Starting /dee2/code/volunteer_pipeline.sh SRR3207921 current disk space = 3049828892672 free memory = 1155486304 SRR3207921 SRAfilesize 82208dac3371d01838ede65f60ae951a SRR3207921.sra SRR3207921.sra file validated SRR3207921 is single end SRR3207921 is conventional basespace SRR3207921 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207921_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9505 34.0 31.0 34.0 31.0 34.0 2 33.12975 34.0 33.0 34.0 31.0 34.0 3 33.15875 34.0 34.0 34.0 31.0 34.0 4 36.5135 37.0 37.0 37.0 35.0 37.0 5 36.36025 37.0 37.0 37.0 35.0 37.0 6 36.274 37.0 37.0 37.0 35.0 37.0 7 36.2405 37.0 37.0 37.0 35.0 37.0 8 36.2785 37.0 37.0 37.0 35.0 37.0 9 38.23725 39.0 39.0 39.0 37.0 39.0 10-11 38.08525 39.0 39.0 39.0 36.0 39.0 12-13 38.157125 39.0 39.0 39.0 37.0 39.0 14-15 39.677625 41.0 40.0 41.0 37.0 41.0 16-17 39.730125 41.0 40.0 41.0 37.0 41.0 18-19 39.772999999999996 41.0 40.0 41.0 37.5 41.0 20-21 39.713625 41.0 40.0 41.0 37.0 41.0 22-23 39.53875 41.0 40.0 41.0 37.0 41.0 24-25 39.590875 41.0 40.0 41.0 37.0 41.0 26-27 39.617875 41.0 40.0 41.0 37.0 41.0 28-29 39.40675 41.0 39.5 41.0 36.5 41.0 30-31 39.331625 41.0 39.0 41.0 36.0 41.0 32-33 39.2555 41.0 39.0 41.0 36.0 41.0 34-35 39.2315 41.0 39.0 41.0 36.0 41.0 36-37 39.1575 41.0 39.0 41.0 36.0 41.0 38-39 39.043625000000006 40.5 39.0 41.0 35.5 41.0 40-41 39.030874999999995 40.0 39.0 41.0 35.0 41.0 42-43 39.02525 40.0 38.5 41.0 35.0 41.0 44-45 39.038624999999996 40.5 39.0 41.0 35.0 41.0 46-47 38.992375 40.0 39.0 41.0 35.0 41.0 48-49 38.914625 40.0 39.0 41.0 35.0 41.0 50-51 39.01175 41.0 39.0 41.0 35.0 41.0 52-53 39.024874999999994 41.0 39.0 41.0 35.5 41.0 54-55 38.857375000000005 41.0 39.0 41.0 35.0 41.0 56-57 38.818375 41.0 39.0 41.0 35.0 41.0 58-59 38.542375 40.0 38.0 41.0 34.5 41.0 60-61 38.0655 40.0 37.0 41.0 33.5 41.0 62-63 38.151250000000005 40.0 37.0 41.0 34.0 41.0 64-65 37.838750000000005 39.0 37.0 41.0 34.0 41.0 66-67 37.555875 39.0 36.0 41.0 33.5 41.0 68-69 37.170874999999995 39.0 35.5 40.5 33.5 41.0 70-71 36.687125 37.5 35.0 40.0 33.0 41.0 72-73 35.991375000000005 37.0 35.0 39.0 31.5 41.0 74-75 35.5855 36.5 35.0 39.0 32.0 40.5 76-77 34.578 35.5 34.0 37.0 30.5 39.0 78-79 34.64 35.5 35.0 37.0 30.5 39.0 80-81 34.584625 35.0 35.0 37.0 32.0 39.0 82-83 34.1365 35.0 35.0 36.0 31.0 37.0 84-85 33.97924999999999 35.0 35.0 36.0 31.0 37.0 86-87 33.84725 35.0 34.5 36.0 31.0 37.0 88-89 33.473375000000004 35.0 34.0 35.0 30.5 36.0 90-91 33.397375 35.0 34.0 35.0 31.0 36.0 92-93 33.279125 35.0 34.0 35.0 31.0 36.0 94-95 33.15 35.0 34.0 35.0 31.0 36.0 96-97 32.991375000000005 35.0 34.0 35.0 30.5 35.5 98-99 32.841875 35.0 34.0 35.0 30.0 35.0 100 32.75275 35.0 34.0 35.0 30.