Starting /dee2/code/volunteer_pipeline.sh SRR3207931 current disk space = 3052784525312 free memory = 1579282032 SRR3207931 SRAfilesize 7bf185e2ad4902d335dcf59e9f78ab4e SRR3207931.sra SRR3207931.sra file validated SRR3207931 is single end SRR3207931 is conventional basespace SRR3207931 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207931_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.044 34.0 33.0 34.0 31.0 34.0 2 33.208 34.0 34.0 34.0 31.0 34.0 3 33.22125 34.0 34.0 34.0 31.0 34.0 4 36.5125 37.0 37.0 37.0 35.0 37.0 5 36.42075 37.0 37.0 37.0 35.0 37.0 6 36.41625 37.0 37.0 37.0 35.0 37.0 7 36.4205 37.0 37.0 37.0 35.0 37.0 8 36.41125 37.0 37.0 37.0 35.0 37.0 9 38.289 39.0 39.0 39.0 37.0 39.0 10-11 38.240375 39.0 39.0 39.0 37.0 39.0 12-13 37.982749999999996 39.0 38.5 39.0 36.0 39.0 14-15 39.779250000000005 41.0 40.0 41.0 37.0 41.0 16-17 39.754000000000005 41.0 40.0 41.0 38.0 41.0 18-19 39.70099999999999 41.0 40.0 41.0 37.0 41.0 20-21 39.69625 41.0 40.0 41.0 37.0 41.0 22-23 39.7185 41.0 40.0 41.0 37.0 41.0 24-25 39.65075 41.0 40.0 41.0 37.0 41.0 26-27 39.659499999999994 41.0 40.0 41.0 37.0 41.0 28-29 39.469375 41.0 40.0 41.0 37.0 41.0 30-31 39.3365 41.0 40.0 41.0 36.5 41.0 32-33 39.257625000000004 41.0 39.0 41.0 36.0 41.0 34-35 39.167249999999996 41.0 39.0 41.0 36.0 41.0 36-37 39.0205 41.0 39.0 41.0 35.0 41.0 38-39 38.937 41.0 39.0 41.0 35.0 41.0 40-41 38.70975 40.0 38.5 41.0 35.0 41.0 42-43 38.660624999999996 40.5 38.5 41.0 35.0 41.0 44-45 38.41425 40.0 38.0 41.0 34.0 41.0 46-47 38.58 40.0 38.0 41.0 35.0 41.0 48-49 38.435625 40.0 38.0 41.0 34.0 41.0 50-51 38.5745 41.0 38.5 41.0 34.5 41.0 52-53 38.62425 41.0 38.5 41.0 35.0 41.0 54-55 38.32925 40.5 38.0 41.0 34.5 41.0 56-57 38.207875 40.0 38.0 41.0 34.0 41.0 58-59 37.918875 40.0 37.0 41.0 34.0 41.0 60-61 37.749375 40.0 36.5 41.0 33.5 41.0 62-63 37.436125000000004 39.0 36.0 41.0 33.0 41.0 64-65 37.043125 39.0 35.5 41.0 32.5 41.0 66-67 36.64925 39.0 35.0 41.0 32.0 41.0 68-69 36.337 37.5 35.0 40.0 32.5 41.0 70-71 35.936625 37.0 35.0 39.5 32.0 41.0 72-73 34.899625 36.5 35.0 39.0 30.5 41.0 74-75 34.447125 36.0 35.0 39.0 30.5 40.0 76-77 33.51025 35.0 33.5 37.0 28.5 39.0 78-79 33.6575 35.0 34.0 37.0 29.0 39.0 80-81 33.433625 35.0 34.5 36.5 29.5 38.0 82-83 33.195375 35.0 34.0 36.0 30.0 37.0 84-85 32.934375 35.0 34.0 36.0 29.5 37.0 86-87 32.659125 35.0 34.0 35.5 29.0 36.5 88-89 32.457125000000005 35.0 34.0 35.0 29.0 36.0 90-91 32.15625 35.0 34.0 35.0 27.0 36.0 92-93 31.79925 35.0 34.0 35.0 25.5 36.0 94-95 31.931125 35.0 34.0 35.0 26.5 35.5 96-97 31.905625 35.0 34.0 35.0 27.0 35.0 98-99 31.791 35.0 34.0 35.0 27.0 35.0 100 31.7575 35.0 34.0 35.0 27.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 1.0 8 2.0 9 3.0 10 5.0 11 2.0 12 4.0 13 5.0 14 3.0 15 4.0 16 3.0 17 6.0 18 8.0 19 7.0 20 11.0 21 7.0 22 14.0 23 15.0 24 12.0 25 24.0 26 18.0 27 43.0 28 70.0 29 26.0 30 35.0 31 50.0 32 57.0 33 85.0 34 116.0 35 185.0 36 310.0 37 776.0 38 1596.0 39 495.