Starting /dee2/code/volunteer_pipeline.sh SRR3207923 current disk space = 3048319389696 free memory = 1580265504 SRR3207923 SRAfilesize 737cdb278c624bd4c03fd06f4ec7905c SRR3207923.sra SRR3207923.sra file validated SRR3207923 is single end SRR3207923 is conventional basespace SRR3207923 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207923_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.12675 34.0 33.0 34.0 31.0 34.0 2 33.26975 34.0 34.0 34.0 31.0 34.0 3 33.296 34.0 34.0 34.0 31.0 34.0 4 36.5455 37.0 37.0 37.0 35.0 37.0 5 36.46425 37.0 37.0 37.0 35.0 37.0 6 36.43625 37.0 37.0 37.0 35.0 37.0 7 36.41675 37.0 37.0 37.0 35.0 37.0 8 36.37275 37.0 37.0 37.0 35.0 37.0 9 38.28275 39.0 39.0 39.0 37.0 39.0 10-11 38.248000000000005 39.0 39.0 39.0 37.0 39.0 12-13 37.94625 39.0 39.0 39.0 36.0 39.0 14-15 39.8595 41.0 40.0 41.0 38.0 41.0 16-17 39.869375000000005 41.0 40.0 41.0 38.0 41.0 18-19 39.783125 41.0 40.0 41.0 38.0 41.0 20-21 39.796875 41.0 40.0 41.0 37.5 41.0 22-23 39.787125 41.0 40.0 41.0 38.0 41.0 24-25 39.776875000000004 41.0 40.0 41.0 37.5 41.0 26-27 39.714875 41.0 40.0 41.0 37.5 41.0 28-29 39.565125 41.0 40.0 41.0 37.0 41.0 30-31 39.453625 41.0 40.0 41.0 37.0 41.0 32-33 39.4015 41.0 40.0 41.0 36.0 41.0 34-35 39.340875 41.0 40.0 41.0 36.0 41.0 36-37 39.261624999999995 41.0 39.0 41.0 36.0 41.0 38-39 39.1845 41.0 39.0 41.0 36.0 41.0 40-41 39.051625 40.5 39.0 41.0 35.5 41.0 42-43 39.115750000000006 40.5 39.0 41.0 36.0 41.0 44-45 38.925 41.0 39.0 41.0 35.0 41.0 46-47 38.9765 41.0 39.0 41.0 35.0 41.0 48-49 38.994 41.0 39.0 41.0 35.0 41.0 50-51 39.1105 41.0 39.0 41.0 35.0 41.0 52-53 39.1445 41.0 39.0 41.0 35.0 41.0 54-55 38.88225 41.0 39.0 41.0 35.0 41.0 56-57 38.81675 41.0 39.0 41.0 35.0 41.0 58-59 38.543875 40.0 38.0 41.0 34.5 41.0 60-61 38.494875 40.0 37.5 41.0 35.0 41.0 62-63 38.1575 40.0 37.0 41.0 34.0 41.0 64-65 37.93025 39.5 37.0 41.0 34.0 41.0 66-67 37.601625 39.0 36.0 41.0 34.0 41.0 68-69 37.225875 39.0 36.0 41.0 34.0 41.0 70-71 36.775875 37.5 35.0 40.0 34.0 41.0 72-73 36.313125 37.0 35.0 39.0 33.0 41.0 74-75 35.975125000000006 36.5 35.0 39.0 33.0 41.0 76-77 35.022 36.0 34.5 37.5 31.5 39.0 78-79 35.002750000000006 35.5 35.0 37.0 32.0 39.0 80-81 34.80175 35.0 35.0 37.0 32.0 39.0 82-83 34.4975 35.0 35.0 36.0 32.0 37.0 84-85 34.297 35.0 35.0 36.0 32.0 37.0 86-87 34.063375 35.0 35.0 36.0 32.0 36.5 88-89 33.8675 35.0 35.0 35.0 32.0 36.0 90-91 33.557125 35.0 34.0 35.0 31.0 36.0 92-93 33.349374999999995 35.0 34.0 35.0 31.0 36.0 94-95 33.3955 35.0 34.0 35.0 31.0 36.0 96-97 33.332125000000005 35.0 34.0 35.0 31.0 35.5 98-99 33.230875 35.0 34.0 35.0 31.0 35.0 100 33.06775 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 2.0 12 0.0 13 1.0 14 4.0 15 2.0 16 5.0 17 1.0 18 3.0 19 3.0 20 7.0 21 6.0 22 5.0 23 5.0 24 10.0 25 13.0 26 8.0 27 21.0 28 22.0 29 20.0 30 34.0 31 46.0 32 64.0 33 75.0 34 103.0 35 132.0 36 306.0 37 725.0 38 1768.0 39 606.