Starting /dee2/code/volunteer_pipeline.sh SRR3207922 current disk space = 2823890321408 free memory = 1579412076 SRR3207922 SRAfilesize 5b6fb181d16e4028f8a86c1fbb099384 SRR3207922.sra SRR3207922.sra file validated SRR3207922 is single end SRR3207922 is conventional basespace SRR3207922 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207922_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.94325 34.0 31.0 34.0 31.0 34.0 2 33.1115 34.0 33.0 34.0 31.0 34.0 3 33.19275 34.0 34.0 34.0 31.0 34.0 4 36.47575 37.0 37.0 37.0 35.0 37.0 5 36.37375 37.0 37.0 37.0 35.0 37.0 6 36.245 37.0 37.0 37.0 35.0 37.0 7 36.2465 37.0 37.0 37.0 35.0 37.0 8 36.2745 37.0 37.0 37.0 35.0 37.0 9 38.21575 39.0 39.0 39.0 37.0 39.0 10-11 38.178625 39.0 39.0 39.0 36.0 39.0 12-13 38.24425 39.0 39.0 39.0 37.0 39.0 14-15 39.696375 41.0 40.0 41.0 37.5 41.0 16-17 39.751625000000004 41.0 40.0 41.0 37.0 41.0 18-19 39.7625 41.0 40.0 41.0 37.5 41.0 20-21 39.7515 41.0 40.0 41.0 37.0 41.0 22-23 39.576375 41.0 40.0 41.0 36.5 41.0 24-25 39.611000000000004 41.0 40.0 41.0 37.0 41.0 26-27 39.605000000000004 41.0 40.0 41.0 37.0 41.0 28-29 39.461875000000006 41.0 40.0 41.0 36.5 41.0 30-31 39.334999999999994 41.0 40.0 41.0 37.0 41.0 32-33 39.34825 41.0 40.0 41.0 37.0 41.0 34-35 39.297875 41.0 39.5 41.0 36.5 41.0 36-37 39.207 41.0 39.0 41.0 36.0 41.0 38-39 39.029624999999996 40.5 39.0 41.0 35.5 41.0 40-41 39.02075 40.0 39.0 41.0 35.5 41.0 42-43 38.979124999999996 40.0 39.0 41.0 35.0 41.0 44-45 39.045500000000004 41.0 39.0 41.0 35.5 41.0 46-47 39.028125 41.0 39.0 41.0 35.0 41.0 48-49 38.9195 40.0 39.0 41.0 35.0 41.0 50-51 39.04825 41.0 39.0 41.0 35.0 41.0 52-53 39.016999999999996 41.0 39.0 41.0 35.0 41.0 54-55 38.861374999999995 41.0 39.0 41.0 35.0 41.0 56-57 38.8315 41.0 39.0 41.0 35.0 41.0 58-59 38.529125 40.0 38.0 41.0 34.5 41.0 60-61 38.067625 40.0 37.0 41.0 33.5 41.0 62-63 38.09525 40.0 37.0 41.0 34.0 41.0 64-65 37.817750000000004 39.0 36.5 41.0 34.0 41.0 66-67 37.57125 39.0 36.0 41.0 34.0 41.0 68-69 37.197375 39.0 35.5 41.0 34.0 41.0 70-71 36.604875 37.5 35.0 40.0 32.5 41.0 72-73 36.01825 37.0 35.0 39.0 32.0 41.0 74-75 35.6055 36.5 35.0 39.0 32.0 41.0 76-77 34.471875 35.5 34.0 37.0 30.5 39.0 78-79 34.4875 35.5 34.5 37.0 30.5 39.0 80-81 34.462 35.0 35.0 37.0 31.0 39.0 82-83 34.1045 35.0 35.0 36.0 31.0 37.0 84-85 33.97525 35.0 35.0 36.0 32.0 37.0 86-87 33.721625 35.0 34.0 36.0 31.0 37.0 88-89 33.422125 35.0 34.0 35.0 31.0 36.0 90-91 33.354875 35.0 34.0 35.0 31.0 36.0 92-93 33.17 35.0 34.0 35.0 31.0 36.0 94-95 33.024375000000006 35.0 34.0 35.0 30.0 36.0 96-97 32.943375 35.0 34.0 35.0 30.0 35.5 98-99 32.757 35.0 34.0 35.0 30.0 35.0 100 32.679 35.0 34.0 35.0 30.