Starting /dee2/code/volunteer_pipeline.sh SRR3207924 current disk space = 3049220235264 free memory = 1505131964 SRR3207924 SRAfilesize 7fdb7102f91b0f18ab6f3d879ac4f3d2 SRR3207924.sra SRR3207924.sra file validated SRR3207924 is single end SRR3207924 is conventional basespace SRR3207924 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207924_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.952 34.0 31.0 34.0 31.0 34.0 2 33.1455 34.0 34.0 34.0 31.0 34.0 3 33.26125 34.0 34.0 34.0 31.0 34.0 4 36.559 37.0 37.0 37.0 35.0 37.0 5 36.433 37.0 37.0 37.0 35.0 37.0 6 36.359 37.0 37.0 37.0 35.0 37.0 7 36.3445 37.0 37.0 37.0 35.0 37.0 8 36.33225 37.0 37.0 37.0 35.0 37.0 9 38.2645 39.0 39.0 39.0 37.0 39.0 10-11 38.174625 39.0 39.0 39.0 37.0 39.0 12-13 38.295249999999996 39.0 39.0 39.0 37.0 39.0 14-15 39.822874999999996 41.0 40.0 41.0 38.0 41.0 16-17 39.834374999999994 41.0 40.0 41.0 38.0 41.0 18-19 39.835125000000005 41.0 40.0 41.0 38.0 41.0 20-21 39.858374999999995 41.0 40.0 41.0 38.0 41.0 22-23 39.678 41.0 40.0 41.0 37.5 41.0 24-25 39.767875000000004 41.0 40.0 41.0 38.0 41.0 26-27 39.65875 41.0 40.0 41.0 37.0 41.0 28-29 39.50275 41.0 40.0 41.0 37.0 41.0 30-31 39.3695 41.0 40.0 41.0 37.0 41.0 32-33 39.342124999999996 41.0 40.0 41.0 36.5 41.0 34-35 39.3335 41.0 39.0 41.0 36.0 41.0 36-37 39.224000000000004 41.0 39.0 41.0 36.0 41.0 38-39 39.127750000000006 40.5 39.0 41.0 36.0 41.0 40-41 39.077375 40.0 39.0 41.0 35.5 41.0 42-43 39.097 40.5 39.0 41.0 35.5 41.0 44-45 39.153 41.0 39.0 41.0 36.0 41.0 46-47 39.066375 40.5 39.0 41.0 36.0 41.0 48-49 38.945625 40.0 39.0 41.0 35.5 41.0 50-51 39.112125 41.0 39.0 41.0 35.5 41.0 52-53 39.06162500000001 41.0 39.0 41.0 35.0 41.0 54-55 38.963 41.0 39.0 41.0 35.0 41.0 56-57 38.925875000000005 41.0 39.0 41.0 35.0 41.0 58-59 38.644999999999996 40.5 38.0 41.0 35.0 41.0 60-61 38.20975 40.0 37.0 41.0 34.0 41.0 62-63 38.255875 40.0 37.0 41.0 34.0 41.0 64-65 37.917249999999996 39.5 37.0 41.0 34.0 41.0 66-67 37.654875000000004 39.0 36.0 41.0 34.0 41.0 68-69 37.172875000000005 39.0 36.0 41.0 34.0 41.0 70-71 36.62325 37.5 35.0 40.0 33.0 41.0 72-73 36.1095 37.0 35.0 39.0 32.5 41.0 74-75 35.710375 36.5 35.0 39.0 32.0 40.5 76-77 34.635999999999996 36.0 34.0 37.0 30.5 39.0 78-79 34.68675 35.5 35.0 37.0 31.5 39.0 80-81 34.527874999999995 35.0 35.0 37.0 32.0 39.0 82-83 34.206625 35.0 35.0 36.0 31.5 37.0 84-85 34.002250000000004 35.0 35.0 36.0 31.5 37.0 86-87 33.83625 35.0 35.0 36.0 32.0 36.5 88-89 33.5815 35.0 34.0 35.0 31.0 36.0 90-91 33.431125 35.0 34.0 35.0 31.0 36.0 92-93 33.313625 35.0 34.0 35.0 31.0 36.0 94-95 33.23375 35.0 34.0 35.0 31.0 36.0 96-97 33.171875 35.0 34.0 35.0 31.0 35.5 98-99 33.053375 35.0 34.0 35.0 31.0 35.0 100 32.94175 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 2.0 9 1.0 10 0.0 11 1.0 12 4.0 13 0.0 14 2.0 15 5.0 16 3.0 17 6.0 18 5.0 19 4.0 20 4.0 21 5.0 22 3.0 23 6.0 24 7.0 25 14.0 26 9.0 27 24.0 28 24.0 29 24.0 30 30.0 31 34.0 32 46.0 33 96.0 34 119.0 35 150.0 36 288.0 37 763.0 38 1747.0 39 571.