Starting /dee2/code/volunteer_pipeline.sh SRR3207926 current disk space = 3048755884032 free memory = 1475912024 SRR3207926 SRAfilesize 5f593bbf71fa968f7780546e2e64c3b5 SRR3207926.sra SRR3207926.sra file validated SRR3207926 is single end SRR3207926 is conventional basespace SRR3207926 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207926_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0325 34.0 33.0 34.0 31.0 34.0 2 33.21725 34.0 34.0 34.0 31.0 34.0 3 33.2685 34.0 34.0 34.0 31.0 34.0 4 36.55025 37.0 37.0 37.0 35.0 37.0 5 36.466 37.0 37.0 37.0 35.0 37.0 6 36.353 37.0 37.0 37.0 35.0 37.0 7 36.333 37.0 37.0 37.0 35.0 37.0 8 36.353 37.0 37.0 37.0 35.0 37.0 9 38.27325 39.0 39.0 39.0 37.0 39.0 10-11 38.201125 39.0 39.0 39.0 37.0 39.0 12-13 38.294250000000005 39.0 39.0 39.0 37.0 39.0 14-15 39.811125 41.0 40.0 41.0 38.0 41.0 16-17 39.802375 41.0 40.0 41.0 38.0 41.0 18-19 39.834875 41.0 40.0 41.0 38.0 41.0 20-21 39.839375000000004 41.0 40.0 41.0 38.0 41.0 22-23 39.709 41.0 40.0 41.0 37.5 41.0 24-25 39.735875 41.0 40.0 41.0 38.0 41.0 26-27 39.692625 41.0 40.0 41.0 37.0 41.0 28-29 39.6165 41.0 40.0 41.0 37.0 41.0 30-31 39.562 41.0 40.0 41.0 37.0 41.0 32-33 39.499624999999995 41.0 40.0 41.0 37.0 41.0 34-35 39.44025 41.0 39.5 41.0 37.0 41.0 36-37 39.35275 41.0 39.0 41.0 36.0 41.0 38-39 39.233875 41.0 39.0 41.0 36.0 41.0 40-41 39.217124999999996 40.5 39.0 41.0 36.0 41.0 42-43 39.167125 40.5 39.0 41.0 35.5 41.0 44-45 39.233625 41.0 39.0 41.0 36.0 41.0 46-47 39.173375 41.0 39.0 41.0 36.0 41.0 48-49 39.1325 40.5 39.0 41.0 35.0 41.0 50-51 39.249375 41.0 39.0 41.0 36.0 41.0 52-53 39.22825 41.0 39.0 41.0 36.0 41.0 54-55 39.045 41.0 39.0 41.0 35.5 41.0 56-57 39.113125 41.0 39.0 41.0 35.5 41.0 58-59 38.822874999999996 41.0 38.5 41.0 35.0 41.0 60-61 38.356375 40.0 38.0 41.0 34.0 41.0 62-63 38.386875 40.0 37.0 41.0 35.0 41.0 64-65 38.098749999999995 40.0 37.0 41.0 34.0 41.0 66-67 37.860375 39.0 36.5 41.0 34.0 41.0 68-69 37.45075 39.0 36.0 41.0 34.0 41.0 70-71 36.792500000000004 37.5 35.5 40.0 33.5 41.0 72-73 36.283125 37.0 35.0 39.0 33.0 41.0 74-75 35.8675 37.0 35.0 39.0 32.5 41.0 76-77 34.83075 36.0 34.0 37.0 30.5 39.0 78-79 34.876625000000004 36.0 35.0 37.0 31.5 39.0 80-81 34.680875 35.5 35.0 37.0 32.0 39.0 82-83 34.295500000000004 35.0 35.0 36.5 31.5 37.0 84-85 34.153999999999996 35.0 35.0 36.0 32.0 37.0 86-87 33.95075 35.0 35.0 36.0 32.0 37.0 88-89 33.614374999999995 35.0 34.0 35.0 31.0 36.0 90-91 33.53575 35.0 34.0 35.0 31.0 36.0 92-93 33.422125 35.0 34.0 35.0 31.0 36.0 94-95 33.32425 35.0 34.0 35.0 31.0 36.0 96-97 33.244375 35.0 34.0 35.0 31.0 35.5 98-99 33.014125 35.0 34.0 35.0 31.0 35.0 100 32.93475 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 1.0 13 1.0 14 1.0 15 2.0 16 3.0 17 2.0 18 1.0 19 4.0 20 5.0 21 5.0 22 8.0 23 6.0 24 14.0 25 9.0 26 10.0 27 28.0 28 25.0 29 24.0 30 27.0 31 43.0 32 57.0 33 76.0 34 106.0 35 143.0 36 297.0 37 693.0 38 1763.0 39 643.