Starting /dee2/code/volunteer_pipeline.sh SRR3207920 current disk space = 3049922899968 free memory = 1443418812 SRR3207920 SRAfilesize a4354977279cb43c2c4e0ab6bde8c55d SRR3207920.sra SRR3207920.sra file validated SRR3207920 is single end SRR3207920 is conventional basespace SRR3207920 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207920_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.901 34.0 31.0 34.0 31.0 34.0 2 33.12625 34.0 33.0 34.0 31.0 34.0 3 33.2395 34.0 34.0 34.0 31.0 34.0 4 36.46 37.0 37.0 37.0 35.0 37.0 5 36.51075 37.0 37.0 37.0 35.0 37.0 6 36.4525 37.0 37.0 37.0 35.0 37.0 7 36.48025 37.0 37.0 37.0 35.0 37.0 8 36.46625 37.0 37.0 37.0 35.0 37.0 9 38.383 39.0 39.0 39.0 37.0 39.0 10-11 38.232 39.0 39.0 39.0 37.0 39.0 12-13 38.078 39.0 38.5 39.0 36.0 39.0 14-15 39.692125 41.0 40.0 41.0 37.0 41.0 16-17 39.63225 41.0 40.0 41.0 37.0 41.0 18-19 39.65025 41.0 40.0 41.0 37.0 41.0 20-21 39.711375000000004 41.0 40.0 41.0 37.5 41.0 22-23 39.614125 41.0 40.0 41.0 37.0 41.0 24-25 39.275000000000006 41.0 39.0 41.0 36.5 41.0 26-27 39.041250000000005 41.0 39.0 41.0 35.5 41.0 28-29 39.18475 41.0 39.0 41.0 36.0 41.0 30-31 39.01475 40.5 39.0 41.0 36.0 41.0 32-33 39.309124999999995 41.0 39.0 41.0 36.5 41.0 34-35 39.246375 41.0 39.0 41.0 36.0 41.0 36-37 39.1465 41.0 39.0 41.0 36.0 41.0 38-39 38.970875 41.0 39.0 41.0 35.0 41.0 40-41 38.665125 40.0 38.0 41.0 35.0 41.0 42-43 38.827875000000006 40.0 39.0 41.0 35.0 41.0 44-45 38.765625 40.0 38.5 41.0 35.0 41.0 46-47 38.769125 40.0 38.5 41.0 34.5 41.0 48-49 38.690124999999995 40.0 38.5 41.0 35.0 41.0 50-51 38.312625 40.0 38.0 41.0 34.0 41.0 52-53 38.323125000000005 40.0 38.0 41.0 34.0 41.0 54-55 38.315875 40.0 38.0 41.0 34.0 41.0 56-57 37.995999999999995 40.0 37.5 41.0 33.5 41.0 58-59 37.761375 40.0 37.0 41.0 33.5 41.0 60-61 37.280125 39.0 36.0 41.0 32.5 41.0 62-63 37.156875 39.0 36.0 41.0 32.0 41.0 64-65 36.872749999999996 39.0 35.5 40.5 32.5 41.0 66-67 36.114374999999995 38.0 35.0 40.0 31.0 41.0 68-69 36.082875 37.5 35.0 40.0 31.0 41.0 70-71 35.6295 37.0 35.0 39.0 31.0 41.0 72-73 35.162 36.0 34.5 39.0 30.5 40.5 74-75 34.7245 36.0 34.0 38.5 30.0 39.5 76-77 33.587625 35.0 33.0 36.5 29.0 39.0 78-79 33.9815 35.0 34.0 37.0 30.0 39.0 80-81 33.75425 35.0 34.0 36.5 29.5 37.5 82-83 33.397999999999996 35.0 34.0 36.0 29.5 37.0 84-85 33.19775 35.0 34.0 35.5 29.5 37.0 86-87 32.775999999999996 35.0 34.0 35.0 29.0 36.0 88-89 32.4465 35.0 33.0 35.0 27.5 36.0 90-91 32.17 35.0 33.0 35.0 27.0 36.0 92-93 32.1225 35.0 33.0 35.0 27.0 35.5 94-95 32.094750000000005 35.0 33.0 35.0 27.5 35.0 96-97 31.575375 35.0 32.5 35.0 26.0 35.0 98-99 31.261499999999998 35.0 32.5 35.0 25.0 35.0 100 31.019 34.0 32.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 3.0 11 4.0 12 4.0 13 3.0 14 7.0 15 8.0 16 6.0 17 7.0 18 9.0 19 10.0 20 10.0 21 9.0 22 8.0 23 9.0 24 10.0 25 10.0 26 24.0 27 25.0 28 35.0 29 34.0 30 47.0 31 54.0 32 64.0 33 95.0 34 135.0 35 214.0 36 365.0 37 913.0 38 1582.0 39 294.