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.8 14.575 12.675 47.949999999999996 2 17.150000000000002 22.0 39.725 21.125 3 22.05 23.375 27.250000000000004 27.325 4 24.6 30.349999999999998 19.85 25.2 5 24.61230615307654 35.06753376688344 22.36118059029515 17.958979489744873 6 19.225 36.975 25.474999999999998 18.325 7 18.075 21.5 40.949999999999996 19.475 8 18.75 24.4 32.175 24.675 9 19.45 24.8 32.675 23.075000000000003 10-11 23.1 34.3375 22.875 19.6875 12-13 21.1125 27.237499999999997 29.262500000000003 22.3875 14-15 21.087500000000002 28.425 28.4125 22.075 16-17 22.175 28.0875 27.8125 21.925 18-19 21.625 28.499999999999996 28.475 21.4 20-21 23.150000000000002 28.125 27.9375 20.7875 22-23 21.762500000000003 28.6375 27.975 21.625 24-25 20.877609701212652 28.82860357544693 28.141017627203404 22.152769096137018 26-27 21.912499999999998 28.749999999999996 28.575 20.7625 28-29 21.546546546546548 28.428428428428425 28.053053053053052 21.97197197197197 30-31 20.750938673341675 28.936170212765955 28.147684605757195 22.165206508135167 32-33 21.925 28.4125 28.0625 21.6 34-35 22.162499999999998 28.599999999999998 27.5875 21.65 36-37 21.8125 28.999999999999996 27.05 22.1375 38-39 21.45 28.825 28.625 21.099999999999998 40-41 21.325 27.9125 29.099999999999998 21.6625 42-43 21.5375 28.6875 27.1625 22.6125 44-45 21.5 29.262500000000003 27.5875 21.65 46-47 22.1875 27.575 28.1375 22.1 48-49 21.512500000000003 28.975 27.6375 21.875 50-51 21.375 28.487499999999997 28.499999999999996 21.637500000000003 52-53 21.725 29.012500000000003 27.5875 21.675 54-55 21.8 27.712500000000002 27.650000000000002 22.8375 56-57 21.4375 29.325000000000003 27.6 21.637500000000003 58-59 21.775 28.8875 28.1 21.2375 60-61 21.15 28.5625 28.212500000000002 22.075 62-63 21.325 29.2875 27.3 22.0875 64-65 21.5375 29.612500000000004 27.35 21.5 66-67 22.0125 28.725 27.787499999999998 21.475 68-69 21.325 29.1625 27.825 21.6875 70-71 22.25 29.4875 26.85 21.4125 72-73 21.775 28.625 28.0625 21.5375 74-75 20.7375 29.549999999999997 28.1375 21.575 76-77 21.55 28.6125 27.6125 22.225 78-79 21.762500000000003 28.65 27.962500000000002 21.625 80-81 21.762500000000003 29.7875 26.787499999999998 21.6625 82-83 21.9 28.325 28.15 21.625 84-85 21.75 28.725 28.050000000000004 21.475 86-87 23.05 28.299999999999997 28.1375 20.5125 88-89 22.05 28.3625 28.4375 21.15 90-91 21.8625 29.1125 28.037499999999998 20.9875 92-93 21.349999999999998 29.6875 27.800000000000004 21.1625 94-95 21.6875 29.549999999999997 27.6125 21.15 96-97 21.825 28.462500000000002 28.512500000000003 21.2 98-99 22.5 28.15 27.9375 21.4125 100 22.45 27.900000000000002 27.3 22.35 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 2.0 23 2.0 24 4.0 25 6.0 26 4.5 27 3.0 28 4.0 29 8.5 30 16.5 31 22.0 32 32.5 33 49.0 34 60.0 35 83.0 36 110.5 37 129.0 38 151.5 39 180.0 40 215.0 41 246.0 42 259.0 43 263.5 44 278.0 45 276.5 46 254.5 47 246.5 48 234.5 49 184.0 50 143.5 51 123.0 52 96.5 53 76.0 54 56.0 55 39.5 56 30.0 57 26.5 58 18.5 59 8.5 60 5.5 61 9.5 62 8.0 63 3.5 64 3.5 65 5.0 66 5.0 67 4.0 68 2.0 69 1.5 70 2.5 71 1.5 72 1.5 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0125 26-27 0.0 28-29 0.1 30-31 0.125 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.874749498998 99.675 2 0.1002004008016032 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0250501002004008 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGC 5 0.125 TruSeq Adapter, Index 2 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0125 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.037500000000000006 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88 0.