Starting /dee2/code/volunteer_pipeline.sh SRR3207925 current disk space = 3049419599872 free memory = 1425885600 SRR3207925 SRAfilesize 09d2551193b7e5c8f41ed9d2b8919da7 SRR3207925.sra SRR3207925.sra file validated SRR3207925 is single end SRR3207925 is conventional basespace SRR3207925 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207925_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 42 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.942 34.0 31.0 34.0 31.0 34.0 2 33.1685 34.0 33.0 34.0 31.0 34.0 3 33.17225 34.0 34.0 34.0 31.0 34.0 4 36.4755 37.0 37.0 37.0 35.0 37.0 5 36.38775 37.0 37.0 37.0 35.0 37.0 6 36.30525 37.0 37.0 37.0 35.0 37.0 7 36.32175 37.0 37.0 37.0 35.0 37.0 8 36.33025 37.0 37.0 37.0 35.0 37.0 9 38.2575 39.0 39.0 39.0 37.0 39.0 10-11 38.165375 39.0 39.0 39.0 37.0 39.0 12-13 38.211625 39.0 39.0 39.0 37.0 39.0 14-15 39.773125 41.0 40.0 41.0 37.5 41.0 16-17 39.672 41.0 40.0 41.0 37.0 41.0 18-19 39.766999999999996 41.0 40.0 41.0 37.0 41.0 20-21 39.802875 41.0 40.0 41.0 37.5 41.0 22-23 39.69225 41.0 40.0 41.0 37.0 41.0 24-25 39.67175 41.0 40.0 41.0 37.0 41.0 26-27 39.618 41.0 40.0 41.0 37.0 41.0 28-29 39.5275 41.0 40.0 41.0 37.0 41.0 30-31 39.419875000000005 41.0 40.0 41.0 37.0 41.0 32-33 39.38225 41.0 39.5 41.0 36.5 41.0 34-35 39.295 41.0 39.0 41.0 36.5 41.0 36-37 39.178875000000005 41.0 39.0 41.0 36.0 41.0 38-39 39.133375 40.5 39.0 41.0 36.0 41.0 40-41 39.080749999999995 40.0 39.0 41.0 36.0 41.0 42-43 39.036 40.5 39.0 41.0 35.0 41.0 44-45 39.01975 41.0 39.0 41.0 35.0 41.0 46-47 38.97175 40.0 39.0 41.0 35.5 41.0 48-49 38.882374999999996 40.0 39.0 41.0 35.0 41.0 50-51 39.176375 41.0 39.0 41.0 36.0 41.0 52-53 39.041375 41.0 39.0 41.0 35.0 41.0 54-55 38.923625 41.0 39.0 41.0 35.0 41.0 56-57 38.936375 41.0 39.0 41.0 35.0 41.0 58-59 38.575374999999994 40.0 38.0 41.0 35.0 41.0 60-61 38.247125 40.0 38.0 41.0 34.0 41.0 62-63 38.229625 40.0 37.0 41.0 34.0 41.0 64-65 37.827625 39.5 37.0 41.0 34.0 41.0 66-67 37.631875 39.0 36.0 41.0 34.0 41.0 68-69 37.21225 39.0 36.0 41.0 33.5 41.0 70-71 36.558125000000004 37.5 35.0 40.0 32.5 41.0 72-73 35.997749999999996 37.0 35.0 39.0 32.5 41.0 74-75 35.5845 37.0 35.0 39.0 32.0 41.0 76-77 34.634375 35.5 34.0 37.0 30.5 39.0 78-79 34.6235 36.0 35.0 37.0 31.0 39.0 80-81 34.545375 35.0 35.0 37.0 32.0 39.0 82-83 34.11024999999999 35.0 35.0 36.0 31.0 37.5 84-85 33.966625 35.0 35.0 36.0 31.0 37.0 86-87 33.775375 35.0 35.0 36.0 31.0 37.0 88-89 33.4725 35.0 34.0 35.0 31.0 36.0 90-91 33.334875 35.0 34.0 35.0 31.0 36.0 92-93 33.2645 35.0 34.0 35.0 31.0 36.0 94-95 33.10225 35.0 34.0 35.0 30.5 36.0 96-97 33.085375 35.0 34.0 35.0 31.0 35.5 98-99 32.963499999999996 35.0 34.0 35.0 31.0 35.0 100 32.78075 35.0 34.0 35.0 30.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 3.0 13 1.0 14 1.0 15 4.0 16 1.0 17 6.0 18 7.0 19 4.0 20 7.0 21 4.0 22 6.0 23 4.0 24 12.0 25 17.0 26 21.0 27 33.0 28 26.0 29 29.0 30 22.0 31 45.0 32 71.0 33 73.0 34 88.0 35 151.0 36 289.0 37 719.0 38 1764.0 39 589.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.131414267834796 17.4468085106383 15.819774718397998 41.60200250312891 2 19.625 24.224999999999998 38.375 17.775 3 20.175 27.925 29.5 22.400000000000002 4 22.375 34.150000000000006 22.375 21.099999999999998 5 24.356089022255563 35.3088272068017 23.25581395348837 17.079269817454364 6 18.7 36.75 24.7 19.85 7 16.05 17.775 45.275 20.9 8 19.325 23.849999999999998 30.125 26.700000000000003 9 20.674999999999997 23.05 31.525 24.75 10-11 22.5875 34.0375 22.8625 20.5125 12-13 19.275000000000002 26.8 30.562499999999996 23.3625 14-15 