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 2.0 12 2.0 13 2.0 14 2.0 15 4.0 16 1.0 17 3.0 18 6.0 19 4.0 20 5.0 21 2.0 22 7.0 23 10.0 24 8.0 25 20.0 26 16.0 27 27.0 28 19.0 29 19.0 30 36.0 31 54.0 32 67.0 33 100.0 34 107.0 35 145.0 36 310.0 37 730.0 38 1725.0 39 563.0 40 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.243182386790092 16.837628221165872 13.635226419814861 45.28396297222917 2 18.825 25.275 37.974999999999994 17.925 3 20.599999999999998 27.800000000000004 28.95 22.650000000000002 4 23.45 33.125 20.575 22.85 5 22.9057264316079 37.559389847461865 21.655413853463365 17.879469867466867 6 18.775 38.125 24.175 18.925 7 16.525000000000002 17.025000000000002 43.974999999999994 22.475 8 17.025000000000002 24.775 31.75 26.450000000000003 9 20.325 22.85 33.375 23.45 10-11 22.4625 33.0875 23.2375 21.212500000000002 12-13 20.4375 27.150000000000002 29.9375 22.475 14-15 21.4125 28.375 28.299999999999997 21.912499999999998 16-17 21.8875 28.3375 27.775 22.0 18-19 21.512500000000003 28.375 27.950000000000003 22.162499999999998 20-21 21.65 28.349999999999998 27.900000000000002 22.1 22-23 20.8125 28.775000000000002 28.237499999999997 22.175 24-25 21.345504564211577 29.498561960735277 27.560335125672125 21.595598349381017 26-27 21.3875 28.725 28.225 21.6625 28-29 21.4491302715555 28.256788887498434 29.245401076210737 21.04867976473533 30-31 20.947131044850913 29.17815083938862 28.238536707592083 21.63618140816838 32-33 20.625 28.787499999999998 28.7375 21.85 34-35 20.837500000000002 28.925 27.400000000000002 22.8375 36-37 21.1375 28.1125 28.7375 22.0125 38-39 22.4625 28.050000000000004 28.199999999999996 21.2875 40-41 21.987499999999997 28.475 27.950000000000003 21.587500000000002 42-43 21.8 28.675 27.900000000000002 21.625 44-45 20.875 28.525 28.95 21.65 46-47 21.75 28.6875 28.0625 21.5 48-49 22.5125 28.1125 28.175 21.2 50-51 21.637500000000003 27.975 28.1875 22.2 52-53 21.475 28.4125 28.212500000000002 21.9 54-55 21.6875 28.175 28.212500000000002 21.925 56-57 21.45 27.450000000000003 29.1375 21.9625 58-59 22.35 26.787499999999998 28.749999999999996 22.112499999999997 60-61 21.75 27.6 28.475 22.175 62-63 21.75 28.512500000000003 27.875 21.8625 64-65 22.025 28.8625 27.975 21.1375 66-67 22.05 28.9375 27.787499999999998 21.224999999999998 68-69 22.0875 28.212500000000002 27.650000000000002 22.05 70-71 20.7 29.3375 27.437499999999996 22.525000000000002 72-73 21.8875 28.7375 28.000000000000004 21.375 74-75 21.587500000000002 29.212500000000002 27.950000000000003 21.25 76-77 22.2625 28.175 28.212500000000002 21.349999999999998 78-79 20.8625 29.262500000000003 28.499999999999996 21.375 80-81 21.5375 28.812500000000004 27.8375 21.8125 82-83 22.075 28.499999999999996 27.762500000000003 21.6625 84-85 21.25 29.4375 27.900000000000002 21.4125 86-87 22.1375 28.512500000000003 28.075 21.275 88-89 21.9375 27.8375 28.525 21.7 90-91 21.725 28.9 28.050000000000004 21.325 92-93 21.875 28.15 28.6875 21.2875 94-95 21.825 27.9375 28.6875 21.55 96-97 21.85 27.85 28.9375 21.3625 98-99 22.0125 29.075 28.249999999999996 20.6625 100 22.125 27.925 27.650000000000002 22.