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1328344 spots for SRR3207923.sra Written 1328344 spots for SRR3207923.sra Read 1328344 spots for SRR3207923.sra Written 1328344 spots for SRR3207923.sra Read 1328344 spots for SRR3207923.sra Written 1328344 spots for SRR3207923.sra Read 1328344 spots for SRR3207923.sra Written 1328344 spots for SRR3207923.sra Read 1328344 spots for SRR3207923.sra Written 1328344 spots for SRR3207923.sra Read 1328344 spots for SRR3207923.sra Written 1328344 spots for SRR3207923.sra Read 1328344 spots for SRR3207923.sra Written 1328344 spots for SRR3207923.sra Read 1328344 spots for SRR3207923.sra Written 1328344 spots for SRR3207923.sra Read 1328344 spots for SRR3207923.sra Written 1328344 spots for SRR3207923.sra Read 1328344 spots for SRR3207923.sra Written 1328344 spots for SRR3207923.sra Read 1328344 spots for SRR3207923.sra Written 1328344 spots for SRR3207923.sra Read 1328344 spots for SRR3207923.sra Written 1328344 spots for SRR3207923.sra Read 1328344 spots for SRR3207923.sra Written 1328344 spots for SRR3207923.sra Read 1328344 spots for SRR3207923.sra Written 1328344 spots for SRR3207923.sra Read 1328344 spots for SRR3207923.sra Written 1328344 spots for SRR3207923.sra Read 1328353 spots for SRR3207923.sra Written 1328353 spots for SRR3207923.sra Read 1328344 spots for SRR3207923.sra Written 1328344 spots for SRR3207923.sra Read 1328344 spots for SRR3207923.sra Written 1328344 spots for SRR3207923.sra Read 1328344 spots for SRR3207923.sra Written 1328344 spots for SRR3207923.sra Read 1328344 spots for SRR3207923.sra Written 1328344 spots for SRR3207923.sra SRR ids: ['SRR3207923.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ydf25gdi SRR3207923.sra spots: 26566889 blocks: [[1, 1328344], [1328345, 2656688], [2656689, 3985032], [3985033, 5313376], [5313377, 6641720], [6641721, 7970064], [7970065, 9298408], [9298409, 10626752], [10626753, 11955096], [11955097, 13283440], [13283441, 14611784], [14611785, 15940128], [15940129, 17268472], [17268473, 18596816], [18596817, 19925160], [19925161, 21253504], [21253505, 22581848], [22581849, 23910192], [23910193, 25238536], [25238537, 26566889]] SRR3207923 file size 6903028 SRR3207923 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207923 SRR3207923_1.fastq Input file: SRR3207923_1.fastq trimmed: SRR3207923-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 17:10:14 2025 >> started Tue Feb 11 17:10:27 2025 >> done (13.022s) 26566889 reads processed; of these: 2324 ( 0.01%) short reads filtered out after trimming by size control 34451 ( 0.13%) empty reads filtered out after trimming by size control 26530114 (99.86%) reads available; of these: 1002799 ( 3.78%) trimmed reads available after processing 25527315 (96.22%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 345 0.00% 19 436 0.00% 20 549 0.00% 21 792 0.00% 22 1130 0.00% 23 1545 0.01% 24 2184 0.01% 25 2674 0.01% 26 2778 0.01% 27 2826 0.01% 28 2841 0.01% 29 2964 0.01% 30 2993 0.01% 31 3070 0.01% 32 3270 0.01% 33 3303 0.01% 34 3577 0.01% 35 3509 0.01% 36 3632 0.01% 37 3685 0.01% 38 3890 0.01% 39 3959 0.01% 40 4152 0.02% 41 4316 0.02% 42 4478 0.02% 43 4634 0.02% 44 4589 0.02% 45 4876 0.02% 46 4967 0.02% 47 5000 