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.8008008008008 16.14114114114114 15.165165165165165 42.892892892892895 2 18.8 25.0 38.2 18.0 3 19.975 27.875 28.599999999999998 23.549999999999997 4 24.45 32.824999999999996 20.825 21.9 5 23.799999999999997 36.65 22.475 17.075000000000003 6 17.724999999999998 37.724999999999994 24.375 20.175 7 17.275 18.4 43.15 21.175 8 18.325 24.025 30.675 26.974999999999998 9 20.424999999999997 22.725 31.8 25.05 10-11 22.45 33.6875 22.8375 21.025 12-13 19.787499999999998 27.437499999999996 29.6625 23.1125 14-15 21.375 27.450000000000003 29.575000000000003 21.6 16-17 21.625 28.1125 27.775 22.4875 18-19 21.8875 27.1 28.525 22.4875 20-21 22.1 28.625 28.125 21.15 22-23 21.6125 29.4875 27.1625 21.7375 24-25 21.5375 28.9125 27.650000000000002 21.9 26-27 21.0625 28.875 28.037499999999998 22.025 28-29 21.50551102204409 28.882765531062127 28.46943887775551 21.142284569138276 30-31 21.381991472284927 27.915726109857037 28.793579132179588 21.908703285678456 32-33 22.0 28.712500000000002 27.437499999999996 21.85 34-35 21.7875 29.012500000000003 27.6125 21.587500000000002 36-37 21.95 27.800000000000004 27.962500000000002 22.287499999999998 38-39 21.725 28.5625 28.3875 21.325 40-41 22.375 28.549999999999997 27.750000000000004 21.325 42-43 21.05 29.349999999999998 27.462500000000002 22.1375 44-45 21.825 28.799999999999997 28.212500000000002 21.1625 46-47 21.6 29.125 27.725 21.55 48-49 21.8875 27.8375 28.625 21.65 50-51 21.5375 28.5875 28.3375 21.5375 52-53 21.425 28.449999999999996 28.1375 21.987499999999997 54-55 21.3875 27.9375 29.312500000000004 21.3625 56-57 22.7 28.125 28.075 21.099999999999998 58-59 21.8 28.999999999999996 28.3875 20.8125 60-61 21.3875 28.4125 28.249999999999996 21.95 62-63 21.325 28.0625 28.5625 22.05 64-65 21.4 29.075 27.925 21.6 66-67 22.4625 29.025000000000002 27.6 20.9125 68-69 20.6375 28.9875 29.262500000000003 21.1125 70-71 21.9375 27.800000000000004 28.4375 21.825 72-73 21.575 28.3625 29.012500000000003 21.05 74-75 21.912499999999998 28.6875 28.599999999999998 20.8 76-77 21.762500000000003 28.299999999999997 28.1875 21.75 78-79 21.525 28.7 28.1875 21.587500000000002 80-81 21.925 28.9125 27.725 21.4375 82-83 21.7875 28.9125 28.625 20.674999999999997 84-85 21.5625 28.5625 28.512500000000003 21.3625 86-87 21.712500000000002 28.050000000000004 28.9875 21.25 88-89 21.462500000000002 28.675 28.625 21.2375 90-91 22.625 28.225 27.9125 21.2375 92-93 21.55 28.775000000000002 28.075 21.6 94-95 21.6625 28.025 28.0625 22.25 96-97 22.45 28.349999999999998 27.950000000000003 21.25 98-99 21.5375 29.4125 28.3125 20.7375 100 22.75 28.15 27.375 21.725 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 1.0 24 4.0 25 5.0 26 7.5 27 9.5 28 9.5 29 15.0 30 21.0 31 28.0 32 41.5 33 54.5 34 70.0 35 97.5 36 104.0 37 111.5 38 156.0 39 185.0 40 202.0 41 223.0 42 253.0 43 267.0 44 265.5 45 272.5 46 273.5 47 247.0 48 205.0 49 182.0 50 157.5 51 129.0 52 103.5 53 76.0 54 60.0 55 46.5 56 30.5 57 21.5 58 14.5 59 14.5 60 9.5 61 3.5 62 3.5 63 4.5 64 3.5 65 1.5 66 1.0 67 2.5 68 1.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.2 30-31 0.325 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8743086978381 99.325 2 0.10055304172951231 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025138260432378077 0.475 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGC 19 0.475 TruSeq Adapter, Index 6 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.037500000000000006 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88 0.