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.725 14.799999999999999 15.0 42.475 2 21.45 22.0 36.225 20.325 3 22.475 24.9 26.125 26.5 4 24.375 30.45 20.3 24.875 5 25.650000000000002 33.6 23.325000000000003 17.424999999999997 6 19.0 37.775 25.275 17.95 7 17.75 20.1 41.699999999999996 20.45 8 19.6 23.849999999999998 30.049999999999997 26.5 9 20.0 23.674999999999997 32.15 24.175 10-11 22.7 33.074999999999996 23.325000000000003 20.9 12-13 20.7875 27.05 28.8375 23.325000000000003 14-15 21.042760690172543 27.94448612153038 28.419604901225306 22.593148287071767 16-17 21.8 28.1875 27.3375 22.675 18-19 21.0625 27.750000000000004 27.925 23.2625 20-21 22.2625 29.325000000000003 26.55 21.8625 22-23 22.162499999999998 28.1 27.875 21.8625 24-25 22.225 28.375 27.0625 22.3375 26-27 21.275 28.512500000000003 27.500000000000004 22.7125 28-29 21.4 28.050000000000004 28.375 22.175 30-31 21.4375 27.474999999999998 28.1625 22.925 32-33 21.15 28.462500000000002 27.900000000000002 22.4875 34-35 21.587500000000002 27.6 28.349999999999998 22.4625 36-37 22.55 27.8625 27.4125 22.175 38-39 22.237499999999997 28.4125 27.6125 21.7375 40-41 22.3625 28.1125 27.450000000000003 22.075 42-43 21.512500000000003 27.925 27.9375 22.625 44-45 21.975 28.725 27.3625 21.9375 46-47 22.4875 28.212500000000002 27.1 22.2 48-49 21.7375 28.95 26.2625 23.05 50-51 21.25 27.4125 28.675 22.662499999999998 52-53 21.6635397123202 28.230143839899934 27.70481550969356 22.401500938086304 54-55 22.7375 26.6 28.349999999999998 22.3125 56-57 22.400000000000002 27.8375 27.900000000000002 21.8625 58-59 22.325 28.3375 27.025 22.3125 60-61 21.375 28.125 28.675 21.825 62-63 22.175 28.1375 27.5875 22.1 64-65 22.2125 28.537499999999998 27.750000000000004 21.5 66-67 21.5375 27.925 27.8375 22.7 68-69 21.762500000000003 28.775000000000002 27.575 21.8875 70-71 22.05 28.725 26.950000000000003 22.275 72-73 22.5875 27.712500000000002 27.3125 22.3875 74-75 22.35 27.962500000000002 27.85 21.837500000000002 76-77 22.55 28.499999999999996 27.775 21.175 78-79 21.912499999999998 28.325 27.3125 22.45 80-81 22.125 28.225 27.85 21.8 82-83 21.987499999999997 28.199999999999996 27.1125 22.7 84-85 21.5375 27.575 28.275 22.6125 86-87 22.0875 28.499999999999996 27.537499999999998 21.875 88-89 21.987499999999997 27.6625 28.050000000000004 22.3 90-91 22.037499999999998 27.900000000000002 27.287499999999998 22.775000000000002 92-93 22.175 28.1625 28.050000000000004 21.6125 94-95 22.1875 28.5625 27.474999999999998 21.775 96-97 22.075 28.175 27.55 22.2 98-99 21.637500000000003 28.712500000000002 28.3625 21.2875 100 22.725 28.175 27.35 21.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 1.0 25 1.5 26 0.5 27 4.0 28 10.0 29 14.5 30 16.5 31 19.5 32 28.0 33 36.5 34 50.0 35 72.5 36 85.0 37 99.5 38 132.5 39 169.5 40 202.5 41 232.0 42 241.5 43 256.0 44 283.0 45 272.0 46 263.5 47 251.5 48 226.5 49 201.5 50 166.0 51 145.5 52 113.5 53 80.0 54 73.0 55 59.0 56 37.0 57 29.5 58 23.5 59 16.5 60 13.5 61 11.5 62 11.5 63 9.5 64 8.0 65 5.0 66 2.5 67 4.5 68 4.0 69 1.5 70 0.5 71 1.5 72 1.0 73 0.5 74 2.0 75 1.5 76 0.5 77 1.5 78 1.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.025 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0625 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84973703981969 99.675 2 0.12521913348359628 0.25 3 0.025043826696719257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88 0.