Starting /dee2/code/volunteer_pipeline.sh SRR3207929 current disk space = 3053304242176 free memory = 1579855108 SRR3207929 SRAfilesize b17c31e39d5f510e63f59e33b86fa481 SRR3207929.sra SRR3207929.sra file validated SRR3207929 is single end SRR3207929 is conventional basespace SRR3207929 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207929_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0295 34.0 33.0 34.0 31.0 34.0 2 33.24375 34.0 34.0 34.0 31.0 34.0 3 33.2975 34.0 34.0 34.0 31.0 34.0 4 36.58475 37.0 37.0 37.0 35.0 37.0 5 36.457 37.0 37.0 37.0 35.0 37.0 6 36.39075 37.0 37.0 37.0 35.0 37.0 7 36.431 37.0 37.0 37.0 35.0 37.0 8 36.43725 37.0 37.0 37.0 35.0 37.0 9 38.31225 39.0 39.0 39.0 37.0 39.0 10-11 38.24925 39.0 39.0 39.0 37.0 39.0 12-13 38.28 39.0 39.0 39.0 37.0 39.0 14-15 39.852875 41.0 40.0 41.0 38.0 41.0 16-17 39.888625000000005 41.0 40.0 41.0 38.0 41.0 18-19 39.8535 41.0 40.0 41.0 38.0 41.0 20-21 39.820750000000004 41.0 40.0 41.0 38.0 41.0 22-23 39.67975 41.0 40.0 41.0 37.0 41.0 24-25 39.696124999999995 41.0 40.0 41.0 37.5 41.0 26-27 39.588499999999996 41.0 40.0 41.0 37.0 41.0 28-29 39.542874999999995 41.0 40.0 41.0 37.0 41.0 30-31 39.417 41.0 40.0 41.0 37.0 41.0 32-33 39.3795 41.0 39.5 41.0 36.5 41.0 34-35 39.282875 41.0 39.0 41.0 36.5 41.0 36-37 39.24825 41.0 39.0 41.0 36.5 41.0 38-39 39.143375 40.5 39.0 41.0 36.0 41.0 40-41 39.070750000000004 40.0 39.0 41.0 35.5 41.0 42-43 39.009125 40.5 39.0 41.0 35.0 41.0 44-45 39.11125 41.0 39.0 41.0 36.0 41.0 46-47 39.062625 41.0 39.0 41.0 35.0 41.0 48-49 38.863875 40.5 39.0 41.0 35.0 41.0 50-51 39.019125 41.0 39.0 41.0 35.0 41.0 52-53 39.0115 41.0 39.0 41.0 35.0 41.0 54-55 38.85825 41.0 39.0 41.0 35.0 41.0 56-57 38.84 41.0 39.0 41.0 35.0 41.0 58-59 38.558125000000004 40.5 38.0 41.0 35.0 41.0 60-61 38.18675 40.0 38.0 41.0 34.0 41.0 62-63 38.249875 40.0 37.0 41.0 34.0 41.0 64-65 37.963 39.5 37.0 41.0 34.0 41.0 66-67 37.689750000000004 39.0 36.5 41.0 34.0 41.0 68-69 37.28975 39.0 36.0 41.0 34.0 41.0 70-71 36.83025 38.0 35.0 40.0 33.5 41.0 72-73 36.181625 37.0 35.0 39.0 32.0 41.0 74-75 35.850625 37.0 35.0 39.0 32.5 40.5 76-77 34.835375 36.0 34.5 37.0 30.5 39.0 78-79 34.790125 36.0 35.0 37.0 31.5 39.0 80-81 34.664500000000004 35.0 35.0 37.0 32.0 39.0 82-83 34.2575 35.0 35.0 36.0 31.5 37.0 84-85 34.117875 35.0 35.0 36.0 32.0 37.0 86-87 33.856125 35.0 35.0 36.0 32.0 36.5 88-89 33.604375000000005 35.0 34.0 35.0 31.0 36.0 90-91 33.519625 35.0 34.0 35.0 31.5 36.0 92-93 33.418 35.0 34.0 35.0 31.0 36.0 94-95 33.301874999999995 35.0 34.0 35.0 31.0 36.0 96-97 33.22 35.0 34.0 35.0 31.0 35.5 98-99 33.051874999999995 35.0 34.0 35.0 31.0 35.0 100 33.01725 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 0.0 9 2.0 10 1.0 11 3.0 12 2.0 13 2.0 14 4.0 15 3.0 16 2.0 17 5.0 18 3.0 19 4.0 20 8.0 21 5.0 22 7.0 23 9.0 24 6.0 25 13.0 26 13.0 27 13.0 28 21.0 29 24.0 30 31.0 31 39.0 32 59.0 33 78.0 34 101.0 35 145.0 36 273.0 37 734.0 38 1806.0 39 581.