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.175 16.35 15.024999999999999 41.449999999999996 2 20.45 24.925 34.2 20.424999999999997 3 21.975 25.525 28.65 23.849999999999998 4 23.75 31.65 19.975 24.625 5 26.474999999999998 33.0 21.099999999999998 19.425 6 22.5 34.35 23.35 19.8 7 17.224999999999998 20.3 42.9 19.575 8 19.900000000000002 24.9 27.075 28.125 9 22.6 22.225 30.15 25.025 10-11 24.837500000000002 32.875 21.087500000000002 21.2 12-13 20.3875 26.5125 29.225 23.875 14-15 21.575 28.1125 27.075 23.2375 16-17 24.575 26.724999999999998 25.85 22.85 18-19 21.4125 26.85 27.975 23.7625 20-21 22.8375 27.325 27.450000000000003 22.3875 22-23 22.237499999999997 30.3875 26.1125 21.2625 24-25 20.875 27.900000000000002 27.425 23.799999999999997 26-27 21.575 26.8125 26.737499999999997 24.875 28-29 23.380845211302827 28.59464866216554 25.95648912228057 22.06801700425106 30-31 21.533074903088657 26.822558459422286 28.523196198574464 23.121170438914593 32-33 21.625 28.6875 26.187500000000004 23.5 34-35 22.6875 28.175 27.375 21.762500000000003 36-37 22.112499999999997 25.874999999999996 29.625 22.3875 38-39 22.0875 27.175 26.5125 24.224999999999998 40-41 23.65 26.974999999999998 26.8 22.575 42-43 20.9375 29.3875 28.4125 21.2625 44-45 21.55 27.1375 28.287499999999998 23.025000000000002 46-47 23.625 27.212500000000002 26.6125 22.55 48-49 22.3125 27.450000000000003 27.474999999999998 22.7625 50-51 23.849999999999998 26.5125 28.125 21.512500000000003 52-53 22.4875 26.437500000000004 26.087500000000002 24.9875 54-55 23.549999999999997 27.3375 27.35 21.762500000000003 56-57 22.237499999999997 26.924999999999997 27.5625 23.275000000000002 58-59 22.05 27.625 27.487499999999997 22.8375 60-61 23.6125 26.174999999999997 27.9125 22.3 62-63 22.5125 26.875 27.737499999999997 22.875 64-65 23.150000000000002 26.85 28.6875 21.3125 66-67 21.675 30.312499999999996 26.4625 21.55 68-69 22.4625 29.762499999999996 26.125 21.65 70-71 22.3 29.912499999999998 26.6 21.1875 72-73 21.65 29.0875 26.575 22.6875 74-75 22.6375 29.25 26.1625 21.95 76-77 22.8625 29.1625 25.8625 22.112499999999997 78-79 21.987499999999997 28.8375 26.700000000000003 22.475 80-81 22.3625 29.037499999999998 26.424999999999997 22.175 82-83 22.475 28.375 27.150000000000002 22.0 84-85 21.4125 28.675 27.525 22.3875 86-87 22.7375 27.8875 26.5 22.875 88-89 22.725 28.575 26.35 22.35 90-91 22.325 28.6375 26.5 22.537499999999998 92-93 23.0125 27.975 26.424999999999997 22.5875 94-95 22.85 29.45 25.662499999999998 22.037499999999998 96-97 21.6 28.4 27.0125 22.9875 98-99 22.4375 28.199999999999996 27.437499999999996 21.925 100 22.675 27.650000000000002 26.775 22.900000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 1.0 18 0.5 19 0.5 20 2.5 21 2.0 22 1.5 23 2.0 24 2.0 25 2.5 26 5.0 27 8.0 28 8.5 29 13.5 30 15.0 31 18.5 32 28.5 33 33.0 34 50.5 35 67.0 36 77.0 37 94.0 38 119.5 39 144.0 40 175.0 41 217.0 42 228.5 43 234.5 44 264.5 45 256.0 46 236.5 47 247.5 48 238.0 49 206.5 50 159.5 51 133.0 52 130.0 53 103.5 54 67.5 55 60.0 56 57.0 57 38.5 58 30.5 59 27.5 60 23.5 61 25.0 62 26.0 63 21.0 64 13.5 65 11.0 66 10.0 67 7.5 68 8.5 69 7.0 70 5.0 71 3.0 72 3.0 73 5.0 74 4.0 75 5.0 76 5.0 77 3.