65 27.825 21.775 82-83 22.237499999999997 26.737499999999997 28.6125 22.412499999999998 84-85 21.7375 27.725 28.487499999999997 22.05 86-87 20.974999999999998 27.212500000000002 28.499999999999996 23.3125 88-89 21.3625 27.474999999999998 28.1625 23.0 90-91 22.3 29.1125 27.250000000000004 21.337500000000002 92-93 22.375 27.6 27.6125 22.412499999999998 94-95 21.4375 27.700000000000003 28.6875 22.175 96-97 22.287499999999998 28.849999999999998 27.05 21.8125 98-99 22.8875 28.499999999999996 27.237499999999997 21.375 100 23.125 27.55 27.325 22.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.5 19 1.0 20 1.0 21 1.0 22 0.0 23 0.5 24 2.5 25 3.5 26 6.0 27 8.5 28 8.0 29 9.5 30 16.5 31 24.0 32 30.5 33 39.5 34 46.5 35 63.5 36 90.5 37 117.0 38 133.0 39 168.5 40 206.0 41 228.5 42 250.5 43 254.5 44 246.5 45 245.0 46 262.0 47 265.5 48 238.0 49 203.5 50 161.0 51 130.0 52 120.5 53 94.5 54 70.0 55 55.0 56 44.0 57 37.0 58 24.0 59 13.0 60 13.5 61 15.5 62 14.5 63 11.5 64 6.5 65 4.0 66 2.0 67 2.0 68 1.5 69 1.0 70 1.0 71 0.0 72 0.0 73 0.5 74 1.0 75 1.0 76 0.5 77 0.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.125 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.025 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8246492985972 99.625 2 0.15030060120240482 0.3 3 0.0250501002004008 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.037500000000000006 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.0625 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.0875 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88 0.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 4326619 spots for SRR3207918.sra Written 4326619 spots for SRR3207918.sra Read 4326619 spots for SRR3207918.sra Written 4326619 spots for SRR3207918.sra Read 4326619 spots for SRR3207918.sra Written 4326619 spots for SRR3207918.sra Read 4326619 spots for SRR3207918.sra Written 4326619 spots for SRR3207918.sra Read 4326619 spots for SRR3207918.sra Written 4326619 spots for SRR3207918.sra Read 4326619 spots for SRR3207918.sra Written 4326619 spots for SRR3207918.sra Read 4326619 spots for SRR3207918.sra Written 4326619 spots for SRR3207918.sra Read 4326619 spots for SRR3207918.sra Written 4326619 spots for SRR3207918.sra Read 4326619 spots for SRR3207918.sra Written 4326619 spots for SRR3207918.sra Read 4326619 spots for SRR3207918.sra Written 4326619 spots for SRR3207918.sra Read 4326619 spots for SRR3207918.sra Written 4326619 spots for SRR3207918.sra Read 4326619 spots for SRR3207918.sra Written 4326619 spots for SRR3207918.sra Read 4326619 spots for SRR3207918.sra Written 4326619 spots for SRR3207918.sra Read 4326619 spots for SRR3207918.sra Written 4326619 spots for SRR3207918.sra Read 4326619 spots for SRR3207918.sra Written 4326619 spots for SRR3207918.sra Read 4326619 spots for SRR3207918.sra Written 4326619 spots for SRR3207918.sra Read 4326619 spots for SRR3207918.sra Written 4326619 spots for SRR3207918.sra Read 4326629 spots for SRR3207918.sra Written 4326629 spots for SRR3207918.sra Read 4326619 spots for SRR3207918.sra Written 4326619 spots for SRR3207918.sra Read 4326619 spots for SRR3207918.sra Written 4326619 spots for SRR3207918.sra SRR ids: ['SRR3207918.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e1t4ncy0 SRR3207918.sra spots: 86532390 blocks: [[1, 4326619], [4326620, 8653238], [8653239, 12979857], [12979858, 17306476], [17306477, 21633095], [21633096, 25959714], [25959715, 30286333], [30286334, 34612952], [34612953, 38939571], [38939572, 43266190], [43266191, 47592809], [47592810, 51919428], [51919429, 56246047], [56246048, 60572666], [60572667, 64899285], [64899286, 69225904], [69225905, 73552523], [73552524, 77879142], [77879143, 82205761], [82205762, 86532390]] SRR3207918 file size 22508456 SRR3207918 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207918 SRR3207918_1.fastq Input file: SRR3207918_1.fastq trimmed: SRR3207918-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 14:51:00 2025 >> started Tue Feb 11 14:51:39 2025 >> done (39.131s) 86532390 reads processed; of these: 29848 ( 0.03%) short reads filtered out after