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.186593296648326 16.95847923961981 15.182591295647823 44.672336168084044 2 19.675 24.4 38.125 17.8 3 21.575 27.474999999999998 28.125 22.825 4 24.349999999999998 33.025 20.075000000000003 22.55 5 23.075000000000003 36.025 23.225 17.675 6 17.424999999999997 37.775 25.2 19.6 7 15.9 18.224999999999998 44.85 21.025 8 19.15 23.225 30.575000000000003 27.05 9 19.8 22.15 32.975 25.074999999999996 10-11 22.4625 33.800000000000004 22.3125 21.425 12-13 20.5625 26.8625 29.812499999999996 22.7625 14-15 21.087500000000002 28.4 28.0875 22.425 16-17 21.95 28.299999999999997 27.775 21.975 18-19 22.075 28.3625 27.487499999999997 22.075 20-21 21.425 28.375 28.3625 21.837500000000002 22-23 20.599999999999998 29.799999999999997 28.525 21.075 24-25 21.676047529706068 27.954971857410882 27.817385866166354 22.551594746716695 26-27 21.4 28.287499999999998 27.737499999999997 22.575 28-29 22.116587440580435 28.183637728296222 27.47060295221416 22.22917187890918 30-31 21.313118656809923 28.542789124169904 28.27966420248089 21.864428016539282 32-33 22.2 28.999999999999996 27.525 21.275 34-35 21.6875 29.15 27.05 22.112499999999997 36-37 22.0875 28.512500000000003 27.55 21.85 38-39 21.75 27.875 27.987499999999997 22.3875 40-41 21.6875 29.275000000000002 27.5625 21.475 42-43 20.9375 28.075 28.4125 22.575 44-45 21.462500000000002 28.787499999999998 27.8375 21.912499999999998 46-47 21.2875 28.812500000000004 27.9375 21.9625 48-49 21.212500000000002 28.762500000000003 28.1875 21.837500000000002 50-51 21.5375 28.499999999999996 27.9125 22.05 52-53 21.3125 29.275000000000002 27.800000000000004 21.6125 54-55 22.3875 29.012500000000003 27.6375 20.962500000000002 56-57 21.7375 28.812500000000004 28.375 21.075 58-59 20.5375 29.825000000000003 28.000000000000004 21.637500000000003 60-61 21.212500000000002 28.262500000000003 28.199999999999996 22.325 62-63 21.099999999999998 28.249999999999996 28.812500000000004 21.837500000000002 64-65 21.837500000000002 28.7 28.475 20.9875 66-67 21.8625 28.8625 27.5125 21.762500000000003 68-69 21.8125 29.2875 27.375 21.525 70-71 22.112499999999997 27.962500000000002 28.0875 21.837500000000002 72-73 21.25 28.1375 28.675 21.9375 74-75 22.025 27.6 28.599999999999998 21.775 76-77 23.175 28.1375 27.537499999999998 21.15 78-79 22.4375 27.6875 27.975 21.9 80-81 21.912499999999998 28.6625 28.525 20.9 82-83 22.0125 27.962500000000002 28.1875 21.837500000000002 84-85 21.95 28.712500000000002 27.750000000000004 21.587500000000002 86-87 21.975 27.787499999999998 28.425 21.8125 88-89 22.0 27.700000000000003 28.3125 21.987499999999997 90-91 21.925 27.237499999999997 28.7 22.1375 92-93 21.5 28.712500000000002 28.375 21.4125 94-95 22.1375 28.4 27.4125 22.05 96-97 21.4375 28.537499999999998 28.487499999999997 21.5375 98-99 21.8875 27.925 28.999999999999996 21.1875 100 23.0 28.975 26.6 21.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 0.0 24 1.0 25 1.0 26 1.5 27 5.0 28 11.0 29 16.5 30 24.5 31 30.0 32 29.5 33 43.5 34 53.0 35 72.0 36 104.5 37 124.5 38 147.0 39 171.5 40 201.0 41 240.5 42 259.5 43 273.0 44 309.0 45 303.0 46 264.5 47 239.5 48 217.0 49 178.0 50 143.5 51 119.0 52 98.5 53 76.5 54 52.0 55 42.0 56 31.5 57 24.5 58 19.5 59 15.0 60 12.5 61 9.0 62 7.0 63 7.0 64 4.5 65 2.5 66 3.5 67 2.5 68 1.0 69 0.5 70 0.0 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0625 26-27 0.0 28-29 0.075 30-31 0.2375 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.7491219267436 99.4 2 0.22579026593075763 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.025087807325639738 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTAT 6 0.15 TruSeq Adapter, Index 15 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10-11 0.1 0.0 0.0 0.0 0.0 12-13 0.1 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.1 0.0 0.0 0.0 0.0 22-23 0.1 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.125 0.0 0.0 0.0 0.0 46-47 0.125 0.0 0.0 0.0 0.0 48-49 0.125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.2375 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.42500000000000004 0.0 0.0 0.0 0.0 88 0.