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 2.0 11 2.0 12 0.0 13 0.0 14 3.0 15 3.0 16 1.0 17 6.0 18 2.0 19 2.0 20 2.0 21 7.0 22 2.0 23 12.0 24 12.0 25 5.0 26 17.0 27 31.0 28 34.0 29 25.0 30 41.0 31 53.0 32 59.0 33 89.0 34 105.0 35 167.0 36 282.0 37 744.0 38 1693.0 39 592.0 40 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.54854854854855 17.04204204204204 15.590590590590592 43.81881881881882 2 19.975 24.85 36.175000000000004 19.0 3 21.525 27.025 28.175 23.275000000000002 4 23.799999999999997 31.574999999999996 20.775 23.849999999999998 5 23.95598899724931 35.38384596149037 22.1055263815954 18.554638659664917 6 19.950000000000003 36.0 25.174999999999997 18.875 7 16.525000000000002 17.275 43.55 22.650000000000002 8 18.0 24.85 29.799999999999997 27.35 9 21.125 22.175 32.025 24.675 10-11 22.2625 34.2375 22.7625 20.7375 12-13 19.9625 26.150000000000002 30.7125 23.175 14-15 20.7375 28.7375 28.9125 21.6125 16-17 22.05 28.000000000000004 28.000000000000004 21.95 18-19 21.1625 28.1625 28.787499999999998 21.8875 20-21 22.85 27.987499999999997 27.462500000000002 21.7 22-23 21.3 29.6875 27.712500000000002 21.3 24-25 22.20555138784696 28.244561140285075 27.51937984496124 22.030507626906726 26-27 21.125 28.425 28.537499999999998 21.912499999999998 28-29 21.807711567351028 29.018527791687532 27.190786179268905 21.98297446169254 30-31 20.223029695526876 27.25222403207618 29.382282921939606 23.142463350457337 32-33 21.087500000000002 28.425 28.037499999999998 22.45 34-35 21.975 28.175 27.650000000000002 22.2 36-37 20.8125 29.2375 27.762500000000003 22.1875 38-39 21.8625 28.325 28.512500000000003 21.3 40-41 22.037499999999998 28.575 27.500000000000004 21.8875 42-43 21.2625 28.175 28.3625 22.2 44-45 21.45 27.700000000000003 28.849999999999998 22.0 46-47 21.9 27.6375 27.437499999999996 23.025000000000002 48-49 21.3625 28.212500000000002 28.625 21.8 50-51 21.587500000000002 28.1625 28.1 22.15 52-53 21.0625 29.5875 27.224999999999998 22.125 54-55 22.0875 27.987499999999997 27.975 21.95 56-57 21.575 28.299999999999997 27.9125 22.2125 58-59 21.4 28.275 28.125 22.2 60-61 21.675 28.3125 28.037499999999998 21.975 62-63 21.4375 28.787499999999998 27.950000000000003 21.825 64-65 21.7375 28.1375 28.1875 21.9375 66-67 21.462500000000002 29.45 27.5625 21.525 68-69 22.375 28.8375 26.7625 22.025 70-71 21.349999999999998 29.5 27.6875 21.462500000000002 72-73 21.9625 28.375 28.1 21.5625 74-75 22.0125 28.599999999999998 27.224999999999998 22.162499999999998 76-77 22.112499999999997 29.425 27.1 21.3625 78-79 21.575 29.212500000000002 28.037499999999998 21.175 80-81 21.65 28.449999999999996 28.262500000000003 21.637500000000003 82-83 21.212500000000002 29.362500000000004 27.450000000000003 21.975 84-85 22.525000000000002 28.000000000000004 28.199999999999996 21.275 86-87 22.3 29.6625 27.3125 20.724999999999998 88-89 21.8875 29.2 27.575 21.337500000000002 90-91 21.5625 29.125 27.187499999999996 22.125 92-93 22.3125 28.037499999999998 28.125 21.525 94-95 22.475 28.050000000000004 28.012500000000003 21.462500000000002 96-97 22.15 28.9375 27.800000000000004 21.1125 98-99 22.725 27.8625 27.325 22.0875 100 21.7 28.825 28.125 21.349999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 1.0 24 1.5 25 3.5 26 5.5 27 4.0 28 4.0 29 8.5 30 16.0 31 26.0 32 42.5 33 59.5 34 66.5 35 75.5 36 92.5 37 125.0 38 161.0 39 169.0 40 194.0 41 236.0 42 247.5 43 270.0 44 287.0 45 271.5 46 254.5 47 248.0 48 221.5 49 177.5 50 159.0 51 142.5 52 102.0 53 69.5 54 57.5 55 46.5 56 34.5 57 24.0 58 15.5 59 11.5 60 11.0 61 11.5 62 10.5 63 5.0 64 2.5 65 3.0 66 4.0 67 4.0 68 2.5 69 1.5 70 1.0 71 1.5 72 2.0 73 1.