20.4 28.6125 27.85 23.1375 16-17 21.087500000000002 27.525 28.8625 22.525000000000002 18-19 20.9125 27.975 29.45 21.6625 20-21 21.475 28.462500000000002 28.599999999999998 21.462500000000002 22-23 20.3875 29.825000000000003 28.762500000000003 21.025 24-25 21.075 28.299999999999997 28.712500000000002 21.912499999999998 26-27 20.8 29.4 27.8125 21.987499999999997 28-29 21.8304576144036 28.844711177794448 27.38184546136534 21.94298574643661 30-31 20.712945590994373 29.055659787367105 28.667917448405255 21.56347717323327 32-33 21.212500000000002 28.487499999999997 28.199999999999996 22.1 34-35 21.6 28.712500000000002 27.762500000000003 21.925 36-37 21.099999999999998 28.537499999999998 28.249999999999996 22.112499999999997 38-39 20.7875 28.925 28.8625 21.425 40-41 22.2 27.712500000000002 29.1625 20.925 42-43 21.2875 27.9375 29.762499999999996 21.0125 44-45 22.125 28.425 27.900000000000002 21.55 46-47 20.5875 28.4125 29.4375 21.5625 48-49 20.9 28.999999999999996 29.0875 21.0125 50-51 21.4875 28.3625 28.449999999999996 21.7 52-53 21.637500000000003 28.375 28.975 21.0125 54-55 20.8 27.6 29.1875 22.412499999999998 56-57 20.325 28.4125 29.4375 21.825 58-59 21.2625 27.775 29.362500000000004 21.6 60-61 20.45 28.95 28.825 21.775 62-63 21.0375 29.175 28.5875 21.2 64-65 21.0 28.549999999999997 29.312500000000004 21.1375 66-67 21.337500000000002 29.299999999999997 28.5875 20.775 68-69 21.4875 29.275000000000002 28.0625 21.175 70-71 21.15 29.212500000000002 28.712500000000002 20.925 72-73 21.45 28.3625 29.125 21.0625 74-75 21.075 29.7 27.6125 21.6125 76-77 22.3125 28.512500000000003 28.175 21.0 78-79 21.1625 27.6875 28.875 22.275 80-81 21.349999999999998 29.2 28.199999999999996 21.25 82-83 21.5625 29.3375 27.700000000000003 21.4 84-85 21.45 28.175 28.825 21.55 86-87 21.8625 27.8875 27.6875 22.5625 88-89 21.7 29.762499999999996 27.900000000000002 20.6375 90-91 21.2 29.425 28.325 21.05 92-93 22.175 29.037499999999998 27.4125 21.375 94-95 21.349999999999998 28.0875 29.0875 21.475 96-97 21.7375 28.7 28.1625 21.4 98-99 21.475 28.749999999999996 28.4 21.375 100 21.025 29.299999999999997 27.1 22.575 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.0 21 1.0 22 0.5 23 0.5 24 2.5 25 4.0 26 4.0 27 8.5 28 15.0 29 17.5 30 19.5 31 24.5 32 43.5 33 59.0 34 68.0 35 98.5 36 124.5 37 146.0 38 169.5 39 192.5 40 208.0 41 232.5 42 252.5 43 279.0 44 288.5 45 266.5 46 263.0 47 250.5 48 215.0 49 175.5 50 135.0 51 102.0 52 86.0 53 60.0 54 46.0 55 44.5 56 29.0 57 14.5 58 12.5 59 11.5 60 6.5 61 3.0 62 5.0 63 4.0 64 1.5 65 1.0 66 0.5 67 0.5 68 1.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.025 30-31 0.0625 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77226720647774 98.575 2 0.1771255060728745 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05060728744939271 1.075 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC 29 0.7250000000000001 TruSeq Adapter, Index 7 (100% over 50bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATG 14 0.35000000000000003 TruSeq Adapter, Index 7 (100% over 49bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.4 0.0 0.0 0.0 0.0 2 0.4 0.0 0.0 0.0 0.0 3 0.4 0.0 0.0 0.0 0.0 4 0.4 0.0 0.0 0.0 0.0 5 0.4 0.0 0.0 0.0 0.0 6 0.4 0.0 0.0 0.0 0.0 7 0.4 0.0 0.0 0.0 0.0 8 0.4 0.0 0.0 0.0 0.0 9 0.4 0.0 0.0 0.0 0.0 10-11 0.4 0.0 0.0 0.0 0.0 12-13 0.4 0.0 0.0 0.0 0.0 14-15 0.4 0.0 0.0 0.0 0.0 16-17 0.4 0.0 0.0 0.0 0.0 18-19 0.4 0.0 0.0 0.0 0.0 20-21 0.4 0.0 0.0 0.0 0.0 22-23 0.4 0.0 0.0 0.0 0.0 24-25 0.4 0.0 0.0 0.0 0.0 26-27 0.4 0.0 0.0 0.0 0.0 28-29 0.4 0.0 0.0 0.0 0.0 30-31 0.4 0.0 0.0 0.0 