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 731320 spots for SRR3207929.sra Written 731320 spots for SRR3207929.sra Read 731320 spots for SRR3207929.sra Written 731320 spots for SRR3207929.sra Read 731320 spots for SRR3207929.sra Written 731320 spots for SRR3207929.sra Read 731320 spots for SRR3207929.sra Written 731320 spots for SRR3207929.sra Read 731320 spots for SRR3207929.sra Written 731320 spots for SRR3207929.sra Read 731320 spots for SRR3207929.sra Written 731320 spots for SRR3207929.sra Read 731320 spots for SRR3207929.sra Written 731320 spots for SRR3207929.sra Read 731320 spots for SRR3207929.sra Written 731320 spots for SRR3207929.sra Read 731320 spots for SRR3207929.sra Written 731320 spots for SRR3207929.sra Read 731320 spots for SRR3207929.sra Written 731320 spots for SRR3207929.sra Read 731320 spots for SRR3207929.sra Written 731320 spots for SRR3207929.sra Read 731320 spots for SRR3207929.sra Written 731320 spots for SRR3207929.sra Read 731320 spots for SRR3207929.sra Written 731320 spots for SRR3207929.sra Read 731322 spots for SRR3207929.sra Written 731322 spots for SRR3207929.sra Read 731320 spots for SRR3207929.sra Written 731320 spots for SRR3207929.sra Read 731320 spots for SRR3207929.sra Written 731320 spots for SRR3207929.sra Read 731320 spots for SRR3207929.sra Written 731320 spots for SRR3207929.sra Read 731320 spots for SRR3207929.sra Written 731320 spots for SRR3207929.sra Read 731320 spots for SRR3207929.sra Written 731320 spots for SRR3207929.sra Read 731320 spots for SRR3207929.sra Written 731320 spots for SRR3207929.sra SRR ids: ['SRR3207929.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hfsji6ca SRR3207929.sra spots: 14626402 blocks: [[1, 731320], [731321, 1462640], [1462641, 2193960], [2193961, 2925280], [2925281, 3656600], [3656601, 4387920], [4387921, 5119240], [5119241, 5850560], [5850561, 6581880], [6581881, 7313200], [7313201, 8044520], [8044521, 8775840], [8775841, 9507160], [9507161, 10238480], [10238481, 10969800], [10969801, 11701120], [11701121, 12432440], [12432441, 13163760], [13163761, 13895080], [13895081, 14626402]] SRR3207929 file size 3795536 SRR3207929 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207929 SRR3207929_1.fastq Input file: SRR3207929_1.fastq trimmed: SRR3207929-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 17:59:39 2025 >> started Tue Feb 11 17:59:49 2025 >> done (9.637s) 14626402 reads processed; of these: 1896 ( 0.01%) short reads filtered out after trimming by size control 80971 ( 0.55%) empty reads filtered out after trimming by size control 14543535 (99.43%) reads available; of these: 655938 ( 4.51%) trimmed reads available after processing 13887597 (95.49%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 571 0.00% 19 556 0.00% 20 467 0.00% 21 689 0.00% 22 710 0.00% 23 967 0.01% 24 1455 0.01% 25 1814 0.01% 26 1701 0.01% 27 1918 0.01% 28 1779 0.01% 29 2012 0.01% 30 1857 0.01% 31 1949 0.01% 32 2235 0.02% 33 2520 0.02% 34 2572 0.02% 35 2257 0.02% 36 2423 0.02% 37 4362 0.03% 38 2990 0.02% 39 2750 0.02% 40 3904 0.03% 41 