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.90622655663916 16.65416354088522 15.778944736184048 42.66066516629157 2 20.200000000000003 25.525 37.95 16.325 3 20.974999999999998 27.775 27.625 23.625 4 21.0 34.849999999999994 21.275 22.875 5 25.28132033008252 35.25881470367592 22.18054513628407 17.27931982995749 6 17.4 37.075 25.525 20.0 7 16.875 17.675 45.324999999999996 20.125 8 19.25 24.575 29.599999999999998 26.575 9 21.325 22.3 32.1 24.275 10-11 22.5875 33.9125 22.8875 20.6125 12-13 19.975 27.1375 29.8375 23.05 14-15 20.75 27.6875 29.775000000000002 21.7875 16-17 22.125 28.975 27.212500000000002 21.6875 18-19 21.625 27.462500000000002 28.237499999999997 22.675 20-21 20.6625 29.599999999999998 28.0625 21.675 22-23 21.55 28.512500000000003 28.5625 21.375 24-25 20.615076884610577 29.028628578572324 28.34104263032879 22.015251906488313 26-27 21.7875 28.999999999999996 27.2625 21.95 28-29 21.46433041301627 28.735919899874844 28.435544430538172 21.364205256570713 30-31 21.870305458187282 28.743114672008012 27.804206309464195 21.58237356034051 32-33 21.15 29.549999999999997 27.487499999999997 21.8125 34-35 21.1125 29.175 28.3625 21.349999999999998 36-37 21.4125 27.537499999999998 29.062500000000004 21.987499999999997 38-39 21.8625 29.375 27.650000000000002 21.1125 40-41 21.425 28.549999999999997 29.062500000000004 20.962500000000002 42-43 21.1125 28.65 28.037499999999998 22.2 44-45 21.675 28.5625 28.249999999999996 21.512500000000003 46-47 21.912499999999998 28.3875 28.7 21.0 48-49 21.4375 29.099999999999998 28.325 21.1375 50-51 21.85 28.962500000000002 27.437499999999996 21.75 52-53 21.1625 28.025 28.8625 21.95 54-55 20.8625 29.2875 28.0875 21.762500000000003 56-57 20.875 28.525 29.262500000000003 21.337500000000002 58-59 21.8125 28.3375 28.749999999999996 21.099999999999998 60-61 21.5375 28.4 28.4 21.6625 62-63 22.525000000000002 28.4 28.262500000000003 20.8125 64-65 21.837500000000002 29.8375 27.625 20.7 66-67 21.25 29.862499999999997 27.700000000000003 21.1875 68-69 22.3625 28.999999999999996 28.349999999999998 20.2875 70-71 21.325 29.2 28.275 21.2 72-73 21.025 29.5375 28.3875 21.05 74-75 22.3375 29.25 27.437499999999996 20.974999999999998 76-77 21.925 29.4875 27.962500000000002 20.625 78-79 21.0125 29.512500000000003 28.025 21.45 80-81 22.025 28.6375 28.299999999999997 21.0375 82-83 21.6875 29.5 27.55 21.2625 84-85 21.525 28.9375 28.000000000000004 21.5375 86-87 21.725 28.95 27.6875 21.637500000000003 88-89 22.2 29.512500000000003 27.437499999999996 20.849999999999998 90-91 22.025 27.650000000000002 29.1125 21.212500000000002 92-93 21.25 29.025000000000002 28.8625 20.8625 94-95 23.5625 29.349999999999998 26.625 20.4625 96-97 21.85 29.65 27.825 20.674999999999997 98-99 22.412499999999998 28.8375 27.9125 20.837500000000002 100 23.1 28.725 26.85 21.