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 705135 spots for SRR3207920.sra Written 705135 spots for SRR3207920.sra Read 705135 spots for SRR3207920.sra Written 705135 spots for SRR3207920.sra Read 705135 spots for SRR3207920.sra Written 705135 spots for SRR3207920.sra Read 705135 spots for SRR3207920.sra Written 705135 spots for SRR3207920.sra Read 705135 spots for SRR3207920.sra Written 705135 spots for SRR3207920.sra Read 705135 spots for SRR3207920.sra Written 705135 spots for SRR3207920.sra Read 705135 spots for SRR3207920.sra Written 705135 spots for SRR3207920.sra Read 705135 spots for SRR3207920.sra Written 705135 spots for SRR3207920.sra Read 705135 spots for SRR3207920.sra Written 705135 spots for SRR3207920.sra Read 705135 spots for SRR3207920.sra Written 705135 spots for SRR3207920.sra Read 705135 spots for SRR3207920.sra Written 705135 spots for SRR3207920.sra Read 705135 spots for SRR3207920.sra Written 705135 spots for SRR3207920.sra Read 705135 spots for SRR3207920.sra Written 705135 spots for SRR3207920.sra Read 705135 spots for SRR3207920.sra Written 705135 spots for SRR3207920.sra Read 705152 spots for SRR3207920.sra Written 705152 spots for SRR3207920.sra Read 705135 spots for SRR3207920.sra Written 705135 spots for SRR3207920.sra Read 705135 spots for SRR3207920.sra Written 705135 spots for SRR3207920.sra Read 705135 spots for SRR3207920.sra Written 705135 spots for SRR3207920.sra Read 705135 spots for SRR3207920.sra Written 705135 spots for SRR3207920.sra Read 705135 spots for SRR3207920.sra Written 705135 spots for SRR3207920.sra SRR ids: ['SRR3207920.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5jkzbao6 SRR3207920.sra spots: 14102717 blocks: [[1, 705135], [705136, 1410270], [1410271, 2115405], [2115406, 2820540], [2820541, 3525675], [3525676, 4230810], [4230811, 4935945], [4935946, 5641080], [5641081, 6346215], [6346216, 7051350], [7051351, 7756485], [7756486, 8461620], [8461621, 9166755], [9166756, 9871890], [9871891, 10577025], [10577026, 11282160], [11282161, 11987295], [11987296, 12692430], [12692431, 13397565], [13397566, 14102717]] SRR3207920 file size 3659255 SRR3207920 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207920 SRR3207920_1.fastq Input file: SRR3207920_1.fastq trimmed: SRR3207920-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 14:46:52 2025 >> started Tue Feb 11 14:46:59 2025 >> done (6.909s) 14102717 reads processed; of these: 2202 ( 0.02%) short reads filtered out after trimming by size control 12319 ( 0.09%) empty reads filtered out after trimming by size control 14088196 (99.90%) reads available; of these: 1184677 ( 8.41%) trimmed reads available after processing 12903519 (91.59%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 377 0.00% 19 489 0.00% 20 617 0.00% 21 780 0.01% 22 997 0.01% 23 1364 0.01% 24 1735 0.01% 25 2395 0.02% 26 2227 0.02% 27 2227 0.02% 28 2362 0.02% 29 2317 0.02% 30 2472 0.02% 31 2447 0.02% 32 2441 0.02% 33 2508 0.02% 34 2861 0.02% 35 2865 0.02% 36 3074 0.02% 37 3248 0.02% 38 3428 0.02% 39 3556 0.03% 40 3881 0.03% 41 3873 0.03% 42 4193 0.03% 43 4377 0.03% 44 4681 0.03% 45 4798 0.03% 46 5021 0.04% 47 5260 0.04% 48 5543 0.04% 49 6017 0.04% 50 6270 0.04% 51 6486 0.05% 