Starting /dee2/code/volunteer_pipeline.sh SRR3207919 current disk space = 3049749889024 free memory = 1578909612 SRR3207919 SRAfilesize 5522ac86ab46dfa26182674258dbd01c SRR3207919.sra SRR3207919.sra file validated SRR3207919 is single end SRR3207919 is conventional basespace SRR3207919 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207919_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.917 34.0 31.0 34.0 31.0 34.0 2 33.12075 34.0 33.0 34.0 31.0 34.0 3 33.266 34.0 34.0 34.0 31.0 34.0 4 36.4405 37.0 37.0 37.0 35.0 37.0 5 36.48775 37.0 37.0 37.0 35.0 37.0 6 36.517 37.0 37.0 37.0 35.0 37.0 7 36.481 37.0 37.0 37.0 35.0 37.0 8 36.476 37.0 37.0 37.0 35.0 37.0 9 38.3405 39.0 39.0 39.0 37.0 39.0 10-11 38.205 39.0 39.0 39.0 37.0 39.0 12-13 38.054500000000004 39.0 38.5 39.0 36.0 39.0 14-15 39.71362499999999 41.0 40.0 41.0 37.0 41.0 16-17 39.598124999999996 41.0 40.0 41.0 37.0 41.0 18-19 39.678375 41.0 40.0 41.0 37.0 41.0 20-21 39.691625 41.0 40.0 41.0 37.5 41.0 22-23 39.661500000000004 41.0 40.0 41.0 37.5 41.0 24-25 39.196875 41.0 39.0 41.0 35.5 41.0 26-27 38.92875 40.5 39.0 41.0 35.5 41.0 28-29 39.034 41.0 39.0 41.0 36.0 41.0 30-31 38.953375 40.5 39.0 41.0 36.0 41.0 32-33 39.26575 41.0 39.0 41.0 36.0 41.0 34-35 39.240750000000006 41.0 39.0 41.0 36.0 41.0 36-37 39.125375 41.0 39.0 41.0 35.5 41.0 38-39 38.961875 41.0 39.0 41.0 35.0 41.0 40-41 38.55575 40.0 38.0 41.0 34.0 41.0 42-43 38.816125 40.0 39.0 41.0 35.0 41.0 44-45 38.61025 40.0 38.5 41.0 34.5 41.0 46-47 38.66225 40.0 38.5 41.0 34.5 41.0 48-49 38.681875 40.0 38.5 41.0 35.0 41.0 50-51 38.285624999999996 40.0 38.0 41.0 34.0 41.0 52-53 38.404250000000005 40.0 38.0 41.0 34.0 41.0 54-55 38.29625 40.0 38.0 41.0 34.0 41.0 56-57 37.915375 40.0 37.5 41.0 33.0 41.0 58-59 37.64025 40.0 37.0 41.0 32.5 41.0 60-61 37.25 39.5 36.0 41.0 31.5 41.0 62-63 37.1505 39.0 36.0 41.0 32.0 41.0 64-65 36.9875 39.0 36.0 40.5 32.5 41.0 66-67 36.214375000000004 38.0 35.0 40.0 30.5 41.0 68-69 36.156375 37.5 35.0 40.0 31.0 41.0 70-71 35.66875 37.0 35.0 39.0 31.0 41.0 72-73 35.272875 36.5 34.5 39.0 30.5 40.5 74-75 34.908249999999995 36.0 34.0 38.5 30.0 40.0 76-77 33.73625 35.0 33.0 37.0 29.0 39.0 78-79 34.162625 35.0 34.0 37.0 29.5 39.0 80-81 33.94025 35.0 34.0 36.5 30.0 38.5 82-83 33.5845 35.0 34.0 36.0 30.0 37.0 84-85 33.343625 35.0 34.0 36.0 29.5 37.0 86-87 32.865875 35.0 34.0 35.0 29.0 36.0 88-89 32.56375 35.0 33.0 35.0 29.0 36.0 90-91 32.293375 35.0 33.5 35.0 27.5 36.0 92-93 32.177625 35.0 33.0 35.0 27.0 35.5 94-95 31.902124999999998 35.0 33.0 35.0 27.0 35.0 96-97 31.57225 35.0 32.5 35.0 26.0 35.0 98-99 31.340625000000003 35.0 32.5 35.0 25.0 35.0 100 31.08 34.0 32.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 1.0 7 1.0 8 3.0 9 2.0 10 1.0 11 1.0 12 3.0 13 2.0 14 3.0 15 4.0 16 11.0 17 3.0 18 7.0 19 8.0 20 10.0 21 6.0 22 9.0 23 10.0 24 13.0 25 11.0 26 22.0 27 34.0 28 31.0 29 41.0 30 44.0 31 65.0 32 63.0 33 96.0 34 150.0 35 216.0 36 375.0 37 868.0 38 1561.0 39 324.