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.025 30-31 0.0375 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.48333763885302 96.275 2 0.3616636528028933 0.7000000000000001 3 0.07749935417204858 0.22499999999999998 4 0.0 0.0 5 0.025833118057349523 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025833118057349523 0.475 >50 0.025833118057349523 2.1999999999999997 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTAT 88 2.1999999999999997 TruSeq Adapter, Index 14 (97% over 44bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTA 19 0.475 TruSeq Adapter, Index 14 (97% over 44bp) AAGCAGAAGACGGCATACGAGATACGGAACTGTGACTGGAGTTCAGACGT 5 0.125 TruSeq Adapter, Index 14 (96% over 30bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.5 0.0 0.0 0.0 0.0 2 0.5 0.0 0.0 0.0 0.0 3 0.5 0.0 0.0 0.0 0.0 4 0.5 0.0 0.0 0.0 0.0 5 0.5 0.0 0.0 0.0 0.0 6 0.5 0.0 0.0 0.0 0.0 7 0.5 0.0 0.0 0.0 0.0 8 0.5 0.0 0.0 0.0 0.0 9 0.5 0.0 0.0 0.0 0.0 10-11 0.5 0.0 0.0 0.0 0.0 12-13 0.5 0.0 0.0 0.0 0.0 14-15 0.5 0.0 0.0 0.0 0.0 16-17 0.5 0.0 0.0 0.0 0.0 18-19 0.5 0.0 0.0 0.0 0.0 20-21 0.5 0.0 0.0 0.0 0.0 22-23 0.5 0.0 0.0 0.0 0.0 24-25 0.5 0.0 0.0 0.0 0.0 26-27 0.5 0.0 0.0 0.0 0.0 28-29 0.5 0.0 0.0 0.0 0.0 30-31 0.5 0.0 0.0 0.0 0.0 32-33 0.5 0.0 0.0 0.0 0.0 34-35 0.5 0.0 0.0 0.0 0.0 36-37 0.5 0.0 0.0 0.0 0.0 38-39 0.5 0.0 0.0 0.0 0.0 40-41 0.5 0.0 0.0 0.0 0.0 42-43 0.5 0.0 0.0 0.0 0.0 44-45 0.5 0.0 0.0 0.0 0.0 46-47 0.5 0.0 0.0 0.0 0.0 48-49 0.5 0.0 0.0 0.0 0.0 50-51 0.5 0.0 0.0 0.0 0.0 52-53 0.5 0.0 0.0 0.0 0.0 54-55 0.5 0.0 0.0 0.0 0.0 56-57 0.5 0.0 0.0 0.0 0.0 58-59 0.5 0.0 0.0 0.0 0.0 60-61 0.5 0.0 0.0 0.0 0.0 62-63 0.525 0.0 0.0 0.0 0.0 64-65 0.55 0.0 0.0 0.0 0.0 66-67 0.55 0.0 0.0 0.0 0.0 68-69 0.55 0.0 0.0 0.0 0.0 70-71 0.55 0.0 0.0 0.0 0.0 72-73 0.5625 0.0 0.0 0.0 0.0 74-75 0.6375 0.0 0.0 0.0 0.0 76-77 0.65 0.0 0.0 0.0 0.0 78-79 0.65 0.0 0.0 0.0 0.0 80-81 0.675 0.0 0.0 0.0 0.0 82-83 0.7375 0.0 0.0 0.0 0.0 84-85 0.75 0.0 0.0 0.0 0.0 86-87 0.8625 0.0 0.0 0.0 0.0 88 0.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 337563 spots for SRR3207931.sra Written 337563 spots for SRR3207931.sra Read 337563 spots for SRR3207931.sra Written 337563 spots for SRR3207931.sra Read 337563 spots for SRR3207931.sra Written 337563 spots for SRR3207931.sra Read 337563 spots for SRR3207931.sra Written 337563 spots for SRR3207931.sra Read 337563 spots for SRR3207931.sra Written 337563 spots for SRR3207931.sra Read 337563 spots for SRR3207931.sra Written 337563 spots for SRR3207931.sra Read 337563 spots for SRR3207931.sra Written 337563 spots for SRR3207931.sra Read 337563 spots for SRR3207931.sra Written 