Starting /dee2/code/volunteer_pipeline.sh SRR3207927 current disk space = 3051625394176 free memory = 1579800436 SRR3207927 SRAfilesize 8532e4d04db1472ac860e8f89527d76e SRR3207927.sra SRR3207927.sra file validated SRR3207927 is single end SRR3207927 is conventional basespace SRR3207927 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207927_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.01425 34.0 33.0 34.0 31.0 34.0 2 33.1515 34.0 34.0 34.0 31.0 34.0 3 33.1935 34.0 34.0 34.0 31.0 34.0 4 36.493 37.0 37.0 37.0 35.0 37.0 5 36.34425 37.0 37.0 37.0 35.0 37.0 6 36.309 37.0 37.0 37.0 35.0 37.0 7 36.342 37.0 37.0 37.0 35.0 37.0 8 36.37925 37.0 37.0 37.0 35.0 37.0 9 38.313 39.0 39.0 39.0 37.0 39.0 10-11 38.189 39.0 39.0 39.0 37.0 39.0 12-13 38.266 39.0 39.0 39.0 37.0 39.0 14-15 39.840374999999995 41.0 40.0 41.0 38.0 41.0 16-17 39.8705 41.0 40.0 41.0 38.0 41.0 18-19 39.81725 41.0 40.0 41.0 38.0 41.0 20-21 39.830875 41.0 40.0 41.0 38.0 41.0 22-23 39.686 41.0 40.0 41.0 37.0 41.0 24-25 39.724875 41.0 40.0 41.0 37.5 41.0 26-27 39.684875 41.0 40.0 41.0 37.0 41.0 28-29 39.5565 41.0 40.0 41.0 37.0 41.0 30-31 39.462500000000006 41.0 40.0 41.0 37.0 41.0 32-33 39.42125 41.0 39.5 41.0 37.0 41.0 34-35 39.33625 41.0 39.0 41.0 36.5 41.0 36-37 39.265125 41.0 39.0 41.0 36.0 41.0 38-39 39.25075 40.5 39.0 41.0 36.0 41.0 40-41 39.152 41.0 39.0 41.0 36.0 41.0 42-43 39.071749999999994 40.5 39.0 41.0 35.0 41.0 44-45 39.118375 41.0 39.0 41.0 36.0 41.0 46-47 39.013875 41.0 39.0 41.0 35.0 41.0 48-49 38.936499999999995 40.0 39.0 41.0 35.0 41.0 50-51 39.129374999999996 41.0 39.0 41.0 35.5 41.0 52-53 39.066625 41.0 39.0 41.0 35.0 41.0 54-55 38.925 41.0 39.0 41.0 35.0 41.0 56-57 38.924875 41.0 39.0 41.0 35.0 41.0 58-59 38.618375 40.5 38.0 41.0 35.0 41.0 60-61 38.1105 40.0 37.5 41.0 34.0 41.0 62-63 38.147375 40.0 37.0 41.0 34.0 41.0 64-65 37.888125 39.5 37.0 41.0 34.0 41.0 66-67 37.502750000000006 39.0 36.0 41.0 34.0 41.0 68-69 37.150625 39.0 36.0 41.0 34.0 41.0 70-71 36.67475 37.5 35.0 40.0 33.0 41.0 72-73 35.85875 37.0 35.0 39.0 31.5 41.0 74-75 35.416624999999996 36.5 35.0 39.0 32.0 40.5 76-77 34.363375000000005 35.5 34.0 37.0 30.5 39.0 78-79 34.4315 36.0 35.0 37.0 31.0 39.0 80-81 34.286500000000004 35.0 35.0 37.0 31.0 39.0 82-83 33.898125 35.0 35.0 36.0 31.0 37.0 84-85 33.790875 35.0 35.0 36.0 31.0 37.0 86-87 33.591750000000005 35.0 35.0 36.0 31.5 36.5 88-89 33.27825 35.0 34.0 35.0 30.5 36.0 90-91 33.295375 35.0 34.0 35.0 31.0 36.0 92-93 33.11925 35.0 34.0 35.0 31.0 36.0 94-95 32.936 35.0 34.0 35.0 30.5 36.0 96-97 32.876000000000005 35.0 34.0 35.0 30.5 35.5 98-99 32.740875 35.0 34.0 35.0 30.0 35.0 100 32.678 35.0 34.0 35.0 30.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 2.0 12 0.0 13 4.0 14 2.0 15 2.0 16 6.0 17 5.0 18 7.0 19 0.0 20 8.0 21 8.0 22 7.0 23 6.0 24 8.0 25 8.0 26 16.0 27 22.0 28 47.0 29 29.0 30 37.0 31 46.0 32 72.0 33 68.0 34 101.0 35 144.0 36 291.0 37 680.0 38 1764.0 39 608.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.23811905952976 17.03351675837919 14.85742871435718 41.870935467733865 2 19.0 26.25 37.1 17.65 3 20.549999999999997 27.1 29.375 22.975 4 22.925 32.95 20.75 23.375 5 24.987493746873437 35.867933966983486 21.410705352676338 17.733866933466732 6 17.95 37.375 24.325 20.349999999999998 7 16.525000000000002 18.45 43.9 21.125 8 17.5 23.9 29.45 29.15 9 20.75 23.5 31.3 24.45 10-11 22.575 34.0125 22.425 20.9875 12-13 20.3125 26.3625 28.8375 24.4875 14-15 20.7 27.950000000000003 28.95 22.400000000000002 16-17 21.875 27.35 27.775 23.0 18-19 21.125 28.3125 28.1125 22.45 20-21 21.5625 27.800000000000004 28.475 