Starting /dee2/code/volunteer_pipeline.sh SRR3207930 current disk space = 3049045925888 free memory = 1470229396 SRR3207930 SRAfilesize 483ae56e0b7089e6d33a8ae5d3999c78 SRR3207930.sra SRR3207930.sra file validated SRR3207930 is single end SRR3207930 is conventional basespace SRR3207930 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207930_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.94125 34.0 31.0 34.0 31.0 34.0 2 33.1285 34.0 33.0 34.0 31.0 34.0 3 33.22375 34.0 34.0 34.0 31.0 34.0 4 36.50925 37.0 37.0 37.0 35.0 37.0 5 36.38525 37.0 37.0 37.0 35.0 37.0 6 36.35375 37.0 37.0 37.0 35.0 37.0 7 36.296 37.0 37.0 37.0 35.0 37.0 8 36.3285 37.0 37.0 37.0 35.0 37.0 9 38.27075 39.0 39.0 39.0 37.0 39.0 10-11 38.208875000000006 39.0 39.0 39.0 37.0 39.0 12-13 38.173 39.0 39.0 39.0 37.0 39.0 14-15 39.715125 41.0 40.0 41.0 37.5 41.0 16-17 39.716625 41.0 40.0 41.0 37.0 41.0 18-19 39.742125 41.0 40.0 41.0 37.0 41.0 20-21 39.78675 41.0 40.0 41.0 38.0 41.0 22-23 39.670375 41.0 40.0 41.0 37.0 41.0 24-25 39.750125 41.0 40.0 41.0 37.5 41.0 26-27 39.656375 41.0 40.0 41.0 37.0 41.0 28-29 39.476875 41.0 40.0 41.0 36.5 41.0 30-31 39.355125 41.0 39.5 41.0 36.5 41.0 32-33 39.321625 41.0 39.0 41.0 36.0 41.0 34-35 39.2535 41.0 39.0 41.0 36.0 41.0 36-37 39.174625 41.0 39.0 41.0 36.0 41.0 38-39 39.047375 40.5 39.0 41.0 35.5 41.0 40-41 38.9715 40.0 39.0 41.0 35.0 41.0 42-43 38.94625 40.5 39.0 41.0 35.0 41.0 44-45 39.008375 41.0 39.0 41.0 35.0 41.0 46-47 38.997125 40.5 39.0 41.0 35.0 41.0 48-49 38.845 40.0 39.0 41.0 35.0 41.0 50-51 38.980875 41.0 39.0 41.0 35.0 41.0 52-53 38.992374999999996 41.0 39.0 41.0 35.0 41.0 54-55 38.8035 41.0 39.0 41.0 35.0 41.0 56-57 38.799 41.0 39.0 41.0 35.0 41.0 58-59 38.472750000000005 40.0 38.0 41.0 34.5 41.0 60-61 38.07125 40.0 37.0 41.0 34.0 41.0 62-63 38.078500000000005 40.0 37.0 41.0 34.0 41.0 64-65 37.820750000000004 39.5 36.5 41.0 34.0 41.0 66-67 37.527125 39.0 36.0 41.0 34.0 41.0 68-69 37.161500000000004 39.0 35.5 41.0 34.0 41.0 70-71 36.636125 37.5 35.0 40.0 33.0 41.0 72-73 36.100875 37.0 35.0 39.0 32.5 41.0 74-75 35.721625 36.5 35.0 39.0 32.0 40.5 76-77 34.62825 35.5 34.0 37.0 30.5 39.0 78-79 34.665875 35.5 35.0 37.0 31.0 39.0 80-81 34.55225 35.0 35.0 37.0 32.0 39.0 82-83 34.125625 35.0 35.0 36.0 31.0 37.0 84-85 34.005375 35.0 35.0 36.0 31.0 37.0 86-87 33.877250000000004 35.0 34.5 36.0 32.0 36.5 88-89 33.58775 35.0 34.0 35.0 31.0 36.0 90-91 33.47475 35.0 34.0 35.0 31.0 36.0 92-93 33.369749999999996 35.0 34.0 35.0 31.0 36.0 94-95 33.21725 35.0 34.0 35.0 31.0 36.0 96-97 33.142125 35.0 34.0 35.0 31.0 35.0 98-99 32.91925 35.0 34.0 35.0 30.0 35.0 100 32.90775 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 2.0 12 1.0 13 3.0 14 3.0 15 5.0 16 8.0 17 1.0 18 2.0 19 10.0 20 4.0 21 10.0 22 3.0 23 4.0 24 8.0 25 8.0 26 16.0 27 18.0 28 26.0 29 24.0 30 28.0 31 46.0 32 56.0 33 70.0 34 110.0 35 174.0 36 287.0 37 790.0 38 1735.0 39 542.0 40 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.708385481852314 16.44555694618273 15.844806007509387 41.00125156445557 2 19.400000000000002 24.975 37.175000000000004 18.45 3 20.825 28.000000000000004 27.950000000000003 23.225 4 23.825 32.975 20.575 22.625 5 23.08654327163582 36.84342171085543 22.411205602801402 17.658829414707352 6 17.424999999999997 38.224999999999994 23.825 20.525 7 16.5 18.2 44.4 20.9 8 19.7 22.8 30.725 26.775 9 20.75 23.150000000000002 