Starting /dee2/code/volunteer_pipeline.sh SRR3207928 current disk space = 3049165500416 free memory = 1153519208 SRR3207928 SRAfilesize 7a98f04908b82e90fc7eca9d05c8c15d SRR3207928.sra SRR3207928.sra file validated SRR3207928 is single end SRR3207928 is conventional basespace SRR3207928 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207928_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0195 34.0 33.0 34.0 31.0 34.0 2 33.18025 34.0 33.0 34.0 31.0 34.0 3 33.23475 34.0 34.0 34.0 31.0 34.0 4 36.562 37.0 37.0 37.0 35.0 37.0 5 36.41925 37.0 37.0 37.0 35.0 37.0 6 36.32725 37.0 37.0 37.0 35.0 37.0 7 36.3325 37.0 37.0 37.0 35.0 37.0 8 36.35875 37.0 37.0 37.0 35.0 37.0 9 38.27825 39.0 39.0 39.0 37.0 39.0 10-11 38.221999999999994 39.0 39.0 39.0 37.0 39.0 12-13 38.231875 39.0 39.0 39.0 37.0 39.0 14-15 39.74925 41.0 40.0 41.0 37.5 41.0 16-17 39.81175 41.0 40.0 41.0 38.0 41.0 18-19 39.824 41.0 40.0 41.0 38.0 41.0 20-21 39.829375 41.0 40.0 41.0 38.0 41.0 22-23 39.641625000000005 41.0 40.0 41.0 37.0 41.0 24-25 39.71175 41.0 40.0 41.0 37.0 41.0 26-27 39.670125 41.0 40.0 41.0 37.0 41.0 28-29 39.494375 41.0 40.0 41.0 37.0 41.0 30-31 39.454375 41.0 40.0 41.0 37.0 41.0 32-33 39.39475 41.0 39.5 41.0 36.5 41.0 34-35 39.286125 41.0 39.0 41.0 36.5 41.0 36-37 39.203 41.0 39.0 41.0 36.0 41.0 38-39 39.095 40.5 39.0 41.0 36.0 41.0 40-41 39.025625 40.0 39.0 41.0 36.0 41.0 42-43 39.033625 40.5 39.0 41.0 35.5 41.0 44-45 39.1025 41.0 39.0 41.0 35.5 41.0 46-47 39.02875 40.5 39.0 41.0 35.0 41.0 48-49 39.01125 40.0 39.0 41.0 35.0 41.0 50-51 39.069625 41.0 39.0 41.0 36.0 41.0 52-53 39.02225 41.0 39.0 41.0 35.5 41.0 54-55 38.847 41.0 39.0 41.0 35.0 41.0 56-57 38.84625 41.0 39.0 41.0 35.0 41.0 58-59 38.601 40.5 38.0 41.0 35.0 41.0 60-61 38.193375 40.0 37.5 41.0 34.0 41.0 62-63 38.15775 40.0 37.0 41.0 34.0 41.0 64-65 37.86875 39.5 37.0 41.0 34.0 41.0 66-67 37.50975 39.0 36.0 41.0 33.5 41.0 68-69 37.07575 39.0 35.5 41.0 33.0 41.0 70-71 36.643375 37.5 35.0 40.0 33.0 41.0 72-73 35.960375 37.0 35.0 39.0 32.0 41.0 74-75 35.604124999999996 36.5 35.0 39.0 32.0 41.0 76-77 34.583 35.5 34.0 37.0 30.5 39.0 78-79 34.584500000000006 35.5 35.0 37.0 31.0 39.0 80-81 34.470625 35.0 35.0 37.0 31.5 39.0 82-83 34.124750000000006 35.0 35.0 36.0 31.5 37.0 84-85 33.957750000000004 35.0 35.0 36.0 31.5 37.0 86-87 33.745375 35.0 35.0 36.0 31.0 37.0 88-89 33.444 35.0 34.0 35.0 31.0 36.0 90-91 33.355625 35.0 34.0 35.0 31.0 36.0 92-93 33.249750000000006 35.0 34.0 35.0 31.0 36.0 94-95 33.123000000000005 35.0 34.0 35.0 30.5 36.0 96-97 33.059125 35.0 34.0 35.0 31.0 35.5 98-99 32.902625 35.0 34.0 35.0 30.5 35.0 100 32.8155 35.0 34.0 35.0 30.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 3.0 10 3.0 11 0.0 12 3.0 13 1.0 14 1.0 15 6.0 16 3.0 17 3.0 18 7.0 19 5.0 20 5.0 21 7.0 22 3.0 23 5.0 24 5.0 25 8.0 26 14.0 27 29.0 28 41.0 29 30.0 30 30.0 31 33.0 32 58.0 33 80.0 34 116.0 35 155.0 36 284.0 37 704.0 38 1787.0 39 570.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.56378189094547 16.03301650825413 15.032516258129064 41.37068534267134 2 19.55 25.75 37.525 17.175 3 20.200000000000003 29.325000000000003 27.35 23.125 4 23.575 33.4 20.25 22.775000000000002 5 23.799999999999997 35.9 22.5 17.8 6 18.975 37.475 25.1 18.45 7 16.6 19.125 43.55 20.724999999999998 8 18.7 24.099999999999998 29.975 27.224999999999998 9 19.475 22.075 33.650000000000006 24.8 10-11 23.4625 34.9375 21.975 19.625 12-13 20.674999999999997 26.375 30.075000000000003 22.875 14-15 20.7875 27.675 29.9875 21.55 16-17 22.287499999999998 28.0875 28.199999999999996 21.425 18-19 21.1375 29.025000000000002 