22.162499999999998 22-23 21.075 29.512500000000003 27.5875 21.825 24-25 20.490061257657207 28.528566070758842 27.903487935992 23.07788473559195 26-27 21.55 27.6625 27.187499999999996 23.599999999999998 28-29 22.372372372372375 28.603603603603606 27.37737737737738 21.646646646646648 30-31 21.68795391935888 27.41046831955923 28.33708990733784 22.564487853744055 32-33 21.224999999999998 28.8625 27.737499999999997 22.175 34-35 22.5875 28.875 27.6875 20.849999999999998 36-37 21.349999999999998 28.237499999999997 27.400000000000002 23.0125 38-39 20.8 29.65 27.250000000000004 22.3 40-41 21.425 29.6875 26.85 22.037499999999998 42-43 20.1 28.262500000000003 28.4375 23.200000000000003 44-45 20.7625 28.025 28.6125 22.6 46-47 21.425 27.3375 27.6875 23.549999999999997 48-49 21.175 29.25 28.5625 21.0125 50-51 21.825 28.4125 28.175 21.587500000000002 52-53 21.5 27.8625 28.6125 22.025 54-55 21.8875 27.500000000000004 28.487499999999997 22.125 56-57 21.1625 27.8375 28.775000000000002 22.225 58-59 21.525 27.775 29.012500000000003 21.6875 60-61 22.1 27.6625 28.7375 21.5 62-63 21.45 28.325 28.325 21.9 64-65 21.65 28.999999999999996 28.812500000000004 20.5375 66-67 21.8 29.975 26.6125 21.6125 68-69 21.175 30.325000000000003 27.8875 20.6125 70-71 21.45 29.1625 27.737499999999997 21.65 72-73 21.637500000000003 30.275000000000002 27.05 21.0375 74-75 21.4875 29.7 27.575 21.2375 76-77 21.525 28.9875 28.425 21.0625 78-79 20.349999999999998 29.7875 28.075 21.7875 80-81 22.037499999999998 29.0875 27.9375 20.9375 82-83 22.0125 28.625 27.650000000000002 21.712500000000002 84-85 21.175 28.5625 28.3125 21.95 86-87 22.2125 28.462500000000002 28.1625 21.1625 88-89 20.8875 28.825 28.775000000000002 21.512500000000003 90-91 21.325 28.875 28.1875 21.6125 92-93 22.0 28.212500000000002 28.1875 21.6 94-95 21.825 28.787499999999998 27.9375 21.45 96-97 21.675 29.299999999999997 27.725 21.3 98-99 22.287499999999998 28.262500000000003 28.1125 21.337500000000002 100 22.475 27.85 28.199999999999996 21.475 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 2.0 26 4.5 27 8.0 28 11.0 29 13.0 30 19.0 31 27.0 32 32.5 33 45.0 34 61.0 35 84.5 36 103.0 37 123.0 38 152.5 39 172.5 40 207.5 41 237.0 42 251.0 43 282.0 44 298.5 45 282.0 46 267.5 47 252.0 48 215.0 49 177.0 50 142.0 51 119.0 52 105.0 53 81.0 54 59.5 55 41.5 56 28.5 57 21.5 58 16.5 59 10.5 60 6.5 61 5.0 62 8.0 63 8.0 64 3.5 65 2.5 66 2.0 67 1.5 68 2.0 69 1.5 70 0.0 71 0.0 72 0.5 73 0.5 74 1.0 75 1.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0125 26-27 0.0 28-29 0.1 30-31 0.17500000000000002 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.7712833545108 98.15 2 0.17789072426937738 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05082592121982211 1.5 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTAT 45 1.125 TruSeq Adapter, Index 13 (97% over 40bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTA 15 0.375 TruSeq Adapter, Index 13 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.425 0.0 0.0 0.0 0.0 2 0.425 0.0 0.0 0.0 0.0 3 0.425 0.0 0.0 0.0 0.0 4 0.45 0.0 0.0 0.0 0.0 5 0.45 0.0 0.0 0.0 0.0 6 0.45 0.0 0.0 0.0 0.0 7 0.45 0.0 0.0 0.0 0.0 8 0.45 0.0 0.0 0.0 0.0 9 0.45 0.0 0.0 0.0 0.0 10-11 0.45 0.0 0.0 0.0 0.0 12-13 0.45 0.0 0.0 0.0 0.0 14-15 0.45 0.0 0.0 0.0 0.0 16-17 0.45 0.0 0.0 0.0 0.0 18-19 0.45 0.0 0.0 0.0 0.0 20-21 0.45 0.0 0.0 0.0 0.0 22-23 0.45 0.0 0.0 0.0 0.0 24-25 0.45 0.0 0.0 0.0 0.0 26-27 0.45 0.0 0.0 0.0 0.0 28-29 0.45 0.0 0.0 0.0 0.0 30-31 0.45 0.0 0.0 0.0 0.0 32-33 0.45 0.0 0.0 0.0 0.0 34-35 0.45 0.0 0.0 0.0 0.0 36-37 0.45 0.0 0.0 0.0 0.0 38-39 0.45 0.0 0.0 0.0 0.0 