337563 spots for SRR3207931.sra Read 337563 spots for SRR3207931.sra Written 337563 spots for SRR3207931.sra Read 337563 spots for SRR3207931.sra Written 337563 spots for SRR3207931.sra Read 337563 spots for SRR3207931.sra Written 337563 spots for SRR3207931.sra Read 337563 spots for SRR3207931.sra Written 337563 spots for SRR3207931.sra Read 337563 spots for SRR3207931.sra Written 337563 spots for SRR3207931.sra Read 337563 spots for SRR3207931.sra Written 337563 spots for SRR3207931.sra Read 337563 spots for SRR3207931.sra Written 337563 spots for SRR3207931.sra Read 337563 spots for SRR3207931.sra Written 337563 spots for SRR3207931.sra Read 337563 spots for SRR3207931.sra Written 337563 spots for SRR3207931.sra Read 337563 spots for SRR3207931.sra Written 337563 spots for SRR3207931.sra Read 337563 spots for SRR3207931.sra Written 337563 spots for SRR3207931.sra Read 337570 spots for SRR3207931.sra Written 337570 spots for SRR3207931.sra SRR ids: ['SRR3207931.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mmbrlkbs SRR3207931.sra spots: 6751267 blocks: [[1, 337563], [337564, 675126], [675127, 1012689], [1012690, 1350252], [1350253, 1687815], [1687816, 2025378], [2025379, 2362941], [2362942, 2700504], [2700505, 3038067], [3038068, 3375630], [3375631, 3713193], [3713194, 4050756], [4050757, 4388319], [4388320, 4725882], [4725883, 5063445], [5063446, 5401008], [5401009, 5738571], [5738572, 6076134], [6076135, 6413697], [6413698, 6751267]] SRR3207931 file size 1749300 SRR3207931 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207931 SRR3207931_1.fastq Input file: SRR3207931_1.fastq trimmed: SRR3207931-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 17:54:48 2025 >> started Tue Feb 11 17:54:51 2025 >> done (3.543s) 6751267 reads processed; of these: 1188 ( 0.02%) short reads filtered out after trimming by size control 203606 ( 3.02%) empty reads filtered out after trimming by size control 6546473 (96.97%) reads available; of these: 309428 ( 4.73%) trimmed reads available after processing 6237045 (95.27%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 187 0.00% 19 222 0.00% 20 448 0.01% 21 358 0.01% 22 444 0.01% 23 538 0.01% 24 738 0.01% 25 991 0.02% 26 937 0.01% 27 1089 0.02% 28 976 0.01% 29 1144 0.02% 30 1449 0.02% 31 1138 0.02% 32 1278 0.02% 33 1350 0.02% 34 1392 0.02% 35 1212 0.02% 36 1860 0.03% 37 1432 0.02% 38 1491 0.02% 39 3045 0.05% 40 1804 0.03% 41 2107 0.03% 42 1691 0.03% 43 1576 0.02% 44 1582 0.02% 45 1652 0.03% 46 1786 0.03% 47 1726 0.03% 48 1975 0.03% 49 1732 0.03% 50 1759 0.03% 51 1852 0.03% 52 2088 0.03% 53 1961 0.03% 54 2129 0.03% 55 1968 0.03% 56 2282 0.03% 57 2415 0.04% 58 2675 0.04% 59 2591 0.04% 60 2885 0.04% 61 2910 0.04% 62 2992 0.05% 63 2730 0.04% 64 2937 0.04% 65 3469 0.05% 66 2973 0.05% 67 3621 0.06% 68 3456 0.05% 69 3181 0.05% 70 3929 0.06% 71 4543 0.07% 72 4580 0.07% 73 3571 0.05% 74 3570 0.05% 75 3636 0.06% 76 2373 