0.0 32-33 0.4 0.0 0.0 0.0 0.0 34-35 0.4 0.0 0.0 0.0 0.0 36-37 0.4 0.0 0.0 0.0 0.0 38-39 0.4 0.0 0.0 0.0 0.0 40-41 0.4 0.0 0.0 0.0 0.0 42-43 0.4 0.0 0.0 0.0 0.0 44-45 0.4 0.0 0.0 0.0 0.0 46-47 0.4 0.0 0.0 0.0 0.0 48-49 0.4 0.0 0.0 0.0 0.0 50-51 0.4 0.0 0.0 0.0 0.0 52-53 0.4 0.0 0.0 0.0 0.0 54-55 0.4125 0.0 0.0 0.0 0.0 56-57 0.425 0.0 0.0 0.0 0.0 58-59 0.4625 0.0 0.0 0.0 0.0 60-61 0.475 0.0 0.0 0.0 0.0 62-63 0.5 0.0 0.0 0.0 0.0 64-65 0.5 0.0 0.0 0.0 0.0 66-67 0.5 0.0 0.0 0.0 0.0 68-69 0.5 0.0 0.0 0.0 0.0 70-71 0.5 0.0 0.0 0.0 0.0 72-73 0.5 0.0 0.0 0.0 0.0 74-75 0.5 0.0 0.0 0.0 0.0 76-77 0.525 0.0 0.0 0.0 0.0 78-79 0.55 0.0 0.0 0.0 0.0 80-81 0.6 0.0 0.0 0.0 0.0 82-83 0.675 0.0 0.0 0.0 0.0 84-85 0.725 0.0 0.0 0.0 0.0 86-87 0.8125 0.0 0.0 0.0 0.0 88 0.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 324085 spots for SRR3207925.sra Written 324085 spots for SRR3207925.sra Read 324085 spots for SRR3207925.sra Written 324085 spots for SRR3207925.sra Read 324085 spots for SRR3207925.sra Written 324085 spots for SRR3207925.sra Read 324085 spots for SRR3207925.sra Written 324085 spots for SRR3207925.sra Read 324085 spots for SRR3207925.sra Written 324085 spots for SRR3207925.sra Read 324085 spots for SRR3207925.sra Written 324085 spots for SRR3207925.sra Read 324085 spots for SRR3207925.sra Written 324085 spots for SRR3207925.sra Read 324085 spots for SRR3207925.sra Written 324085 spots for SRR3207925.sra Read 324085 spots for SRR3207925.sra Written 324085 spots for SRR3207925.sra Read 324085 spots for SRR3207925.sra Written 324085 spots for SRR3207925.sra Read 324085 spots for SRR3207925.sra Written 324085 spots for SRR3207925.sra Read 324085 spots for SRR3207925.sra Written 324085 spots for SRR3207925.sra Read 324085 spots for SRR3207925.sra Written 324085 spots for SRR3207925.sra Read 324085 spots for SRR3207925.sra Written 324085 spots for SRR3207925.sra Read 324085 spots for SRR3207925.sra Written 324085 spots for SRR3207925.sra Read 324085 spots for SRR3207925.sra Written 324085 spots for SRR3207925.sra Read 324085 spots for SRR3207925.sra Written 324085 spots for SRR3207925.sra Read 324085 spots for SRR3207925.sra Written 324085 spots for SRR3207925.sra Read 324085 spots for SRR3207925.sra Written 324085 spots for SRR3207925.sra Read 324085 spots for SRR3207925.sra Written 324085 spots for SRR3207925.sra SRR ids: ['SRR3207925.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w7olunqv SRR3207925.sra spots: 6481700 blocks: [[1, 324085], [324086, 648170], [648171, 972255], [972256, 1296340], [1296341, 1620425], [1620426, 1944510], [1944511, 2268595], [2268596, 2592680], [2592681, 2916765], [2916766, 3240850], [3240851, 3564935], [3564936, 3889020], [3889021, 4213105], [4213106, 4537190], [4537191, 4861275], [4861276, 5185360], [5185361, 5509445], [5509446, 5833530], [5833531, 6157615], [6157616, 6481700]] SRR3207925 file size 1679390 SRR3207925 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207925 SRR3207925_1.fastq Input file: SRR3207925_1.fastq trimmed: SRR3207925-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 15:53:56 2025 >> started Tue Feb 11 15:53:59 2025 >> done (3.183s) 6481700 reads processed; of these: 391 ( 0.01%) short reads filtered out after trimming by size control 93544 ( 1.44%) empty reads filtered out after trimming by size control 6387765 (98.55%) reads available; of these: 262236 ( 4.11%) trimmed reads available after processing 6125529 (95.89%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 73 0.00% 19 121 0.00% 20 126 0.00% 21 157 0.00% 22 250 0.00% 