28.025 21.8125 20-21 22.112499999999997 28.6625 27.925 21.3 22-23 21.4875 29.725 27.1375 21.65 24-25 21.22045767162686 28.898336876328624 28.810804051519316 21.070401400525196 26-27 20.625 28.487499999999997 28.475 22.412499999999998 28-29 22.38208432378331 29.588389841110974 27.73676967346428 20.29275616164144 30-31 22.07336922499061 28.145736822336296 28.045574057843996 21.735319894829097 32-33 21.1875 28.675 28.537499999999998 21.6 34-35 21.975 28.9375 27.8375 21.25 36-37 22.4375 28.012500000000003 28.449999999999996 21.099999999999998 38-39 22.0875 27.987499999999997 27.55 22.375 40-41 22.0 28.575 28.225 21.2 42-43 21.8 28.4 27.6 22.2 44-45 20.75 28.525 28.537499999999998 22.1875 46-47 22.025 28.787499999999998 27.8375 21.349999999999998 48-49 21.8875 28.3875 28.225 21.5 50-51 22.15 28.025 28.4 21.425 52-53 21.025 28.199999999999996 28.3625 22.412499999999998 54-55 22.05 27.0875 29.1625 21.7 56-57 21.325 27.950000000000003 28.849999999999998 21.875 58-59 21.912499999999998 28.675 27.625 21.7875 60-61 21.4125 28.299999999999997 28.525 21.762500000000003 62-63 21.525 28.825 28.3375 21.3125 64-65 21.099999999999998 28.625 29.125 21.15 66-67 21.224999999999998 29.0875 28.125 21.5625 68-69 21.5 29.812499999999996 27.9125 20.775 70-71 21.2375 29.099999999999998 28.4125 21.25 72-73 20.8 28.875 28.425 21.9 74-75 22.075 29.075 27.9125 20.9375 76-77 21.475 29.462500000000002 27.800000000000004 21.2625 78-79 21.95 28.775000000000002 27.925 21.349999999999998 80-81 21.637500000000003 29.3875 28.0875 20.8875 82-83 22.112499999999997 28.875 27.437499999999996 21.575 84-85 21.3 28.575 28.599999999999998 21.525 86-87 21.0375 27.9125 29.4125 21.637500000000003 88-89 22.15 28.787499999999998 28.975 20.0875 90-91 22.037499999999998 28.8375 28.299999999999997 20.825 92-93 21.675 27.9375 28.1625 22.225 94-95 21.4 28.499999999999996 28.575 21.525 96-97 21.762500000000003 28.575 28.475 21.1875 98-99 22.4375 28.725 26.724999999999998 22.112499999999997 100 21.175 29.75 28.075 21.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.5 20 0.5 21 0.0 22 0.5 23 1.0 24 3.0 25 4.5 26 4.5 27 6.5 28 15.5 29 19.0 30 21.0 31 33.0 32 39.0 33 48.5 34 69.5 35 79.0 36 94.0 37 124.0 38 159.5 39 194.0 40 219.0 41 245.5 42 264.5 43 267.5 44 280.5 45 281.0 46 255.5 47 227.5 48 198.0 49 177.5 50 154.5 51 123.5 52 98.0 53 75.0 54 52.5 55 38.0 56 28.0 57 20.0 58 18.5 59 16.5 60 12.0 61 10.0 62 7.5 63 3.5 64 1.0 65 1.5 66 1.0 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0375 26-27 0.0 28-29 0.08750000000000001 30-31 0.1625 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84871406959152 99.0 2 0.10085728693898136 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05042864346949068 0.8 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTAT 22 0.5499999999999999 TruSeq Adapter, Index 14 (97% over 44bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTA 10 0.25 TruSeq Adapter, Index 14 (97% over 44bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.275 0.0 0.0 0.0 0.0 2 0.275 0.0 0.0 0.0 0.0 3 0.275 0.0 0.0 0.0 0.0 4 0.275 0.0 0.0 0.0 0.0 5 0.275 0.0 0.0 0.0 0.0 6 0.275 0.0 0.0 0.0 0.0 7 0.275 0.0 0.0 0.0 0.0 8 0.275 0.0 0.0 0.0 0.0 9 0.275 0.0 0.0 0.0 0.0 10-11 0.275 0.0 0.0 0.0 0.0 12-13 0.3 0.0 0.0 0.0 0.0 14-15 0.3 0.0 0.0 0.0 0.0 16-17 0.3 0.0 0.0 0.0 0.0 18-19 0.3 0.0 0.0 0.0 0.0 20-21 0.3 0.0 0.0 0.0 0.0 22-23 0.3 0.0 0.0 0.0 0.0 24-25 0.3 0.0 0.0 0.0 0.0 26-27 0.3 0.0 0.0 0.0 0.0 28-29 0.3 0.0 0.0 0.0 0.0 30-31 0.3 0.0 0.0 0.0 0.0 32-33 0.3 0.0 0.0 0.0 0.0 34-35 0.3 0.0 0.0 0.0 0.0 36-37 0.3 0.0 0.0 0.0 0.0 38-39 0.3 0.0 0.0 0.0 