0.04% 77 2749 0.04% 78 2843 0.04% 79 3007 0.05% 80 3383 0.05% 81 3386 0.05% 82 4045 0.06% 83 4311 0.07% 84 4502 0.07% 85 4505 0.07% 86 4865 0.07% 87 5199 0.08% 88 5636 0.09% 89 6231 0.10% 90 6889 0.11% 91 7673 0.12% 92 8646 0.13% 93 9703 0.15% 94 11336 0.17% 95 13314 0.20% 96 15461 0.24% 97 18945 0.29% 98 20503 0.31% 99 21870 0.33% 100 6237045 95.27% 6546473 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=47.95 fanout-score-rank=2 prefix-density=0.47 prefix-fanout=36.4 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTATGCCGTCTTCTGCTTGAAAAAAAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=29 fanout-score=188.40 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=14.1 sequence=TTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCATCCAGAGCCGCAGCCACAGTTTCCTCCACAGCAAGACATTTTCTGTTGGAAAAGAAGGAAA Started job on | Feb 11 17:55:11 Started mapping on | Feb 11 17:55:11 Finished on | Feb 11 17:55:24 Mapping speed, Million of reads per hour | 1812.87 Number of input reads | 6546473 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 5484696 Uniquely mapped reads % | 83.78% Average mapped length | 98.96 Number of splices: Total | 1646075 Number of splices: Annotated (sjdb) | 1611771 Number of splices: GT/AG | 1618841 Number of splices: GC/AG | 22136 Number of splices: AT/AC | 1818 Number of splices: Non-canonical | 3280 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 2.03 Insertion rate per base | 0.01% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 175069 % of reads mapped to multiple loci | 2.67% Number of reads mapped to too many loci | 613534 % of reads mapped to too many loci | 9.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.14% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 886708 886708 886708 N_multimapping 175069 175069 175069 N_noFeature 298655 2852332 2900779 N_ambiguous 51826 10914 10753 UnstrandedReadsAssigned:5134215 PositiveStrandReadsAssigned:2621450 NegativeStrandReadsAssigned:2573164 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207931 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207931-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,546,473 reads, 5,814,985 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,126 rounds 52401 SRR3207931.ke.tsv 34699 SRR3207931.se.tsv 87100 total ==> SRR3207931.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 287 35.5827 Potri.005G024800.1.v4.1 1035 936 188 47.7875 Potri.004G059700.1.v4.1 961 862 5 1.38005 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 110.202 9.2192 Potri.016G087400.1.v4.1 270 171 163 226.79 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 25 3.55317 Potri.012G127500.1.v4.1 977 878 972 263.393 ==> SRR3207931.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 368 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 89 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR3207931 completed mapping pipeline successfully