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.775 15.15 14.424999999999999 43.65 2 19.05 22.575 37.4 20.974999999999998 3 22.15 25.374999999999996 27.650000000000002 24.825 4 23.775 30.375000000000004 20.575 25.275 5 25.324999999999996 34.575 22.75 17.349999999999998 6 18.625 37.7 24.55 19.125 7 16.5 20.349999999999998 43.025000000000006 20.125 8 19.6 23.724999999999998 32.225 24.45 9 20.125 23.175 33.15 23.549999999999997 10-11 22.7 33.6125 23.5 20.1875 12-13 21.85 25.474999999999998 30.175 22.5 14-15 20.205051262815704 28.232058014503625 29.68242060515129 21.880470117529384 16-17 22.075 28.3625 27.85 21.712500000000002 18-19 21.475 27.6 27.775 23.150000000000002 20-21 21.6875 27.825 27.6125 22.875 22-23 21.375 29.912499999999998 27.8375 20.875 24-25 21.9 28.8625 27.2625 21.975 26-27 22.95 28.237499999999997 26.8625 21.95 28-29 21.2375 28.275 28.225 22.2625 30-31 22.162499999999998 28.6375 27.800000000000004 21.4 32-33 22.4625 27.975 27.675 21.8875 34-35 23.1375 27.725 27.450000000000003 21.6875 36-37 22.787499999999998 27.525 26.775 22.912499999999998 38-39 21.349999999999998 28.4125 27.462500000000002 22.775000000000002 40-41 21.9625 28.3125 27.3125 22.412499999999998 42-43 22.275 27.6625 28.012500000000003 22.05 44-45 21.462500000000002 27.725 28.525 22.287499999999998 46-47 21.925 28.025 28.725 21.325 48-49 22.0125 27.6125 27.6875 22.6875 50-51 21.45 28.15 28.3125 22.0875 52-53 21.920720270101288 28.23558834562961 27.185194447917972 22.65849693635113 54-55 22.8375 27.975 27.4125 21.775 56-57 22.900000000000002 27.500000000000004 28.15 21.45 58-59 21.462500000000002 28.4375 28.299999999999997 21.8 60-61 21.4875 28.9875 27.35 22.175 62-63 22.1375 29.049999999999997 27.3875 21.425 64-65 22.35 27.987499999999997 27.237499999999997 22.425 66-67 22.025 28.875 27.375 21.725 68-69 22.2125 28.0875 27.725 21.975 70-71 22.3625 28.3375 26.737499999999997 22.5625 72-73 21.325 28.1375 28.6125 21.925 74-75 22.6375 28.15 26.8625 22.35 76-77 21.9375 28.9 27.187499999999996 21.975 78-79 22.5 28.725 28.0625 20.7125 80-81 22.3375 28.525 27.275 21.8625 82-83 22.75 27.375 27.875 22.0 84-85 21.212500000000002 27.675 28.487499999999997 22.625 86-87 22.6375 28.212500000000002 27.987499999999997 21.1625 88-89 22.25 28.037499999999998 27.8375 21.875 90-91 22.237499999999997 28.212500000000002 28.375 21.175 92-93 22.9875 27.950000000000003 27.625 21.4375 94-95 22.5125 27.575 27.487499999999997 22.425 96-97 22.3625 27.3125 28.487499999999997 21.837500000000002 98-99 22.1375 28.675 28.075 21.1125 100 23.175 26.85 27.875 22.1 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 0.5 25 1.0 26 3.5 27 8.0 28 8.0 29 11.5 30 18.0 31 20.0 32 30.0 33 40.0 34 49.5 35 60.5 36 84.5 37 121.0 38 144.0 39 169.5 40 191.0 41 217.0 42 259.0 43 281.5 44 284.5 45 279.5 46 264.0 47 244.0 48 224.0 49 200.0 50 163.5 51 128.0 52 101.5 53 81.0 54 71.0 55 56.5 56 43.5 57 34.0 58 21.0 59 15.0 60 14.0 61 11.0 62 7.5 63 4.5 64 3.5 65 3.5 66 2.5 67 3.0 68 4.0 69 3.0 70 2.0 71 2.0 72 2.0 73 1.5 74 1.0 75 0.5 76 0.5 77 1.5 78 1.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.025 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0375 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88 0.