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 1.5 25 3.0 26 3.5 27 7.5 28 12.5 29 13.5 30 19.5 31 29.0 32 35.5 33 50.5 34 66.0 35 81.5 36 113.0 37 133.5 38 151.5 39 175.0 40 215.0 41 249.5 42 260.0 43 279.5 44 278.0 45 269.5 46 245.5 47 223.0 48 206.5 49 178.5 50 161.5 51 130.5 52 97.0 53 74.0 54 58.5 55 46.0 56 32.0 57 20.0 58 13.0 59 9.5 60 10.0 61 8.5 62 7.0 63 6.5 64 4.0 65 4.0 66 3.0 67 1.5 68 1.0 69 0.5 70 0.5 71 1.5 72 1.0 73 0.5 74 0.5 75 0.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0375 26-27 0.0 28-29 0.11249999999999999 30-31 0.22499999999999998 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.7739829231542 99.325 2 0.1757910597689603 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.025113008538422906 0.125 6 0.0 0.0 7 0.0 0.0 8 0.025113008538422906 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTAT 8 0.2 TruSeq Adapter, Index 18 (97% over 40bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTA 5 0.125 TruSeq Adapter, Index 18 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.175 0.0 0.0 0.0 0.0 2 0.175 0.0 0.0 0.0 0.0 3 0.175 0.0 0.0 0.0 0.0 4 0.175 0.0 0.0 0.0 0.0 5 0.175 0.0 0.0 0.0 0.0 6 0.175 0.0 0.0 0.0 0.0 7 0.175 0.0 0.0 0.0 0.0 8 0.175 0.0 0.0 0.0 0.0 9 0.175 0.0 0.0 0.0 0.0 10-11 0.175 0.0 0.0 0.0 0.0 12-13 0.175 0.0 0.0 0.0 0.0 14-15 0.175 0.0 0.0 0.0 0.0 16-17 0.175 0.0 0.0 0.0 0.0 18-19 0.175 0.0 0.0 0.0 0.0 20-21 0.175 0.0 0.0 0.0 0.0 22-23 0.175 0.0 0.0 0.0 0.0 24-25 0.175 0.0 0.0 0.0 0.0 26-27 0.175 0.0 0.0 0.0 0.0 28-29 0.175 0.0 0.0 0.0 0.0 30-31 0.175 0.0 0.0 0.0 0.0 32-33 0.175 0.0 0.0 0.0 0.0 34-35 0.175 0.0 0.0 0.0 0.0 36-37 0.175 0.0 0.0 0.0 0.0 38-39 0.175 0.0 0.0 0.0 0.0 40-41 0.175 0.0 0.0 0.0 0.0 42-43 0.175 0.0 0.0 0.0 0.0 44-45 0.175 0.0 0.0 0.0 0.0 46-47 0.1875 0.0 0.0 0.0 0.0 48-49 0.2 0.0 0.0 0.0 0.0 50-51 0.2 0.0 0.0 0.0 0.0 52-53 0.2 0.0 0.0 0.0 0.0 54-55 0.2 0.0 0.0 0.0 0.0 56-57 0.2 0.0 0.0 0.0 0.0 58-59 0.21250000000000002 0.0 0.0 0.0 0.0 60-61 0.225 0.0 0.0 0.0 0.0 62-63 0.225 0.0 0.0 0.0 0.0 64-65 0.25 0.0 0.0 0.0 0.0 66-67 0.275 0.0 0.0 0.0 0.0 68-69 0.275 0.0 0.0 0.0 0.0 70-71 0.275 0.0 0.0 0.0 0.0 72-73 0.275 0.0 0.0 0.0 0.0 74-75 0.3 0.0 0.0 0.0 0.0 76-77 0.3 0.0 0.0 0.0 0.0 78-79 0.32499999999999996 0.0 0.0 0.0 0.0 80-81 0.3625 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.5125 0.0 0.0 0.0 0.0 86-87 0.55 0.0 0.0 0.0 0.0 88 0.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 758435 spots for SRR3207921.sra Written 758435 spots for SRR3207921.sra Read 758435 spots for SRR3207921.sra Written 758435 spots for SRR3207921.sra Read 758435 spots for SRR3207921.sra Written 758435 spots for SRR3207921.sra Read 758435 spots for SRR3207921.sra Written 758435 spots for SRR3207921.sra Read 758435 spots for SRR3207921.sra Written 758435 spots for SRR3207921.sra Read 758435 spots for SRR3207921.sra Written 758435 spots for SRR3207921.sra Read 758435 spots for SRR3207921.sra Written 758435 spots for SRR3207921.sra Read 758435 spots for SRR3207921.sra Written 758435 spots for SRR3207921.sra Read 758435 spots for SRR3207921.sra Written 758435 spots for SRR3207921.sra Read 758435 