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.0 22 1.5 23 1.5 24 2.0 25 2.0 26 3.5 27 7.0 28 10.0 29 19.0 30 26.5 31 24.0 32 31.0 33 45.5 34 64.0 35 91.5 36 118.5 37 150.5 38 172.0 39 186.0 40 199.5 41 238.0 42 269.0 43 276.5 44 292.5 45 274.5 46 256.0 47 247.0 48 217.5 49 171.5 50 141.0 51 121.0 52 92.5 53 72.0 54 48.5 55 32.0 56 22.5 57 17.5 58 16.0 59 9.5 60 5.0 61 4.5 62 3.5 63 1.5 64 2.5 65 2.0 66 0.5 67 1.0 68 1.0 69 1.5 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0125 26-27 0.0 28-29 0.125 30-31 0.15 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82341069626641 98.925 2 0.12613521695257315 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.050454086781029264 0.8250000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGC 23 0.575 TruSeq Adapter, Index 12 (100% over 50bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATG 10 0.25 TruSeq Adapter, Index 12 (100% over 49bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.275 0.0 0.0 0.0 0.0 2 0.275 0.0 0.0 0.0 0.0 3 0.275 0.0 0.0 0.0 0.0 4 0.275 0.0 0.0 0.0 0.0 5 0.275 0.0 0.0 0.0 0.0 6 0.275 0.0 0.0 0.0 0.0 7 0.275 0.0 0.0 0.0 0.0 8 0.275 0.0 0.0 0.0 0.0 9 0.275 0.0 0.0 0.0 0.0 10-11 0.275 0.0 0.0 0.0 0.0 12-13 0.275 0.0 0.0 0.0 0.0 14-15 0.275 0.0 0.0 0.0 0.0 16-17 0.275 0.0 0.0 0.0 0.0 18-19 0.275 0.0 0.0 0.0 0.0 20-21 0.275 0.0 0.0 0.0 0.0 22-23 0.275 0.0 0.0 0.0 0.0 24-25 0.275 0.0 0.0 0.0 0.0 26-27 0.275 0.0 0.0 0.0 0.0 28-29 0.275 0.0 0.0 0.0 0.0 30-31 0.275 0.0 0.0 0.0 0.0 32-33 0.275 0.0 0.0 0.0 0.0 34-35 0.275 0.0 0.0 0.0 0.0 36-37 0.275 0.0 0.0 0.0 0.0 38-39 0.275 0.0 0.0 0.0 0.0 40-41 0.275 0.0 0.0 0.0 0.0 42-43 0.275 0.0 0.0 0.0 0.0 44-45 0.275 0.0 0.0 0.0 0.0 46-47 0.275 0.0 0.0 0.0 0.0 48-49 0.275 0.0 0.0 0.0 0.0 50-51 0.275 0.0 0.0 0.0 0.0 52-53 0.275 0.0 0.0 0.0 0.0 54-55 0.275 0.0 0.0 0.0 0.0 56-57 0.2875 0.0 0.0 0.0 0.0 58-59 0.325 0.0 0.0 0.0 0.0 60-61 0.325 0.0 0.0 0.0 0.0 62-63 0.325 0.0 0.0 0.0 0.0 64-65 0.325 0.0 0.0 0.0 0.0 66-67 0.325 0.0 0.0 0.0 0.0 68-69 0.325 0.0 0.0 0.0 0.0 70-71 0.325 0.0 0.0 0.0 0.0 72-73 0.3375 0.0 0.0 0.0 0.0 74-75 0.4 0.0 0.0 0.0 0.0 76-77 0.44999999999999996 0.0 0.0 0.0 0.0 78-79 0.475 0.0 0.0 0.0 0.0 80-81 0.5 0.0 0.0 0.0 0.0 82-83 0.5875 0.0 0.0 0.0 0.0 84-85 0.625 0.0 0.0 0.0 0.0 86-87 0.625 0.0 0.0 0.0 0.0 88 0.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 651460 spots for SRR3207926.sra Written 651460 spots for SRR3207926.sra Read 651460 spots for SRR3207926.sra Written 651460 spots for SRR3207926.sra Read 651460 spots for SRR3207926.sra Written 651460 spots for SRR3207926.sra Read 651460 spots for SRR3207926.sra Written 651460 spots for SRR3207926.sra Read 651460 spots for SRR3207926.sra Written 651460 spots for SRR3207926.sra Read 651460 spots for SRR3207926.sra Written 651460 spots for SRR3207926.sra Read 651460 spots for SRR3207926.sra Written 651460 spots for SRR3207926.sra Read 651460 spots for SRR3207926.sra Written 651460 spots for SRR3207926.sra Read 