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1242358 spots for SRR3207919.sra Written 1242358 spots for SRR3207919.sra Read 1242358 spots for SRR3207919.sra Written 1242358 spots for SRR3207919.sra Read 1242358 spots for SRR3207919.sra Written 1242358 spots for SRR3207919.sra Read 1242358 spots for SRR3207919.sra Written 1242358 spots for SRR3207919.sra Read 1242358 spots for SRR3207919.sra Written 1242358 spots for SRR3207919.sra Read 1242358 spots for SRR3207919.sra Written 1242358 spots for SRR3207919.sra Read 1242358 spots for SRR3207919.sra Written 1242358 spots for SRR3207919.sra Read 1242358 spots for SRR3207919.sra Written 1242358 spots for SRR3207919.sra Read 1242358 spots for SRR3207919.sra Written 1242358 spots for SRR3207919.sra Read 1242358 spots for SRR3207919.sra Written 1242358 spots for SRR3207919.sra Read 1242358 spots for SRR3207919.sra Written 1242358 spots for SRR3207919.sra Read 1242358 spots for SRR3207919.sra Written 1242358 spots for SRR3207919.sra Read 1242359 spots for SRR3207919.sra Written 1242359 spots for SRR3207919.sra Read 1242358 spots for SRR3207919.sra Written 1242358 spots for SRR3207919.sra Read 1242358 spots for SRR3207919.sra Written 1242358 spots for SRR3207919.sra Read 1242358 spots for SRR3207919.sra Written 1242358 spots for SRR3207919.sra Read 1242358 spots for SRR3207919.sra Written 1242358 spots for SRR3207919.sra Read 1242358 spots for SRR3207919.sra Written 1242358 spots for SRR3207919.sra Read 1242358 spots for SRR3207919.sra Written 1242358 spots for SRR3207919.sra Read 1242358 spots for SRR3207919.sra Written 1242358 spots for SRR3207919.sra SRR ids: ['SRR3207919.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8jjv_65u SRR3207919.sra spots: 24847161 blocks: [[1, 1242358], [1242359, 2484716], [2484717, 3727074], [3727075, 4969432], [4969433, 6211790], [6211791, 7454148], [7454149, 8696506], [8696507, 9938864], [9938865, 11181222], [11181223, 12423580], [12423581, 13665938], [13665939, 14908296], [14908297, 16150654], [16150655, 17393012], [17393013, 18635370], [18635371, 19877728], [19877729, 21120086], [21120087, 22362444], [22362445, 23604802], [23604803, 24847161]] SRR3207919 file size 6455405 SRR3207919 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207919 SRR3207919_1.fastq Input file: SRR3207919_1.fastq trimmed: SRR3207919-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 15:20:13 2025 >> started Tue Feb 11 15:20:25 2025 >> done (11.371s) 24847161 reads processed; of these: 5387 ( 0.02%) short reads filtered out after trimming by size control 21145 ( 0.09%) empty reads filtered out after trimming by size control 24820629 (99.89%) reads available; of these: 2128355 ( 8.57%) trimmed reads available after processing 22692274 (91.43%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 881 0.00% 19 1004 0.00% 20 1306 0.01% 21 1649 0.01% 22 2170 0.01% 23 2857 0.01% 24 3681 0.01% 25 4701 0.02% 26 4739 0.02% 27 4529 0.02% 28 4558 0.02% 29 4655 0.02% 30 4797 0.02% 31 4775 0.02% 32 4846 0.02% 33 5071 0.02% 34 5327 0.02% 35 5397 0.02% 36 5948 0.02% 37 6380 0.03% 38 6429 0.03% 39 6672 0.03% 40 7421 0.03% 41 7578 0.03% 42 8123 0.03% 43 8294 0.03% 44 8836 0.04% 45 9101 0.04% 46 9441 0.04% 47 10256 0.04% 48 10796 0.04% 49 11385 0.05% 50 11844 0.05% 51 12230 0.05% 52 12517 0.05% 53 13620 0.05% 54 14778 0.06% 55 15427 0.06% 56 15878 0.06% 57 16284 0.07% 