31.85 24.25 10-11 22.412499999999998 34.125 22.662499999999998 20.8 12-13 20.349999999999998 26.7125 30.099999999999998 22.8375 14-15 20.325 28.675 28.849999999999998 22.15 16-17 22.8375 27.5625 27.8875 21.712500000000002 18-19 22.1 28.6125 27.400000000000002 21.8875 20-21 21.575 28.875 27.425 22.125 22-23 21.2375 29.862499999999997 27.6875 21.212500000000002 24-25 21.445542078279356 28.335625859697387 28.160560210078778 22.05827185194448 26-27 20.962500000000002 28.95 28.050000000000004 22.037499999999998 28-29 21.579672049067465 27.63800225309801 29.215170859932403 21.567154837902116 30-31 22.46993987975952 28.269038076152302 27.85571142284569 21.405310621242485 32-33 21.55 28.6625 28.125 21.6625 34-35 21.15 28.249999999999996 28.787499999999998 21.8125 36-37 21.675 28.449999999999996 27.712500000000002 22.162499999999998 38-39 21.224999999999998 28.1625 27.925 22.6875 40-41 21.45 28.487499999999997 28.0625 22.0 42-43 21.025 28.9125 27.8375 22.225 44-45 21.425 28.000000000000004 28.262500000000003 22.3125 46-47 21.5 28.65 26.937499999999996 22.912499999999998 48-49 22.0125 28.9125 27.425 21.65 50-51 22.2625 29.025000000000002 27.1625 21.55 52-53 22.15 27.800000000000004 28.225 21.825 54-55 22.0 28.599999999999998 27.900000000000002 21.5 56-57 22.287499999999998 27.3 28.037499999999998 22.375 58-59 21.8125 27.575 27.975 22.6375 60-61 21.6875 28.749999999999996 27.900000000000002 21.6625 62-63 21.125 27.8625 28.4 22.6125 64-65 21.912499999999998 29.1375 28.237499999999997 20.7125 66-67 20.925 28.3875 28.8625 21.825 68-69 22.7375 28.175 26.85 22.237499999999997 70-71 22.05 28.5625 27.8125 21.575 72-73 20.8875 28.287499999999998 28.6125 22.2125 74-75 21.4 28.3125 28.549999999999997 21.7375 76-77 21.0625 28.575 28.449999999999996 21.912499999999998 78-79 21.8125 28.0625 27.975 22.15 80-81 22.4875 27.9125 27.55 22.05 82-83 22.4875 28.075 28.1375 21.3 84-85 21.6125 28.575 27.8125 22.0 86-87 21.4125 27.5875 28.6125 22.3875 88-89 21.9375 29.125 27.85 21.087500000000002 90-91 21.8875 28.812500000000004 27.6375 21.6625 92-93 21.2 27.8875 29.4 21.512500000000003 94-95 22.412499999999998 28.199999999999996 27.875 21.512500000000003 96-97 22.0125 28.349999999999998 28.025 21.6125 98-99 20.974999999999998 28.449999999999996 28.3875 22.1875 100 22.275 28.249999999999996 28.475 21.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.5 20 1.5 21 2.0 22 3.0 23 1.0 24 1.0 25 6.0 26 8.0 27 4.5 28 7.5 29 13.0 30 20.0 31 25.5 32 30.0 33 40.0 34 57.0 35 76.5 36 100.0 37 109.5 38 127.0 39 166.5 40 204.5 41 253.0 42 278.0 43 275.0 44 281.5 45 299.0 46 276.5 47 234.0 48 210.5 49 186.0 50 155.0 51 131.0 52 106.0 53 72.5 54 56.0 55 48.0 56 31.5 57 15.5 58 19.0 59 20.0 60 11.0 61 7.5 62 7.5 63 5.0 64 2.0 65 1.5 66 0.0 67 2.5 68 3.0 69 1.5 70 1.0 71 0.0 72 0.0 73 0.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0375 26-27 0.0 28-29 0.13749999999999998 30-31 0.2 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84917043740573 99.3 2 0.10055304172951231 0.2 3 0.0 0.0 4 0.025138260432378077 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025138260432378077 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTAT 16 0.4 TruSeq Adapter, Index 16 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.1 0.0 0.0 0.0 0.0 2 0.1 0.0 0.0 0.0 0.0 3 0.1 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10-11 0.1 0.0 0.0 0.0 0.0 12-13 0.1 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.1 0.0 0.0 0.0 0.0 22-23 0.1 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88 0.