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.5 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.025 26-27 0.0 28-29 0.15 30-31 0.2375 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87392839132627 99.02499999999999 2 0.05042864346949068 0.1 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.02521432173474534 0.15 7 0.0 0.0 8 0.02521432173474534 0.2 9 0.0 0.0 >10 0.02521432173474534 0.525 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTAT 21 0.525 TruSeq Adapter, Index 19 (97% over 40bp) CGTATGCCGTCTTCTGCTTGAGATCGGAAGAGCACACGTCTGAACTCCAG 8 0.2 Illumina Multiplexing PCR Primer 2.01 (100% over 30bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTA 6 0.15 TruSeq Adapter, Index 19 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.2 0.0 0.0 0.0 0.0 2 0.225 0.0 0.0 0.0 0.0 3 0.225 0.0 0.0 0.0 0.0 4 0.225 0.0 0.0 0.0 0.0 5 0.225 0.0 0.0 0.0 0.0 6 0.225 0.0 0.0 0.0 0.0 7 0.225 0.0 0.0 0.0 0.0 8 0.225 0.0 0.0 0.0 0.0 9 0.225 0.0 0.0 0.0 0.0 10-11 0.225 0.0 0.0 0.0 0.0 12-13 0.225 0.0 0.0 0.0 0.0 14-15 0.225 0.0 0.0 0.0 0.0 16-17 0.225 0.0 0.0 0.0 0.0 18-19 0.225 0.0 0.0 0.0 0.0 20-21 0.3625 0.0 0.0 0.0 0.0 22-23 0.475 0.0 0.0 0.0 0.0 24-25 0.4875 0.0 0.0 0.0 0.0 26-27 0.5 0.0 0.0 0.0 0.0 28-29 0.5 0.0 0.0 0.0 0.0 30-31 0.5 0.0 0.0 0.0 0.0 32-33 0.525 0.0 0.0 0.0 0.0 34-35 0.525 0.0 0.0 0.0 0.0 36-37 0.525 0.0 0.0 0.0 0.0 38-39 0.525 0.0 0.0 0.0 0.0 40-41 0.55 0.0 0.0 0.0 0.0 42-43 0.55 0.0 0.0 0.0 0.0 44-45 0.55 0.0 0.0 0.0 0.0 46-47 0.55 0.0 0.0 0.0 0.0 48-49 0.5625 0.0 0.0 0.0 0.0 50-51 0.575 0.0 0.0 0.0 0.0 52-53 0.6 0.0 0.0 0.0 0.0 54-55 0.6 0.0 0.0 0.0 0.0 56-57 0.6 0.0 0.0 0.0 0.0 58-59 0.6 0.0 0.0 0.0 0.0 60-61 0.6 0.0 0.0 0.0 0.0 62-63 0.6 0.0 0.0 0.0 0.0 64-65 0.6125 0.0 0.0 0.0 0.0 66-67 0.65 0.0 0.0 0.0 0.0 68-69 0.6625000000000001 0.0 0.0 0.0 0.0 70-71 0.675 0.0 0.0 0.0 0.0 72-73 0.675 0.0 0.0 0.0 0.0 74-75 0.6875 0.0 0.0 0.0 0.0 76-77 0.7 0.0 0.0 0.0 0.0 78-79 0.7625 0.0 0.0 0.0 0.0 80-81 0.8 0.0 0.0 0.0 0.0 82-83 0.825 0.0 0.0 0.0 0.0 84-85 0.8625 0.0 0.0 0.0 0.0 86-87 0.975 0.0 0.0 0.0 0.0 88 1.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1250402 spots for SRR3207922.sra Written 1250402 spots for SRR3207922.sra Read 1250402 spots for SRR3207922.sra Written 1250402 spots for SRR3207922.sra Read 1250402 spots for SRR3207922.sra Written 1250402 spots for SRR3207922.sra Read 1250402 spots for SRR3207922.sra Written 1250402 spots for SRR3207922.sra Read 1250402 spots for SRR3207922.sra Written 1250402 spots for SRR3207922.sra Read 1250402 spots for SRR3207922.sra Written 1250402 spots for SRR3207922.sra Read 1250402 spots for SRR3207922.sra Written 1250402 spots for SRR3207922.sra