58 16722 0.07% 59 16659 0.07% 60 17217 0.07% 61 17369 0.07% 62 17327 0.07% 63 17588 0.07% 64 17976 0.07% 65 18266 0.07% 66 18486 0.07% 67 18389 0.07% 68 19404 0.08% 69 19575 0.08% 70 19900 0.08% 71 20545 0.08% 72 21301 0.09% 73 22102 0.09% 74 22294 0.09% 75 21625 0.09% 76 15548 0.06% 77 18124 0.07% 78 19993 0.08% 79 22522 0.09% 80 24797 0.10% 81 26597 0.11% 82 28996 0.12% 83 30835 0.12% 84 32544 0.13% 85 35402 0.14% 86 38080 0.15% 87 40525 0.16% 88 43209 0.17% 89 46940 0.19% 90 52286 0.21% 91 60729 0.24% 92 69264 0.28% 93 76883 0.31% 94 89660 0.36% 95 106075 0.43% 96 123497 0.50% 97 147411 0.59% 98 171146 0.69% 99 168366 0.68% 100 22692274 91.43% 24820629 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=15.48 fanout-score-rank=16 prefix-density=0.10 prefix-fanout=15.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCG criterion=fanout-score sequence-density=0.04 sequence-density-rank=14 fanout-score=309.36 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=29.2 sequence=TTCTTCTTCTTT Started job on | Feb 11 15:20:40 Started mapping on | Feb 11 15:20:40 Finished on | Feb 11 15:21:10 Mapping speed, Million of reads per hour | 2978.48 Number of input reads | 24820629 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 23603002 Uniquely mapped reads % | 95.09% Average mapped length | 98.23 Number of splices: Total | 6661529 Number of splices: Annotated (sjdb) | 6534103 Number of splices: GT/AG | 6555684 Number of splices: GC/AG | 87520 Number of splices: AT/AC | 7254 Number of splices: Non-canonical | 11071 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 1.99 Insertion rate per base | 0.01% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 613902 % of reads mapped to multiple loci | 2.47% Number of reads mapped to too many loci | 309127 % of reads mapped to too many loci | 1.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.18% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 603725 603725 603725 N_multimapping 613902 613902 613902 N_noFeature 985250 12156324 12258059 N_ambiguous 259526 42867 43248 UnstrandedReadsAssigned:22358226 PositiveStrandReadsAssigned:11403811 NegativeStrandReadsAssigned:11301695 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207919 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207919-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,820,629 reads, 23,093,762 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,236 rounds 52401 SRR3207919.ke.tsv 34699 SRR3207919.se.tsv 87100 total ==> SRR3207919.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1218.55 36.7671 Potri.005G024800.1.v4.1 1035 936 460 28.4559 Potri.004G059700.1.v4.1 961 862 59 3.96309 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 472.989 9.62966 Potri.016G087400.1.v4.1 270 171 1064.48 360.44 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 137 4.73865 Potri.012G127500.1.v4.1 977 878 6799 448.374 ==> SRR3207919.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2639 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 492 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 27 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR3207919 completed mapping pipeline successfully