spots for SRR3207921.sra Written 758435 spots for SRR3207921.sra Read 758435 spots for SRR3207921.sra Written 758435 spots for SRR3207921.sra Read 758435 spots for SRR3207921.sra Written 758435 spots for SRR3207921.sra Read 758435 spots for SRR3207921.sra Written 758435 spots for SRR3207921.sra Read 758449 spots for SRR3207921.sra Written 758449 spots for SRR3207921.sra Read 758435 spots for SRR3207921.sra Written 758435 spots for SRR3207921.sra Read 758435 spots for SRR3207921.sra Written 758435 spots for SRR3207921.sra Read 758435 spots for SRR3207921.sra Written 758435 spots for SRR3207921.sra Read 758435 spots for SRR3207921.sra Written 758435 spots for SRR3207921.sra Read 758435 spots for SRR3207921.sra Written 758435 spots for SRR3207921.sra Read 758435 spots for SRR3207921.sra Written 758435 spots for SRR3207921.sra SRR ids: ['SRR3207921.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z_zuf6yu SRR3207921.sra spots: 15168714 blocks: [[1, 758435], [758436, 1516870], [1516871, 2275305], [2275306, 3033740], [3033741, 3792175], [3792176, 4550610], [4550611, 5309045], [5309046, 6067480], [6067481, 6825915], [6825916, 7584350], [7584351, 8342785], [8342786, 9101220], [9101221, 9859655], [9859656, 10618090], [10618091, 11376525], [11376526, 12134960], [12134961, 12893395], [12893396, 13651830], [13651831, 14410265], [14410266, 15168714]] SRR3207921 file size 3936665 SRR3207921 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207921 SRR3207921_1.fastq Input file: SRR3207921_1.fastq trimmed: SRR3207921-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 15:01:31 2025 >> started Tue Feb 11 15:01:42 2025 >> done (10.739s) 15168714 reads processed; of these: 1508 ( 0.01%) short reads filtered out after trimming by size control 73278 ( 0.48%) empty reads filtered out after trimming by size control 15093928 (99.51%) reads available; of these: 670778 ( 4.44%) trimmed reads available after processing 14423150 (95.56%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 266 0.00% 19 335 0.00% 20 442 0.00% 21 543 0.00% 22 749 0.00% 23 988 0.01% 24 1368 0.01% 25 1722 0.01% 26 1801 0.01% 27 1865 0.01% 28 1821 0.01% 29 1919 0.01% 30 1959 0.01% 31 1982 0.01% 32 2127 0.01% 33 2206 0.01% 34 2269 0.02% 35 2253 0.01% 36 2404 0.02% 37 2498 0.02% 38 2595 0.02% 39 2734 0.02% 40 2728 0.02% 41 2961 0.02% 42 2830 0.02% 43 3005 0.02% 44 3087 0.02% 45 3303 0.02% 46 3329 0.02% 47 3456 0.02% 48 3549 0.02% 49 3754 0.02% 50 3631 0.02% 51 3846 0.03% 52 3973 0.03% 53 4066 0.03% 54 4330 0.03% 55 4431 0.03% 56 4498 0.03% 57 4867 0.03% 58 5014 0.03% 59 5087 0.03% 60 5115 0.03% 61 5328 0.04% 62 5338 0.04% 63 5580 0.04% 64 5863 0.04% 65 6133 0.04% 66 6041 0.04% 67 6558 0.04% 68 6651 0.04% 69 6287 0.04% 70 6680 0.04% 71 7932 0.05% 72 7321 0.05% 73 7438 0.05% 74 7558 0.05% 75 7646 0.05% 76 5577 0.04% 77 5993 0.04% 78 6700 0.04% 79 7356 0.05% 80 7996 0.05% 81 8514 0.06% 82 9122 0.06% 83 9897 0.07% 84 10186 0.07% 85 10618 0.07% 86 11419 0.08% 87 