Starting /dee2/code/volunteer_pipeline.sh SRR3207932 current disk space = 3053438656512 free memory = 1578327756 SRR3207932 SRAfilesize 17f000cdbc9d84623314f1d5774af19c SRR3207932.sra SRR3207932.sra file validated SRR3207932 is single end SRR3207932 is conventional basespace SRR3207932 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207932_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1195 34.0 33.0 34.0 31.0 34.0 2 33.2865 34.0 34.0 34.0 31.0 34.0 3 33.3335 34.0 34.0 34.0 31.0 34.0 4 36.546 37.0 37.0 37.0 35.0 37.0 5 36.44 37.0 37.0 37.0 35.0 37.0 6 36.398 37.0 37.0 37.0 35.0 37.0 7 36.4445 37.0 37.0 37.0 35.0 37.0 8 36.41775 37.0 37.0 37.0 35.0 37.0 9 38.27525 39.0 39.0 39.0 37.0 39.0 10-11 38.26375 39.0 39.0 39.0 37.0 39.0 12-13 37.956 39.0 38.5 39.0 36.0 39.0 14-15 39.904250000000005 41.0 40.0 41.0 38.0 41.0 16-17 39.94025 41.0 40.0 41.0 38.0 41.0 18-19 39.819125 41.0 40.0 41.0 38.0 41.0 20-21 39.855625 41.0 40.0 41.0 38.0 41.0 22-23 39.857124999999996 41.0 40.0 41.0 38.0 41.0 24-25 39.778499999999994 41.0 40.0 41.0 37.5 41.0 26-27 39.783500000000004 41.0 40.0 41.0 37.5 41.0 28-29 39.6475 41.0 40.0 41.0 37.0 41.0 30-31 39.539 41.0 40.0 41.0 37.0 41.0 32-33 39.481375 41.0 40.0 41.0 37.0 41.0 34-35 39.43275 41.0 40.0 41.0 37.0 41.0 36-37 39.410375 41.0 40.0 41.0 37.0 41.0 38-39 39.27525 41.0 39.5 41.0 36.5 41.0 40-41 39.22925 41.0 39.5 41.0 36.5 41.0 42-43 39.1935 41.0 39.0 41.0 36.0 41.0 44-45 38.888374999999996 41.0 39.0 41.0 35.0 41.0 46-47 39.06 41.0 39.0 41.0 35.5 41.0 48-49 39.0625 41.0 39.0 41.0 35.0 41.0 50-51 39.214124999999996 41.0 39.0 41.0 36.0 41.0 52-53 39.218500000000006 41.0 39.0 41.0 36.0 41.0 54-55 38.90925 41.0 39.0 41.0 35.0 41.0 56-57 38.898125 41.0 39.0 41.0 35.0 41.0 58-59 38.616 41.0 38.5 41.0 35.0 41.0 60-61 38.535375 40.0 38.0 41.0 35.0 41.0 62-63 38.206500000000005 40.0 37.0 41.0 34.5 41.0 64-65 37.86525 39.5 37.0 41.0 34.0 41.0 66-67 37.522999999999996 39.0 36.0 41.0 34.0 41.0 68-69 37.202 39.0 36.0 41.0 34.0 41.0 70-71 36.748125 37.5 35.0 40.0 33.5 41.0 72-73 36.017875000000004 37.0 35.0 39.0 33.0 41.0 74-75 35.59625 36.5 35.0 39.0 32.5 40.5 76-77 34.649375000000006 36.0 34.5 37.0 31.0 39.0 78-79 34.746625 35.5 35.0 37.0 32.0 39.0 80-81 34.465875 35.0 35.0 37.0 32.0 39.0 82-83 34.226 35.0 35.0 36.5 32.0 37.0 84-85 33.997625 35.0 35.0 36.0 32.0 37.0 86-87 33.66175 35.0 35.0 36.0 31.0 36.5 88-89 33.490624999999994 35.0 35.0 35.5 31.5 36.0 90-91 33.267125 35.0 34.5 35.0 31.0 36.0 92-93 33.009 35.0 34.0 35.0 30.5 36.0 94-95 33.12587499999999 35.0 34.0 35.0 31.0 36.0 96-97 32.99225 35.0 34.0 35.0 31.0 35.0 98-99 32.846375 35.0 34.0 35.0 31.0 35.0 100 32.70775 35.0 34.0 35.0 30.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 2.0 7 0.0 8 0.0 9 2.0 10 2.0 11 1.0 12 2.0 13 2.0 14 3.0 15 1.0 16 1.0 17 2.0 18 8.0 19 10.0 20 6.0 21 6.0 22 8.0 23 8.0 24 11.0 25 12.0 26 15.0 27 17.0 28 34.0 29 21.0 30 31.0 31 29.0 32 57.0 33 83.0 34 90.0 35 121.0 36 260.0 37 715.0 38 1822.0 39 613.0 40 3.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.724999999999998 16.875 14.075 45.324999999999996 2 18.85 25.1 37.1 18.95 3 21.2 28.349999999999998 27.700000000000003 22.75 4 22.7 32.95 22.075 22.275 5 24.83741870935468 35.01750875437719 21.83591795897949 18.309154577288645 6 18.075 37.9 25.124999999999996 18.9 7 16.725 18.25 44.75 20.275000000000002 8 18.6 24.575 30.325000000000003 26.5 9 21.5 22.25 30.475 25.775 10-11 22.787499999999998 32.7875 23.0375 21.3875 12-13 20.962500000000002 26.775 29.45 22.8125 14-15 