651460 spots for SRR3207926.sra Written 651460 spots for SRR3207926.sra Read 651460 spots for SRR3207926.sra Written 651460 spots for SRR3207926.sra Read 651460 spots for SRR3207926.sra Written 651460 spots for SRR3207926.sra Read 651460 spots for SRR3207926.sra Written 651460 spots for SRR3207926.sra Read 651460 spots for SRR3207926.sra Written 651460 spots for SRR3207926.sra Read 651460 spots for SRR3207926.sra Written 651460 spots for SRR3207926.sra Read 651465 spots for SRR3207926.sra Written 651465 spots for SRR3207926.sra Read 651460 spots for SRR3207926.sra Written 651460 spots for SRR3207926.sra Read 651460 spots for SRR3207926.sra Written 651460 spots for SRR3207926.sra Read 651460 spots for SRR3207926.sra Written 651460 spots for SRR3207926.sra Read 651460 spots for SRR3207926.sra Written 651460 spots for SRR3207926.sra Read 651460 spots for SRR3207926.sra Written 651460 spots for SRR3207926.sra SRR ids: ['SRR3207926.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kc50jkg_ SRR3207926.sra spots: 13029205 blocks: [[1, 651460], [651461, 1302920], [1302921, 1954380], [1954381, 2605840], [2605841, 3257300], [3257301, 3908760], [3908761, 4560220], [4560221, 5211680], [5211681, 5863140], [5863141, 6514600], [6514601, 7166060], [7166061, 7817520], [7817521, 8468980], [8468981, 9120440], [9120441, 9771900], [9771901, 10423360], [10423361, 11074820], [11074821, 11726280], [11726281, 12377740], [12377741, 13029205]] SRR3207926 file size 3379885 SRR3207926 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207926 SRR3207926_1.fastq Input file: SRR3207926_1.fastq trimmed: SRR3207926-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 16:30:59 2025 >> started Tue Feb 11 16:31:05 2025 >> done (5.674s) 13029205 reads processed; of these: 897 ( 0.01%) short reads filtered out after trimming by size control 130687 ( 1.00%) empty reads filtered out after trimming by size control 12897621 (98.99%) reads available; of these: 524602 ( 4.07%) trimmed reads available after processing 12373019 (95.93%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 145 0.00% 19 186 0.00% 20 253 0.00% 21 308 0.00% 22 527 0.00% 23 720 0.01% 24 1004 0.01% 25 1241 0.01% 26 1426 0.01% 27 1324 0.01% 28 1443 0.01% 29 1408 0.01% 30 1368 0.01% 31 1464 0.01% 32 1526 0.01% 33 1543 0.01% 34 1660 0.01% 35 1769 0.01% 36 1786 0.01% 37 1891 0.01% 38 1859 0.01% 39 2029 0.02% 40 2050 0.02% 41 2202 0.02% 42 2260 0.02% 43 2301 0.02% 44 2421 0.02% 45 2424 0.02% 46 2677 0.02% 47 2674 0.02% 48 2694 0.02% 49 2912 0.02% 50 2829 0.02% 51 2934 0.02% 52 3210 0.02% 53 3271 0.03% 54 3376 0.03% 55 3518 0.03% 56 3569 0.03% 57 3655 0.03% 58 3808 0.03% 59 4046 0.03% 60 4085 0.03% 61 4238 0.03% 62 4413 0.03% 63 4507 0.03% 64 4528 0.04% 65 4770 0.04% 66 5029 0.04% 67 5243 0.04% 68 5818 0.05% 69 5627 0.04% 70 5406 0.04% 71 5273 0.04% 72 5465 0.04% 73 5652 0.04% 74 6005 0.05% 75 5871 0.05% 76 4150 