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1444382 spots for SRR3207924.sra Written 1444382 spots for SRR3207924.sra Read 1444382 spots for SRR3207924.sra Written 1444382 spots for SRR3207924.sra Read 1444382 spots for SRR3207924.sra Written 1444382 spots for SRR3207924.sra Read 1444382 spots for SRR3207924.sra Written 1444382 spots for SRR3207924.sra Read 1444382 spots for SRR3207924.sra Written 1444382 spots for SRR3207924.sra Read 1444382 spots for SRR3207924.sra Written 1444382 spots for SRR3207924.sra Read 1444382 spots for SRR3207924.sra Written 1444382 spots for SRR3207924.sra Read 1444382 spots for SRR3207924.sra Written 1444382 spots for SRR3207924.sra Read 1444382 spots for SRR3207924.sra Written 1444382 spots for SRR3207924.sra Read 1444382 spots for SRR3207924.sra Written 1444382 spots for SRR3207924.sra Read 1444382 spots for SRR3207924.sra Written 1444382 spots for SRR3207924.sra Read 1444399 spots for SRR3207924.sra Written 1444399 spots for SRR3207924.sra Read 1444382 spots for SRR3207924.sra Written 1444382 spots for SRR3207924.sra Read 1444382 spots for SRR3207924.sra Written 1444382 spots for SRR3207924.sra Read 1444382 spots for SRR3207924.sra Written 1444382 spots for SRR3207924.sra Read 1444382 spots for SRR3207924.sra Written 1444382 spots for SRR3207924.sra Read 1444382 spots for SRR3207924.sra Written 1444382 spots for SRR3207924.sra Read 1444382 spots for SRR3207924.sra Written 1444382 spots for SRR3207924.sra Read 1444382 spots for SRR3207924.sra Written 1444382 spots for SRR3207924.sra Read 1444382 spots for SRR3207924.sra Written 1444382 spots for SRR3207924.sra SRR ids: ['SRR3207924.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_c9pjclil SRR3207924.sra spots: 28887657 blocks: [[1, 1444382], [1444383, 2888764], [2888765, 4333146], [4333147, 5777528], [5777529, 7221910], [7221911, 8666292], [8666293, 10110674], [10110675, 11555056], [11555057, 12999438], [12999439, 14443820], [14443821, 15888202], [15888203, 17332584], [17332585, 18776966], [18776967, 20221348], [20221349, 21665730], [21665731, 23110112], [23110113, 24554494], [24554495, 25998876], [25998877, 27443258], [27443259, 28887657]] SRR3207924 file size 7506909 SRR3207924 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207924 SRR3207924_1.fastq Input file: SRR3207924_1.fastq trimmed: SRR3207924-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 16:10:34 2025 >> started Tue Feb 11 16:10:49 2025 >> done (15.039s) 28887657 reads processed; of these: 1882 ( 0.01%) short reads filtered out after trimming by size control 180302 ( 0.62%) empty reads filtered out after trimming by size control 28705473 (99.37%) reads available; of these: 1202505 ( 4.19%) trimmed reads available after processing 27502968 (95.81%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 366 0.00% 19 427 0.00% 20 623 0.00% 21 781 0.00% 22 1174 0.00% 23 1579 0.01% 24 2312 0.01% 25 2940 0.01% 26 3170 0.01% 27 3134 0.01% 28 3093 0.01% 29 3146 0.01% 30 3224 0.01% 31 3298 0.01% 32 3509 0.01% 33 3544 0.01% 34 3736 0.01% 35 3961 0.01% 36 4052 0.01% 37 4282 0.01% 38 4456 0.02% 39 4577 0.02% 40 4595 0.02% 41 4937 0.02% 42 5033 0.02% 43 5165 0.02% 44 5442 0.02% 45 5795 0.02% 46 5762 0.02% 47 6177 0.02% 48 6426 0.02% 49 6623 0.02% 50 6447 0.02% 51 6881 0.02% 52 