Read 1250402 spots for SRR3207922.sra Written 1250402 spots for SRR3207922.sra Read 1250402 spots for SRR3207922.sra Written 1250402 spots for SRR3207922.sra Read 1250402 spots for SRR3207922.sra Written 1250402 spots for SRR3207922.sra Read 1250402 spots for SRR3207922.sra Written 1250402 spots for SRR3207922.sra Read 1250402 spots for SRR3207922.sra Written 1250402 spots for SRR3207922.sra Read 1250402 spots for SRR3207922.sra Written 1250402 spots for SRR3207922.sra Read 1250402 spots for SRR3207922.sra Written 1250402 spots for SRR3207922.sra Read 1250402 spots for SRR3207922.sra Written 1250402 spots for SRR3207922.sra Read 1250402 spots for SRR3207922.sra Written 1250402 spots for SRR3207922.sra Read 1250419 spots for SRR3207922.sra Written 1250419 spots for SRR3207922.sra Read 1250402 spots for SRR3207922.sra Written 1250402 spots for SRR3207922.sra Read 1250402 spots for SRR3207922.sra Written 1250402 spots for SRR3207922.sra Read 1250402 spots for SRR3207922.sra Written 1250402 spots for SRR3207922.sra SRR ids: ['SRR3207922.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dzszdrc6 SRR3207922.sra spots: 25008057 blocks: [[1, 1250402], [1250403, 2500804], [2500805, 3751206], [3751207, 5001608], [5001609, 6252010], [6252011, 7502412], [7502413, 8752814], [8752815, 10003216], [10003217, 11253618], [11253619, 12504020], [12504021, 13754422], [13754423, 15004824], [15004825, 16255226], [16255227, 17505628], [17505629, 18756030], [18756031, 20006432], [20006433, 21256834], [21256835, 22507236], [22507237, 23757638], [23757639, 25008057]] SRR3207922 file size 6497280 SRR3207922 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207922 SRR3207922_1.fastq Input file: SRR3207922_1.fastq trimmed: SRR3207922-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Apr 10 12:55:31 2025 >> started Thu Apr 10 12:55:44 2025 >> done (12.635s) 25008057 reads processed; of these: 3737 ( 0.01%) short reads filtered out after trimming by size control 234141 ( 0.94%) empty reads filtered out after trimming by size control 24770179 (99.05%) reads available; of these: 1127164 ( 4.55%) trimmed reads available after processing 23643015 (95.45%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 571 0.00% 19 3192 0.01% 20 21730 0.09% 21 1291 0.01% 22 1322 0.01% 23 1906 0.01% 24 2623 0.01% 25 3357 0.01% 26 3579 0.01% 27 3244 0.01% 28 3607 0.01% 29 3925 0.02% 30 3264 0.01% 31 4738 0.02% 32 4040 0.02% 33 4306 0.02% 34 4048 0.02% 35 4009 0.02% 36 4689 0.02% 37 4617 0.02% 38 4536 0.02% 39 4947 0.02% 40 4904 0.02% 41 5189 0.02% 42 5134 0.02% 43 5302 0.02% 44 5286 0.02% 45 5541 0.02% 46 5812 0.02% 47 5849 0.02% 48 6202 0.03% 49 6444 0.03% 50 6308 0.03% 51 6666 0.03% 52 6874 0.03% 53 6985 0.03% 54 7402 0.03% 55 7438 0.03% 56 7736 0.03% 57 8097 0.03% 58 8225 0.03% 59 8286 0.03% 60 8696 0.04% 61 9158 0.04% 62 9042 0.04% 63 9312 0.04% 64 9945 0.04% 65 13258 0.05% 66 10709 0.04% 67 11196 0.05% 68 11212 0.05% 69 10453 0.04% 70 11378 0.05% 71 13220 0.05% 72 12407 