40-41 0.45 0.0 0.0 0.0 0.0 42-43 0.45 0.0 0.0 0.0 0.0 44-45 0.45 0.0 0.0 0.0 0.0 46-47 0.45 0.0 0.0 0.0 0.0 48-49 0.45 0.0 0.0 0.0 0.0 50-51 0.45 0.0 0.0 0.0 0.0 52-53 0.45 0.0 0.0 0.0 0.0 54-55 0.45 0.0 0.0 0.0 0.0 56-57 0.475 0.0 0.0 0.0 0.0 58-59 0.475 0.0 0.0 0.0 0.0 60-61 0.475 0.0 0.0 0.0 0.0 62-63 0.475 0.0 0.0 0.0 0.0 64-65 0.5 0.0 0.0 0.0 0.0 66-67 0.5 0.0 0.0 0.0 0.0 68-69 0.5125 0.0 0.0 0.0 0.0 70-71 0.525 0.0 0.0 0.0 0.0 72-73 0.55 0.0 0.0 0.0 0.0 74-75 0.55 0.0 0.0 0.0 0.0 76-77 0.55 0.0 0.0 0.0 0.0 78-79 0.575 0.0 0.0 0.0 0.0 80-81 0.625 0.0 0.0 0.0 0.0 82-83 0.7 0.0 0.0 0.0 0.0 84-85 0.75 0.0 0.0 0.0 0.0 86-87 0.8999999999999999 0.0 0.0 0.0 0.0 88 1.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 910911 spots for SRR3207927.sra Written 910911 spots for SRR3207927.sra Read 910911 spots for SRR3207927.sra Written 910911 spots for SRR3207927.sra Read 910911 spots for SRR3207927.sra Written 910911 spots for SRR3207927.sra Read 910911 spots for SRR3207927.sra Written 910911 spots for SRR3207927.sra Read 910911 spots for SRR3207927.sra Written 910911 spots for SRR3207927.sra Read 910911 spots for SRR3207927.sra Written 910911 spots for SRR3207927.sra Read 910911 spots for SRR3207927.sra Written 910911 spots for SRR3207927.sra Read 910911 spots for SRR3207927.sra Written 910911 spots for SRR3207927.sra Read 910911 spots for SRR3207927.sra Written 910911 spots for SRR3207927.sra Read 910911 spots for SRR3207927.sra Written 910911 spots for SRR3207927.sra Read 910911 spots for SRR3207927.sra Written 910911 spots for SRR3207927.sra Read 910911 spots for SRR3207927.sra Written 910911 spots for SRR3207927.sra Read 910911 spots for SRR3207927.sra Written 910911 spots for SRR3207927.sra Read 910911 spots for SRR3207927.sra Written 910911 spots for SRR3207927.sra Read 910918 spots for SRR3207927.sra Written 910918 spots for SRR3207927.sra Read 910911 spots for SRR3207927.sra Written 910911 spots for SRR3207927.sra Read 910911 spots for SRR3207927.sra Written 910911 spots for SRR3207927.sra Read 910911 spots for SRR3207927.sra Written 910911 spots for SRR3207927.sra Read 910911 spots for SRR3207927.sra Written 910911 spots for SRR3207927.sra Read 910911 spots for SRR3207927.sra Written 910911 spots for SRR3207927.sra SRR ids: ['SRR3207927.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1u33dm9c SRR3207927.sra spots: 18218227 blocks: [[1, 910911], [910912, 1821822], [1821823, 2732733], [2732734, 3643644], [3643645, 4554555], [4554556, 5465466], [5465467, 6376377], [6376378, 7287288], [7287289, 8198199], [8198200, 9109110], [9109111, 10020021], [10020022, 10930932], [10930933, 11841843], [11841844, 12752754], [12752755, 13663665], [13663666, 14574576], [14574577, 15485487], [15485488, 16396398], [16396399, 17307309], [17307310, 18218227]] SRR3207927 file size 4730284 SRR3207927 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207927 SRR3207927_1.fastq Input file: SRR3207927_1.fastq trimmed: SRR3207927-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 17:44:28 2025 >> started Tue Feb 11 17:44:37 2025 >> done (8.883s) 18218227 reads processed; of these: 1680 ( 0.01%) short reads filtered out after trimming by size control 293452 ( 1.61%) empty reads filtered out after trimming by size control 17923095 (98.38%) reads available; of these: 800670 ( 4.47%) trimmed reads available after processing 17122425 (95.53%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 260 0.00% 19 407 0.00% 20 916 0.01% 21 598 0.00% 22 799 0.00% 23 1189 0.01% 24 1543 0.01% 25 2046 0.01% 26 2242 0.01% 27 2088 0.01% 28 2082 