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1414535 spots for SRR3207930.sra Written 1414535 spots for SRR3207930.sra Read 1414535 spots for SRR3207930.sra Written 1414535 spots for SRR3207930.sra Read 1414535 spots for SRR3207930.sra Written 1414535 spots for SRR3207930.sra Read 1414535 spots for SRR3207930.sra Written 1414535 spots for SRR3207930.sra Read 1414535 spots for SRR3207930.sra Written 1414535 spots for SRR3207930.sra Read 1414535 spots for SRR3207930.sra Written 1414535 spots for SRR3207930.sra Read 1414535 spots for SRR3207930.sra Written 1414535 spots for SRR3207930.sra Read 1414535 spots for SRR3207930.sra Written 1414535 spots for SRR3207930.sra Read 1414535 spots for SRR3207930.sra Written 1414535 spots for SRR3207930.sra Read 1414535 spots for SRR3207930.sra Written 1414535 spots for SRR3207930.sra Read 1414536 spots for SRR3207930.sra Written 1414536 spots for SRR3207930.sra Read 1414535 spots for SRR3207930.sra Written 1414535 spots for SRR3207930.sra Read 1414535 spots for SRR3207930.sra Written 1414535 spots for SRR3207930.sra Read 1414535 spots for SRR3207930.sra Written 1414535 spots for SRR3207930.sra Read 1414535 spots for SRR3207930.sra Written 1414535 spots for SRR3207930.sra Read 1414535 spots for SRR3207930.sra Written 1414535 spots for SRR3207930.sra Read 1414535 spots for SRR3207930.sra Written 1414535 spots for SRR3207930.sra Read 1414535 spots for SRR3207930.sra Written 1414535 spots for SRR3207930.sra Read 1414535 spots for SRR3207930.sra Written 1414535 spots for SRR3207930.sra Read 1414535 spots for SRR3207930.sra Written 1414535 spots for SRR3207930.sra SRR ids: ['SRR3207930.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uq0u9sv8 SRR3207930.sra spots: 28290701 blocks: [[1, 1414535], [1414536, 2829070], [2829071, 4243605], [4243606, 5658140], [5658141, 7072675], [7072676, 8487210], [8487211, 9901745], [9901746, 11316280], [11316281, 12730815], [12730816, 14145350], [14145351, 15559885], [15559886, 16974420], [16974421, 18388955], [18388956, 19803490], [19803491, 21218025], [21218026, 22632560], [22632561, 24047095], [24047096, 25461630], [25461631, 26876165], [26876166, 28290701]] SRR3207930 file size 7351546 SRR3207930 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207930 SRR3207930_1.fastq Input file: SRR3207930_1.fastq trimmed: SRR3207930-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 16:21:26 2025 >> started Tue Feb 11 16:21:41 2025 >> done (14.959s) 28290701 reads processed; of these: 2921 ( 0.01%) short reads filtered out after trimming by size control 165285 ( 0.58%) empty reads filtered out after trimming by size control 28122495 (99.41%) reads available; of these: 1272652 ( 4.53%) trimmed reads available after processing 26849843 (95.47%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 543 0.00% 19 749 0.00% 20 2157 0.01% 21 1063 0.00% 22 1445 0.01% 23 1979 0.01% 24 2735 0.01% 25 3413 0.01% 26 3607 0.01% 27 3691 0.01% 28 3622 0.01% 29 3561 0.01% 30 3684 0.01% 31 3803 0.01% 32 4028 0.01% 33 3937 0.01% 34 4158 0.01% 35 4295 0.02% 36 4320 0.02% 37 4633 0.02% 38 4626 0.02% 39 4798 0.02% 40 5136 0.02% 41 5433 0.02% 42 5576 0.02% 43 5675 0.02% 44 5778 0.02% 45 6111 0.02% 46 6286 