23 388 0.01% 24 520 0.01% 25 634 0.01% 26 635 0.01% 27 641 0.01% 28 660 0.01% 29 676 0.01% 30 660 0.01% 31 708 0.01% 32 764 0.01% 33 743 0.01% 34 813 0.01% 35 843 0.01% 36 863 0.01% 37 884 0.01% 38 937 0.01% 39 981 0.02% 40 989 0.02% 41 1084 0.02% 42 1135 0.02% 43 1126 0.02% 44 1160 0.02% 45 1243 0.02% 46 1243 0.02% 47 1306 0.02% 48 1406 0.02% 49 1401 0.02% 50 1356 0.02% 51 1443 0.02% 52 1569 0.02% 53 1577 0.02% 54 1734 0.03% 55 1767 0.03% 56 1824 0.03% 57 1940 0.03% 58 1997 0.03% 59 2139 0.03% 60 2125 0.03% 61 2132 0.03% 62 2368 0.04% 63 2375 0.04% 64 2400 0.04% 65 2394 0.04% 66 2505 0.04% 67 2813 0.04% 68 3299 0.05% 69 3096 0.05% 70 2889 0.05% 71 2640 0.04% 72 2621 0.04% 73 2889 0.05% 74 2935 0.05% 75 2941 0.05% 76 2056 0.03% 77 2389 0.04% 78 2559 0.04% 79 2859 0.04% 80 3060 0.05% 81 3237 0.05% 82 3419 0.05% 83 3935 0.06% 84 3926 0.06% 85 4192 0.07% 86 4471 0.07% 87 4785 0.07% 88 5244 0.08% 89 5789 0.09% 90 6268 0.10% 91 7067 0.11% 92 7876 0.12% 93 9089 0.14% 94 10635 0.17% 95 12726 0.20% 96 14749 0.23% 97 17468 0.27% 98 19341 0.30% 99 20158 0.32% 100 6125529 95.89% 6387765 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=57.64 fanout-score-rank=10 prefix-density=0.79 prefix-fanout=39.0 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTGAAAAAAA criterion=fanout-score sequence-density=0.05 sequence-density-rank=5 fanout-score=276.95 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=29.6 sequence=TTCTTCTTCTTT Started job on | Feb 11 15:54:14 Started mapping on | Feb 11 15:54:14 Finished on | Feb 11 15:54:22 Mapping speed, Million of reads per hour | 2874.49 Number of input reads | 6387765 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 6172420 Uniquely mapped reads % | 96.63% Average mapped length | 98.85 Number of splices: Total | 1858320 Number of splices: Annotated (sjdb) | 1823569 Number of splices: GT/AG | 1829928 Number of splices: GC/AG | 23568 Number of splices: AT/AC | 1796 Number of splices: Non-canonical | 3028 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 1.99 Insertion rate per base | 0.02% Insertion average length | 1.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 126215 % of reads mapped to multiple loci | 1.98% Number of reads mapped to too many loci | 27050 % of reads mapped to too many loci | 0.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.97% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 89130 89130 89130 N_multimapping 126215 126215 126215 N_noFeature 292040 3172054 3251304 N_ambiguous 61950 10690 10283 UnstrandedReadsAssigned:5818430 PositiveStrandReadsAssigned:2989676 NegativeStrandReadsAssigned:2910833 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207925 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207925-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,387,765 reads, 5,943,661 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,169 rounds 52401 SRR3207925.ke.tsv 34699 SRR3207925.se.tsv 87100 total ==> SRR3207925.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 127 17.2748 Potri.005G024800.1.v4.1 1035 936 14 3.90423 Potri.004G059700.1.v4.1 961 862 0 0 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 93.216 8.55549 Potri.016G087400.1.v4.1 270 171 195 297.661 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 15 2.33894 Potri.012G127500.1.v4.1 977 878 536 159.351 ==> SRR3207925.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 532 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 112 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3207925 completed mapping pipeline successfully