0.01% 29 2138 0.01% 30 2185 0.01% 31 2244 0.01% 32 2738 0.02% 33 2424 0.01% 34 2717 0.02% 35 2712 0.02% 36 3151 0.02% 37 3440 0.02% 38 4102 0.02% 39 3209 0.02% 40 3392 0.02% 41 3583 0.02% 42 4374 0.02% 43 3895 0.02% 44 4104 0.02% 45 3732 0.02% 46 4168 0.02% 47 4241 0.02% 48 5354 0.03% 49 4681 0.03% 50 6127 0.03% 51 4749 0.03% 52 5039 0.03% 53 5509 0.03% 54 6682 0.04% 55 6108 0.03% 56 7150 0.04% 57 6280 0.04% 58 8044 0.04% 59 7981 0.04% 60 8375 0.05% 61 7542 0.04% 62 8333 0.05% 63 8047 0.04% 64 8828 0.05% 65 9864 0.06% 66 7839 0.04% 67 7510 0.04% 68 7797 0.04% 69 7831 0.04% 70 9098 0.05% 71 11404 0.06% 72 9858 0.06% 73 8737 0.05% 74 8736 0.05% 75 8760 0.05% 76 6205 0.03% 77 6944 0.04% 78 7610 0.04% 79 8308 0.05% 80 8918 0.05% 81 9581 0.05% 82 10034 0.06% 83 11073 0.06% 84 11451 0.06% 85 12199 0.07% 86 13102 0.07% 87 13893 0.08% 88 15066 0.08% 89 16855 0.09% 90 18572 0.10% 91 20192 0.11% 92 23256 0.13% 93 25910 0.14% 94 30517 0.17% 95 36746 0.21% 96 43508 0.24% 97 49759 0.28% 98 55122 0.31% 99 56867 0.32% 100 17122425 95.53% 17923095 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=47.62 fanout-score-rank=9 prefix-density=0.44 prefix-fanout=35.1 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTATGCCGTCTTCTGCTTGAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=15 fanout-score=259.08 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=27.0 sequence=TTCTTCTTCTTT Started job on | Feb 11 17:44:54 Started mapping on | Feb 11 17:44:55 Finished on | Feb 11 17:45:14 Mapping speed, Million of reads per hour | 3395.95 Number of input reads | 17923095 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 17248169 Uniquely mapped reads % | 96.23% Average mapped length | 98.88 Number of splices: Total | 5220707 Number of splices: Annotated (sjdb) | 5127128 Number of splices: GT/AG | 5141982 Number of splices: GC/AG | 65083 Number of splices: AT/AC | 5192 Number of splices: Non-canonical | 8450 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 1.99 Insertion rate per base | 0.01% Insertion average length | 1.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 354454 % of reads mapped to multiple loci | 1.98% Number of reads mapped to too many loci | 76001 % of reads mapped to too many loci | 0.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.36% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 320472 320472 320472 N_multimapping 354454 354454 354454 N_noFeature 819729 8885265 9065746 N_ambiguous 172525 28162 27746 UnstrandedReadsAssigned:16255915 PositiveStrandReadsAssigned:8334742 NegativeStrandReadsAssigned:8154677 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207927 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207927-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,923,095 reads, 16,607,210 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,162 rounds 52401 SRR3207927.ke.tsv 34699 SRR3207927.se.tsv 87100 total ==> SRR3207927.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 369 17.7417 Potri.005G024800.1.v4.1 1035 936 48 4.73163 Potri.004G059700.1.v4.1 961 862 6 0.642228 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 326.574 10.5949 Potri.016G087400.1.v4.1 270 171 564 304.318 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 41 2.25982 Potri.012G127500.1.v4.1 977 878 2013 211.541 ==> SRR3207927.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1553 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 362 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 39 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207927 completed mapping pipeline successfully