12232 0.08% 88 13326 0.09% 89 14985 0.10% 90 16309 0.11% 91 18213 0.12% 92 20613 0.14% 93 23281 0.15% 94 27317 0.18% 95 32396 0.21% 96 38550 0.26% 97 43913 0.29% 98 49325 0.33% 99 50880 0.34% 100 14423150 95.56% 15093928 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=46.07 fanout-score-rank=6 prefix-density=0.47 prefix-fanout=33.7 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTATGCCGTCTTCTGCTTGAAAAAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=38 fanout-score=304.46 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=15.6 sequence=CAGCAGCAAGACAAACCGAATTATTCATAAGTACCAATAAAATAAGCATTGCGCAAAAGGGATAGGATAAATCACTCTTAAGCTTGAGGCTTCTCCCATTTGAGGGGCTTGACAACTTCCCAGGTGAAGTCTGGGTCATCCCTTCCAAAATGTCCGTATGCAGCTGTCTTCAAGAACCTATTACCCCCCCTCTTGAGATCCAGGTTGATGGTCATCATTCCAGGCCTAAAGTCAAAGCTCTCCTTCACA Started job on | Feb 11 15:01:59 Started mapping on | Feb 11 15:02:00 Finished on | Feb 11 15:02:18 Mapping speed, Million of reads per hour | 3018.79 Number of input reads | 15093928 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 14364472 Uniquely mapped reads % | 95.17% Average mapped length | 98.85 Number of splices: Total | 4254517 Number of splices: Annotated (sjdb) | 4177337 Number of splices: GT/AG | 4190829 Number of splices: GC/AG | 52623 Number of splices: AT/AC | 4102 Number of splices: Non-canonical | 6963 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 2.02 Insertion rate per base | 0.01% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 303846 % of reads mapped to multiple loci | 2.01% Number of reads mapped to too many loci | 148714 % of reads mapped to too many loci | 0.99% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.83% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 425610 425610 425610 N_multimapping 303846 303846 303846 N_noFeature 667536 7410891 7521580 N_ambiguous 147878 24406 24178 UnstrandedReadsAssigned:13549058 PositiveStrandReadsAssigned:6929175 NegativeStrandReadsAssigned:6818714 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207921 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207921-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,093,928 reads, 13,931,797 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,095 rounds 52401 SRR3207921.ke.tsv 34699 SRR3207921.se.tsv 87100 total ==> SRR3207921.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 322 18.5333 Potri.005G024800.1.v4.1 1035 936 60 7.08022 Potri.004G059700.1.v4.1 961 862 4 0.512536 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 256.643 9.96716 Potri.016G087400.1.v4.1 270 171 436 281.619 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 30 1.97942 Potri.012G127500.1.v4.1 977 878 1199 150.833 ==> SRR3207921.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1428 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 242 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 22 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207921 completed mapping pipeline successfully