3316 0.02% 42 3964 0.03% 43 3834 0.03% 44 3313 0.02% 45 3780 0.03% 46 3298 0.02% 47 3404 0.02% 48 3541 0.02% 49 3880 0.03% 50 3812 0.03% 51 4368 0.03% 52 4388 0.03% 53 5453 0.04% 54 5025 0.03% 55 5406 0.04% 56 5298 0.04% 57 5634 0.04% 58 6028 0.04% 59 6360 0.04% 60 5978 0.04% 61 5852 0.04% 62 6772 0.05% 63 6153 0.04% 64 6506 0.04% 65 6988 0.05% 66 6437 0.04% 67 6311 0.04% 68 6823 0.05% 69 6121 0.04% 70 6723 0.05% 71 7815 0.05% 72 7414 0.05% 73 7441 0.05% 74 6997 0.05% 75 7247 0.05% 76 5024 0.03% 77 5820 0.04% 78 6276 0.04% 79 7491 0.05% 80 7435 0.05% 81 7856 0.05% 82 8127 0.06% 83 8997 0.06% 84 9571 0.07% 85 9933 0.07% 86 10625 0.07% 87 11528 0.08% 88 12400 0.09% 89 14238 0.10% 90 15690 0.11% 91 16823 0.12% 92 18662 0.13% 93 21269 0.15% 94 24644 0.17% 95 29731 0.20% 96 35378 0.24% 97 40606 0.28% 98 44916 0.31% 99 46760 0.32% 100 13887597 95.49% 14543535 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=44.38 fanout-score-rank=10 prefix-density=0.44 prefix-fanout=33.7 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATGCCGTCTTCTGCTTGAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=14 fanout-score=298.70 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=29.1 sequence=TTCTTCTTCTTT Started job on | Feb 11 18:00:05 Started mapping on | Feb 11 18:00:05 Finished on | Feb 11 18:00:25 Mapping speed, Million of reads per hour | 2617.84 Number of input reads | 14543535 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 13894305 Uniquely mapped reads % | 95.54% Average mapped length | 98.90 Number of splices: Total | 4236923 Number of splices: Annotated (sjdb) | 4161165 Number of splices: GT/AG | 4173764 Number of splices: GC/AG | 52593 Number of splices: AT/AC | 4070 Number of splices: Non-canonical | 6496 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.02 Insertion rate per base | 0.01% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 287119 % of reads mapped to multiple loci | 1.97% Number of reads mapped to too many loci | 57752 % of reads mapped to too many loci | 0.40% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.09% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 362111 362111 362111 N_multimapping 287119 287119 287119 N_noFeature 643113 7166689 7278361 N_ambiguous 139827 23748 23922 UnstrandedReadsAssigned:13111365 PositiveStrandReadsAssigned:6703868 NegativeStrandReadsAssigned:6592022 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207929 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207929-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,543,535 reads, 13,397,254 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,164 rounds 52401 SRR3207929.ke.tsv 34699 SRR3207929.se.tsv 87100 total ==> SRR3207929.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 320 19.1194 Potri.005G024800.1.v4.1 1035 936 54 6.6148 Potri.004G059700.1.v4.1 961 862 4 0.532048 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 236.651 9.54065 Potri.016G087400.1.v4.1 270 171 461 309.103 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 65 4.45201 Potri.012G127500.1.v4.1 977 878 1450 189.353 ==> SRR3207929.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1609 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 217 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 29 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207929 completed mapping pipeline successfully