0.05% 73 12071 0.05% 74 12411 0.05% 75 12322 0.05% 76 8956 0.04% 77 9894 0.04% 78 11005 0.04% 79 11894 0.05% 80 12678 0.05% 81 13666 0.06% 82 14111 0.06% 83 15761 0.06% 84 16488 0.07% 85 17224 0.07% 86 18583 0.08% 87 19482 0.08% 88 21222 0.09% 89 23695 0.10% 90 26240 0.11% 91 29140 0.12% 92 33179 0.13% 93 37073 0.15% 94 43697 0.18% 95 52059 0.21% 96 61108 0.25% 97 70132 0.28% 98 78469 0.32% 99 81397 0.33% 100 23643015 95.45% 24770179 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=43.93 fanout-score-rank=8 prefix-density=0.45 prefix-fanout=32.7 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTATGCCGTCTTCTGCTTGAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=19 fanout-score=288.07 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=28.8 sequence=TTCTTCTTCTTT Started job on | Apr 10 12:56:00 Started mapping on | Apr 10 12:56:00 Finished on | Apr 10 12:56:28 Mapping speed, Million of reads per hour | 3184.74 Number of input reads | 24770179 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 23534536 Uniquely mapped reads % | 95.01% Average mapped length | 98.86 Number of splices: Total | 7004484 Number of splices: Annotated (sjdb) | 6875580 Number of splices: GT/AG | 6898539 Number of splices: GC/AG | 87579 Number of splices: AT/AC | 6970 Number of splices: Non-canonical | 11396 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 1.98 Insertion rate per base | 0.01% Insertion average length | 1.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 542523 % of reads mapped to multiple loci | 2.19% Number of reads mapped to too many loci | 223884 % of reads mapped to too many loci | 0.90% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.89% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 693120 693120 693120 N_multimapping 542523 542523 542523 N_noFeature 1089226 12153617 12307209 N_ambiguous 242361 39954 39859 UnstrandedReadsAssigned:22202949 PositiveStrandReadsAssigned:11340965 NegativeStrandReadsAssigned:11187468 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207922 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207922-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,770,179 reads, 22,824,641 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,219 rounds 52401 SRR3207922.ke.tsv 34699 SRR3207922.se.tsv 87100 total ==> SRR3207922.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 600 20.8853 Potri.005G024800.1.v4.1 1035 936 90 6.42289 Potri.004G059700.1.v4.1 961 862 11 0.852411 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 426.399 10.015 Potri.016G087400.1.v4.1 270 171 943 368.366 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 112 4.46916 Potri.012G127500.1.v4.1 977 878 2444 185.939 ==> SRR3207922.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2599 Potri.001G233950.v4.1 6 Potri.001G122700.v4.1 374 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 84 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 10 SRR3207922 completed mapping pipeline successfully