0.02% 48 5289 0.02% 49 5610 0.02% 50 5334 0.02% 51 5690 0.02% 52 5890 0.02% 53 6085 0.02% 54 6223 0.02% 55 6631 0.02% 56 6925 0.03% 57 7148 0.03% 58 7167 0.03% 59 7403 0.03% 60 7514 0.03% 61 7770 0.03% 62 7909 0.03% 63 8099 0.03% 64 8239 0.03% 65 8474 0.03% 66 8876 0.03% 67 9191 0.03% 68 9803 0.04% 69 9551 0.04% 70 9744 0.04% 71 10209 0.04% 72 10536 0.04% 73 11186 0.04% 74 11757 0.04% 75 11318 0.04% 76 8330 0.03% 77 9250 0.03% 78 10349 0.04% 79 11004 0.04% 80 12013 0.05% 81 12725 0.05% 82 13644 0.05% 83 14846 0.06% 84 15495 0.06% 85 16461 0.06% 86 17482 0.07% 87 18866 0.07% 88 20315 0.08% 89 22320 0.08% 90 24712 0.09% 91 27351 0.10% 92 30865 0.12% 93 34765 0.13% 94 40653 0.15% 95 47763 0.18% 96 56545 0.21% 97 66958 0.25% 98 74065 0.28% 99 77487 0.29% 100 25527315 96.22% 26530114 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=16.30 fanout-score-rank=22 prefix-density=0.12 prefix-fanout=16.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=9 fanout-score=295.02 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=28.0 sequence=TTCTTCTTCTTT Started job on | Feb 11 17:10:44 Started mapping on | Feb 11 17:10:44 Finished on | Feb 11 17:11:07 Mapping speed, Million of reads per hour | 4152.54 Number of input reads | 26530114 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 25463003 Uniquely mapped reads % | 95.98% Average mapped length | 98.97 Number of splices: Total | 7648029 Number of splices: Annotated (sjdb) | 7504942 Number of splices: GT/AG | 7527638 Number of splices: GC/AG | 99520 Number of splices: AT/AC | 7599 Number of splices: Non-canonical | 13272 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 2.07 Insertion rate per base | 0.01% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 589842 % of reads mapped to multiple loci | 2.22% Number of reads mapped to too many loci | 169956 % of reads mapped to too many loci | 0.64% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.15% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 477269 477269 477269 N_multimapping 589842 589842 589842 N_noFeature 1136737 13214459 13225811 N_ambiguous 252036 46184 46810 UnstrandedReadsAssigned:24074230 PositiveStrandReadsAssigned:12202360 NegativeStrandReadsAssigned:12190382 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207923 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207923-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,530,114 reads, 24,711,590 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,212 rounds 52401 SRR3207923.ke.tsv 34699 SRR3207923.se.tsv 87100 total ==> SRR3207923.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1009.54 31.6567 Potri.005G024800.1.v4.1 1035 936 336 21.6013 Potri.004G059700.1.v4.1 961 862 23 1.6056 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 638.526 13.5103 Potri.016G087400.1.v4.1 270 171 863 303.69 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 438.482 15.762 Potri.012G127500.1.v4.1 977 878 3009 206.226 ==> SRR3207923.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2680 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 519 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 69 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 55 SRR3207923 completed mapping pipeline successfully