0.0 40-41 0.3 0.0 0.0 0.0 0.0 42-43 0.3 0.0 0.0 0.0 0.0 44-45 0.3 0.0 0.0 0.0 0.0 46-47 0.3 0.0 0.0 0.0 0.0 48-49 0.3 0.0 0.0 0.0 0.0 50-51 0.3 0.0 0.0 0.0 0.0 52-53 0.3 0.0 0.0 0.0 0.0 54-55 0.3 0.0 0.0 0.0 0.0 56-57 0.3 0.0 0.0 0.0 0.0 58-59 0.3 0.0 0.0 0.0 0.0 60-61 0.3 0.0 0.0 0.0 0.0 62-63 0.3 0.0 0.0 0.0 0.0 64-65 0.3 0.0 0.0 0.0 0.0 66-67 0.3 0.0 0.0 0.0 0.0 68-69 0.3375 0.0 0.0 0.0 0.0 70-71 0.35 0.0 0.0 0.0 0.0 72-73 0.35 0.0 0.0 0.0 0.0 74-75 0.375 0.0 0.0 0.0 0.0 76-77 0.3875 0.0 0.0 0.0 0.0 78-79 0.4 0.0 0.0 0.0 0.0 80-81 0.4 0.0 0.0 0.0 0.0 82-83 0.4375 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.5625 0.0 0.0 0.0 0.0 88 0.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 820208 spots for SRR3207928.sra Written 820208 spots for SRR3207928.sra Read 820208 spots for SRR3207928.sra Written 820208 spots for SRR3207928.sra Read 820208 spots for SRR3207928.sra Written 820208 spots for SRR3207928.sra Read 820208 spots for SRR3207928.sra Written 820208 spots for SRR3207928.sra Read 820208 spots for SRR3207928.sra Written 820208 spots for SRR3207928.sra Read 820208 spots for SRR3207928.sra Written 820208 spots for SRR3207928.sra Read 820208 spots for SRR3207928.sra Written 820208 spots for SRR3207928.sra Read 820208 spots for SRR3207928.sra Written 820208 spots for SRR3207928.sra Read 820208 spots for SRR3207928.sra Written 820208 spots for SRR3207928.sra Read 820208 spots for SRR3207928.sra Written 820208 spots for SRR3207928.sra Read 820208 spots for SRR3207928.sra Written 820208 spots for SRR3207928.sra Read 820208 spots for SRR3207928.sra Written 820208 spots for SRR3207928.sra Read 820208 spots for SRR3207928.sra Written 820208 spots for SRR3207928.sra Read 820208 spots for SRR3207928.sra Written 820208 spots for SRR3207928.sra Read 820208 spots for SRR3207928.sra Written 820208 spots for SRR3207928.sra Read 820208 spots for SRR3207928.sra Written 820208 spots for SRR3207928.sra Read 820208 spots for SRR3207928.sra Written 820208 spots for SRR3207928.sra Read 820208 spots for SRR3207928.sra Written 820208 spots for SRR3207928.sra Read 820208 spots for SRR3207928.sra Written 820208 spots for SRR3207928.sra Read 820208 spots for SRR3207928.sra Written 820208 spots for SRR3207928.sra SRR ids: ['SRR3207928.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ky0sjnuu SRR3207928.sra spots: 16404160 blocks: [[1, 820208], [820209, 1640416], [1640417, 2460624], [2460625, 3280832], [3280833, 4101040], [4101041, 4921248], [4921249, 5741456], [5741457, 6561664], [6561665, 7381872], [7381873, 8202080], [8202081, 9022288], [9022289, 9842496], [9842497, 10662704], [10662705, 11482912], [11482913, 12303120], [12303121, 13123328], [13123329, 13943536], [13943537, 14763744], [14763745, 15583952], [15583953, 16404160]] SRR3207928 file size 4258183 SRR3207928 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207928 SRR3207928_1.fastq Input file: SRR3207928_1.fastq trimmed: SRR3207928-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 16:12:25 2025 >> started Tue Feb 11 16:12:37 2025 >> done (11.971s) 16404160 reads processed; of these: 1306 ( 0.01%) short reads filtered out after trimming by size control 151384 ( 0.92%) empty reads filtered out after trimming by size control 16251470 (99.07%) reads available; of these: 677493 ( 4.17%) trimmed reads available after processing 15573977 (95.83%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 245 0.00% 19 288 0.00% 20 379 0.00% 21 475 0.00% 22 770 0.00% 23 1009 0.01% 24 1354 0.01% 25 1783 0.01% 26 1796 0.01% 27 1925 0.01% 28 1828 0.01% 29 1825 0.01% 