0.03% 77 4849 0.04% 78 5199 0.04% 79 5747 0.04% 80 6252 0.05% 81 6556 0.05% 82 7069 0.05% 83 7523 0.06% 84 8087 0.06% 85 8635 0.07% 86 9021 0.07% 87 9521 0.07% 88 10491 0.08% 89 11687 0.09% 90 12527 0.10% 91 14003 0.11% 92 16115 0.12% 93 18336 0.14% 94 21387 0.17% 95 25742 0.20% 96 30399 0.24% 97 34551 0.27% 98 38823 0.30% 99 40291 0.31% 100 12373019 95.93% 12897621 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=55.50 fanout-score-rank=9 prefix-density=0.71 prefix-fanout=38.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTGAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=8 fanout-score=274.38 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=27.7 sequence=TTCTTCTTCTTT Started job on | Feb 11 16:31:23 Started mapping on | Feb 11 16:31:23 Finished on | Feb 11 16:31:37 Mapping speed, Million of reads per hour | 3316.53 Number of input reads | 12897621 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 12351646 Uniquely mapped reads % | 95.77% Average mapped length | 98.87 Number of splices: Total | 3672145 Number of splices: Annotated (sjdb) | 3603121 Number of splices: GT/AG | 3616120 Number of splices: GC/AG | 46008 Number of splices: AT/AC | 3750 Number of splices: Non-canonical | 6267 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 1.97 Insertion rate per base | 0.02% Insertion average length | 1.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 259602 % of reads mapped to multiple loci | 2.01% Number of reads mapped to too many loci | 137021 % of reads mapped to too many loci | 1.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.14% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 286373 286373 286373 N_multimapping 259602 259602 259602 N_noFeature 632268 6379623 6523176 N_ambiguous 123996 21716 21348 UnstrandedReadsAssigned:11595382 PositiveStrandReadsAssigned:5950307 NegativeStrandReadsAssigned:5807122 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207926 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207926-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,897,621 reads, 11,921,263 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,277 rounds 52401 SRR3207926.ke.tsv 34699 SRR3207926.se.tsv 87100 total ==> SRR3207926.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 346 23.2253 Potri.005G024800.1.v4.1 1035 936 57 7.84438 Potri.004G059700.1.v4.1 961 862 8 1.19548 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 241.225 10.9258 Potri.016G087400.1.v4.1 270 171 439 330.695 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 111 8.54136 Potri.012G127500.1.v4.1 977 878 1001 146.858 ==> SRR3207926.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1329 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 265 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 29 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 14 SRR3207926 completed mapping pipeline successfully