trimming by size control 93832 ( 0.11%) empty reads filtered out after trimming by size control 86408710 (99.86%) reads available; of these: 7389892 ( 8.55%) trimmed reads available after processing 79018818 (91.45%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 4550 0.01% 19 4988 0.01% 20 6158 0.01% 21 7637 0.01% 22 9543 0.01% 23 11624 0.01% 24 14786 0.02% 25 19242 0.02% 26 18477 0.02% 27 17987 0.02% 28 18340 0.02% 29 18231 0.02% 30 18783 0.02% 31 18594 0.02% 32 19043 0.02% 33 19668 0.02% 34 21190 0.02% 35 21597 0.02% 36 22876 0.03% 37 24220 0.03% 38 25224 0.03% 39 26129 0.03% 40 28154 0.03% 41 28554 0.03% 42 30321 0.04% 43 31804 0.04% 44 33597 0.04% 45 34480 0.04% 46 35919 0.04% 47 37692 0.04% 48 39496 0.05% 49 42086 0.05% 50 44016 0.05% 51 45348 0.05% 52 46872 0.05% 53 49603 0.06% 54 53557 0.06% 55 56459 0.07% 56 57537 0.07% 57 58689 0.07% 58 61034 0.07% 59 60618 0.07% 60 62631 0.07% 61 63047 0.07% 62 63573 0.07% 63 63942 0.07% 64 64384 0.07% 65 65999 0.08% 66 66168 0.08% 67 67356 0.08% 68 69317 0.08% 69 67371 0.08% 70 68678 0.08% 71 70498 0.08% 72 73233 0.08% 73 74145 0.09% 74 75835 0.09% 75 73979 0.09% 76 53591 0.06% 77 61662 0.07% 78 69335 0.08% 79 77504 0.09% 80 83943 0.10% 81 90163 0.10% 82 98766 0.11% 83 105595 0.12% 84 110831 0.13% 85 120130 0.14% 86 128652 0.15% 87 138737 0.16% 88 147822 0.17% 89 160322 0.19% 90 177210 0.21% 91 204443 0.24% 92 235469 0.27% 93 260759 0.30% 94 304775 0.35% 95 359668 0.42% 96 417473 0.48% 97 497241 0.58% 98 580755 0.67% 99 570167 0.66% 100 79018818 91.45% 86408710 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=48.51 fanout-score-rank=7 prefix-density=0.48 prefix-fanout=35.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGT criterion=fanout-score sequence-density=0.05 sequence-density-rank=7 fanout-score=210.36 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=24.7 sequence=AAGAAGAAGAAA Started job on | Feb 11 14:52:03 Started mapping on | Feb 11 14:52:04 Finished on | Feb 11 14:53:29 Mapping speed, Million of reads per hour | 3659.66 Number of input reads | 86408710 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 81220616 Uniquely mapped reads % | 94.00% Average mapped length | 98.12 Number of splices: Total | 22259785 Number of splices: Annotated (sjdb) | 21807295 Number of splices: GT/AG | 21909300 Number of splices: GC/AG | 286688 Number of splices: AT/AC | 24768 Number of splices: Non-canonical | 39029 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 2.01 Insertion rate per base | 0.01% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2044709 % of reads mapped to multiple loci | 2.37% Number of reads mapped to too many loci | 2054776 % of reads mapped to too many loci | 2.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.25% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3143385 3143385 3143385 N_multimapping 2044709 2044709 2044709 N_noFeature 3345583 41819415 42087259 N_ambiguous 966675 153583 155153 UnstrandedReadsAssigned:76908358 PositiveStrandReadsAssigned:39247618 NegativeStrandReadsAssigned:38978204 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207918 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207918-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 86,408,710 reads, 80,262,779 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,361 rounds 52401 SRR3207918.ke.tsv 34699 SRR3207918.se.tsv 87100 total ==> SRR3207918.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 5242.15 46.5544 Potri.005G024800.1.v4.1 1035 936 3469.06 63.163 Potri.004G059700.1.v4.1 961 862 214 4.2309 Potri.007G009000.2.v4.1 1416 1317 2 0.0258804 Potri.003G141000.2.v4.1 2943 2844 1539.38 9.22452 Potri.016G087400.1.v4.1 270 171 3519 350.711 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 356.593 3.63031 Potri.012G127500.1.v4.1 977 878 9549 185.349 ==> SRR3207918.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 9048 Potri.001G233950.v4.1 6 Potri.001G122700.v4.1 1538 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 198 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 28 SRR3207918 completed mapping pipeline successfully