0.02% 47 6384 0.02% 48 6627 0.02% 49 6899 0.02% 50 6747 0.02% 51 7152 0.03% 52 7210 0.03% 53 7664 0.03% 54 7967 0.03% 55 8283 0.03% 56 8674 0.03% 57 8647 0.03% 58 8966 0.03% 59 9173 0.03% 60 9400 0.03% 61 9608 0.03% 62 9769 0.03% 63 10069 0.04% 64 10654 0.04% 65 11425 0.04% 66 11192 0.04% 67 11824 0.04% 68 12218 0.04% 69 11785 0.04% 70 12653 0.04% 71 13904 0.05% 72 13858 0.05% 73 14268 0.05% 74 14468 0.05% 75 14532 0.05% 76 10486 0.04% 77 11659 0.04% 78 13038 0.05% 79 14183 0.05% 80 15056 0.05% 81 16091 0.06% 82 17192 0.06% 83 18611 0.07% 84 19402 0.07% 85 20815 0.07% 86 21970 0.08% 87 23572 0.08% 88 25717 0.09% 89 28597 0.10% 90 31421 0.11% 91 34334 0.12% 92 39046 0.14% 93 44885 0.16% 94 52043 0.19% 95 62466 0.22% 96 73590 0.26% 97 84677 0.30% 98 93915 0.33% 99 97024 0.35% 100 26849843 95.47% 28122495 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=36.65 fanout-score-rank=9 prefix-density=0.30 prefix-fanout=28.4 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTATGCCGTCTTCTGCTTGAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=14 fanout-score=292.13 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=28.5 sequence=TTCTTCTTCTTT Started job on | Feb 11 16:22:00 Started mapping on | Feb 11 16:22:00 Finished on | Feb 11 16:22:26 Mapping speed, Million of reads per hour | 3893.88 Number of input reads | 28122495 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 26981470 Uniquely mapped reads % | 95.94% Average mapped length | 98.86 Number of splices: Total | 8109684 Number of splices: Annotated (sjdb) | 7966244 Number of splices: GT/AG | 7989471 Number of splices: GC/AG | 99825 Number of splices: AT/AC | 7961 Number of splices: Non-canonical | 12427 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 2.01 Insertion rate per base | 0.01% Insertion average length | 1.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 570512 % of reads mapped to multiple loci | 2.03% Number of reads mapped to too many loci | 157139 % of reads mapped to too many loci | 0.56% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.46% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 570513 570513 570513 N_multimapping 570512 570512 570512 N_noFeature 1239376 13917043 14122982 N_ambiguous 266379 42875 43121 UnstrandedReadsAssigned:25475715 PositiveStrandReadsAssigned:13021552 NegativeStrandReadsAssigned:12815367 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207930 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207930-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,122,495 reads, 26,072,344 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,172 rounds 52401 SRR3207930.ke.tsv 34699 SRR3207930.se.tsv 87100 total ==> SRR3207930.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 621 18.9924 Potri.005G024800.1.v4.1 1035 936 91 5.70597 Potri.004G059700.1.v4.1 961 862 30 2.04257 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 475.543 9.8135 Potri.016G087400.1.v4.1 270 171 993 340.814 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 68.3835 2.3975 Potri.012G127500.1.v4.1 977 878 2963 198.062 ==> SRR3207930.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2336 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 558 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 63 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR3207930 completed mapping pipeline successfully