30 2035 0.01% 31 1920 0.01% 32 2055 0.01% 33 2074 0.01% 34 2217 0.01% 35 2273 0.01% 36 2438 0.02% 37 2509 0.02% 38 2654 0.02% 39 3070 0.02% 40 2750 0.02% 41 2963 0.02% 42 2934 0.02% 43 3126 0.02% 44 3163 0.02% 45 3236 0.02% 46 3442 0.02% 47 3554 0.02% 48 3748 0.02% 49 3705 0.02% 50 3757 0.02% 51 3652 0.02% 52 4035 0.02% 53 4122 0.03% 54 4390 0.03% 55 4569 0.03% 56 4561 0.03% 57 4828 0.03% 58 4854 0.03% 59 5118 0.03% 60 5140 0.03% 61 5333 0.03% 62 5534 0.03% 63 5616 0.03% 64 5838 0.04% 65 6080 0.04% 66 6224 0.04% 67 6521 0.04% 68 6731 0.04% 69 6513 0.04% 70 6942 0.04% 71 7595 0.05% 72 7766 0.05% 73 7488 0.05% 74 7664 0.05% 75 7675 0.05% 76 5491 0.03% 77 5987 0.04% 78 6659 0.04% 79 7452 0.05% 80 8083 0.05% 81 8422 0.05% 82 9004 0.06% 83 9830 0.06% 84 10257 0.06% 85 10864 0.07% 86 11573 0.07% 87 12332 0.08% 88 13581 0.08% 89 15095 0.09% 90 16425 0.10% 91 18236 0.11% 92 20574 0.13% 93 23637 0.15% 94 27777 0.17% 95 32761 0.20% 96 39032 0.24% 97 44619 0.27% 98 49843 0.31% 99 51870 0.32% 100 15573977 95.83% 16251470 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=43.73 fanout-score-rank=11 prefix-density=0.43 prefix-fanout=32.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTATGCCGTCTTCTGCTTGAAAAA criterion=fanout-score sequence-density=0.05 sequence-density-rank=5 fanout-score=251.15 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=27.6 sequence=TTCTTCTTCTTT Started job on | Feb 11 16:12:52 Started mapping on | Feb 11 16:12:52 Finished on | Feb 11 16:13:10 Mapping speed, Million of reads per hour | 3250.29 Number of input reads | 16251470 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 15662703 Uniquely mapped reads % | 96.38% Average mapped length | 98.89 Number of splices: Total | 4672583 Number of splices: Annotated (sjdb) | 4585628 Number of splices: GT/AG | 4601113 Number of splices: GC/AG | 58726 Number of splices: AT/AC | 4780 Number of splices: Non-canonical | 7964 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 2.02 Insertion rate per base | 0.02% Insertion average length | 1.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 333367 % of reads mapped to multiple loci | 2.05% Number of reads mapped to too many loci | 90012 % of reads mapped to too many loci | 0.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.01% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 255400 255400 255400 N_multimapping 333367 333367 333367 N_noFeature 806219 8092310 8267501 N_ambiguous 164200 28138 27204 UnstrandedReadsAssigned:14692284 PositiveStrandReadsAssigned:7542255 NegativeStrandReadsAssigned:7367998 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207928 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207928-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,251,470 reads, 15,045,331 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,197 rounds 52401 SRR3207928.ke.tsv 34699 SRR3207928.se.tsv 87100 total ==> SRR3207928.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 445 23.7284 Potri.005G024800.1.v4.1 1035 936 97 10.6042 Potri.004G059700.1.v4.1 961 862 15 1.78061 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 285.375 10.2676 Potri.016G087400.1.v4.1 270 171 480 287.23 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 84 5.13461 Potri.012G127500.1.v4.1 977 878 1569 182.857 ==> SRR3207928.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2151 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 351 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 44 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR3207928 completed mapping pipeline successfully