52 6889 0.05% 53 7338 0.05% 54 7904 0.06% 55 8436 0.06% 56 8572 0.06% 57 8870 0.06% 58 9300 0.07% 59 9167 0.07% 60 9261 0.07% 61 9626 0.07% 62 9757 0.07% 63 9723 0.07% 64 9885 0.07% 65 10050 0.07% 66 9981 0.07% 67 10186 0.07% 68 10684 0.08% 69 10770 0.08% 70 11034 0.08% 71 11654 0.08% 72 11716 0.08% 73 12121 0.09% 74 12269 0.09% 75 12075 0.09% 76 8808 0.06% 77 9773 0.07% 78 11187 0.08% 79 12524 0.09% 80 13697 0.10% 81 14830 0.11% 82 16073 0.11% 83 17155 0.12% 84 18406 0.13% 85 19776 0.14% 86 21394 0.15% 87 22787 0.16% 88 24418 0.17% 89 26439 0.19% 90 29591 0.21% 91 34137 0.24% 92 39124 0.28% 93 43549 0.31% 94 50806 0.36% 95 59725 0.42% 96 69924 0.50% 97 83227 0.59% 98 96937 0.69% 99 95935 0.68% 100 12903519 91.59% 14088196 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=11.69 fanout-score-rank=11 prefix-density=0.07 prefix-fanout=11.7 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGC criterion=fanout-score sequence-density=0.04 sequence-density-rank=23 fanout-score=285.85 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=28.7 sequence=TTCTTCTTCTTT Started job on | Feb 11 14:47:15 Started mapping on | Feb 11 14:47:16 Finished on | Feb 11 14:47:32 Mapping speed, Million of reads per hour | 3169.84 Number of input reads | 14088196 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 13329661 Uniquely mapped reads % | 94.62% Average mapped length | 98.31 Number of splices: Total | 3797262 Number of splices: Annotated (sjdb) | 3718557 Number of splices: GT/AG | 3735662 Number of splices: GC/AG | 50700 Number of splices: AT/AC | 4533 Number of splices: Non-canonical | 6367 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 2.04 Insertion rate per base | 0.01% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 361896 % of reads mapped to multiple loci | 2.57% Number of reads mapped to too many loci | 240041 % of reads mapped to too many loci | 1.70% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.10% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 396639 396639 396639 N_multimapping 361896 361896 361896 N_noFeature 593197 6878209 6958119 N_ambiguous 137141 25449 25404 UnstrandedReadsAssigned:12599323 PositiveStrandReadsAssigned:6426003 NegativeStrandReadsAssigned:6346138 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207920 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207920-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,088,196 reads, 13,075,829 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,107 rounds 52401 SRR3207920.ke.tsv 34699 SRR3207920.se.tsv 87100 total ==> SRR3207920.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 755 40.8422 Potri.005G024800.1.v4.1 1035 936 655 72.6445 Potri.004G059700.1.v4.1 961 862 21 2.529 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 306.245 11.1783 Potri.016G087400.1.v4.1 270 171 420 254.971 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 65 4.03084 Potri.012G127500.1.v4.1 977 878 3318 392.301 ==> SRR3207920.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1105 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 235 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR3207920 completed mapping pipeline successfully