6865 0.02% 53 7239 0.03% 54 7662 0.03% 55 7853 0.03% 56 8062 0.03% 57 8203 0.03% 58 8740 0.03% 59 8930 0.03% 60 9191 0.03% 61 9456 0.03% 62 9634 0.03% 63 9886 0.03% 64 10233 0.04% 65 10499 0.04% 66 10937 0.04% 67 11735 0.04% 68 12691 0.04% 69 13127 0.05% 70 12117 0.04% 71 12108 0.04% 72 12610 0.04% 73 13188 0.05% 74 13900 0.05% 75 13854 0.05% 76 9911 0.03% 77 10938 0.04% 78 11941 0.04% 79 13203 0.05% 80 14240 0.05% 81 15383 0.05% 82 16311 0.06% 83 17591 0.06% 84 18401 0.06% 85 19840 0.07% 86 20859 0.07% 87 22251 0.08% 88 24077 0.08% 89 27065 0.09% 90 29431 0.10% 91 32343 0.11% 92 37060 0.13% 93 42388 0.15% 94 49358 0.17% 95 59038 0.21% 96 69428 0.24% 97 80232 0.28% 98 88980 0.31% 99 92849 0.32% 100 27502968 95.81% 28705473 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=45.59 fanout-score-rank=8 prefix-density=0.46 prefix-fanout=32.6 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTGAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=18 fanout-score=276.91 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=27.3 sequence=TTCTTCTTCTTT Started job on | Feb 11 16:11:05 Started mapping on | Feb 11 16:11:05 Finished on | Feb 11 16:11:31 Mapping speed, Million of reads per hour | 3974.60 Number of input reads | 28705473 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 27708331 Uniquely mapped reads % | 96.53% Average mapped length | 98.90 Number of splices: Total | 8396038 Number of splices: Annotated (sjdb) | 8245411 Number of splices: GT/AG | 8270649 Number of splices: GC/AG | 104094 Number of splices: AT/AC | 8193 Number of splices: Non-canonical | 13102 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 1.98 Insertion rate per base | 0.02% Insertion average length | 1.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 570405 % of reads mapped to multiple loci | 1.99% Number of reads mapped to too many loci | 169290 % of reads mapped to too many loci | 0.59% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.89% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 426737 426737 426737 N_multimapping 570405 570405 570405 N_noFeature 1248190 14232506 14542085 N_ambiguous 273189 45908 45735 UnstrandedReadsAssigned:26186952 PositiveStrandReadsAssigned:13429917 NegativeStrandReadsAssigned:13120511 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207924 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207924-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,705,473 reads, 26,797,877 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,076 rounds 52401 SRR3207924.ke.tsv 34699 SRR3207924.se.tsv 87100 total ==> SRR3207924.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 582 17.6487 Potri.005G024800.1.v4.1 1035 936 70 4.35198 Potri.004G059700.1.v4.1 961 862 14 0.945116 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 474.39 9.70668 Potri.016G087400.1.v4.1 270 171 955 324.991 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 87 3.02432 Potri.012G127500.1.v4.1 977 878 2610 172.986 ==> SRR3207924.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3355 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 485 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 62 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR3207924 completed mapping pipeline successfully