20.1875 28.249999999999996 28.6875 22.875 16-17 21.575 27.750000000000004 27.712500000000002 22.9625 18-19 21.8875 28.237499999999997 27.6375 22.237499999999997 20-21 22.0625 27.825 27.825 22.287499999999998 22-23 21.712500000000002 29.2375 27.200000000000003 21.85 24-25 21.4375 28.5625 27.787499999999998 22.2125 26-27 20.75 28.7375 27.500000000000004 23.0125 28-29 21.442860715178792 29.119779944986245 27.84446111527882 21.59289822455614 30-31 20.482681005377014 27.885457046392396 28.398149305989744 23.23371264224084 32-33 21.925 28.199999999999996 28.262500000000003 21.6125 34-35 21.9375 28.299999999999997 27.762500000000003 22.0 36-37 22.237499999999997 28.237499999999997 27.3875 22.1375 38-39 20.95 28.975 27.6625 22.412499999999998 40-41 21.2875 28.6125 28.499999999999996 21.6 42-43 20.625 29.325000000000003 28.749999999999996 21.3 44-45 20.9125 28.349999999999998 28.0625 22.675 46-47 21.6 28.0625 28.325 22.0125 48-49 21.425 27.450000000000003 29.012500000000003 22.112499999999997 50-51 22.3375 27.1375 28.5875 21.9375 52-53 21.625 28.000000000000004 28.325 22.05 54-55 22.162499999999998 28.6625 27.5125 21.6625 56-57 21.475 27.5625 28.9 22.0625 58-59 22.237499999999997 28.3375 27.650000000000002 21.775 60-61 21.4875 28.4 28.0875 22.025 62-63 21.912499999999998 27.6 28.65 21.837500000000002 64-65 22.8625 27.200000000000003 28.925 21.0125 66-67 21.5625 29.049999999999997 28.1125 21.275 68-69 22.275 29.75 27.125 20.849999999999998 70-71 21.4375 29.65 27.762500000000003 21.15 72-73 21.675 28.3375 27.987499999999997 22.0 74-75 22.175 27.85 28.037499999999998 21.9375 76-77 22.412499999999998 28.275 28.4125 20.9 78-79 22.5125 27.400000000000002 27.9125 22.175 80-81 21.7 29.049999999999997 28.075 21.175 82-83 21.475 28.749999999999996 28.349999999999998 21.425 84-85 22.3 28.175 27.5125 22.0125 86-87 22.4625 27.875 27.5625 22.1 88-89 21.275 29.15 27.750000000000004 21.825 90-91 22.3 27.425 27.3875 22.8875 92-93 21.912499999999998 28.6875 26.987499999999997 22.412499999999998 94-95 21.825 29.062500000000004 27.8625 21.25 96-97 22.0625 29.075 27.250000000000004 21.6125 98-99 22.3375 28.3375 27.712500000000002 21.6125 100 22.25 27.675 27.825 22.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 1.5 22 2.5 23 1.5 24 1.5 25 2.0 26 3.5 27 6.5 28 8.5 29 15.0 30 20.5 31 22.5 32 30.5 33 41.5 34 56.5 35 72.5 36 88.0 37 120.5 38 155.5 39 180.5 40 205.5 41 235.0 42 255.5 43 262.5 44 270.5 45 264.5 46 254.0 47 255.0 48 226.0 49 189.5 50 168.5 51 144.5 52 113.5 53 83.5 54 64.0 55 47.5 56 33.0 57 23.5 58 17.5 59 9.5 60 7.5 61 7.0 62 4.0 63 2.5 64 4.0 65 4.5 66 4.0 67 2.0 68 1.0 69 0.5 70 1.5 71 2.0 72 1.0 73 0.5 74 0.5 75 0.5 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.025 30-31 0.0375 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79772439949431 98.675 2 0.12642225031605564 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025284450063211124 0.2 9 0.0 0.0 >10 0.05056890012642225 0.8750000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTAT 25 0.625 TruSeq Adapter, Index 15 (97% over 40bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTA 10 0.25 TruSeq Adapter, Index 15 (97% over 40bp) AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCT 8 0.2 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.25 0.0 0.0 0.0 0.0 2 0.25 0.0 0.0 0.0 0.0 3 0.25 0.0 0.0 0.0 0.0 4 0.25 0.0 0.0 0.0 0.0 5 0.25 0.0 0.0 0.0 0.0 6 0.25 0.0 0.0 0.0 0.0 7 0.25 0.0 0.0 0.0 0.0 8 0.275 0.0 0.0 0.0 0.0 9 0.275 0.0 0.0 0.0 0.0 10-11 0.275 0.0 0.0 0.0 0.0 12-13 0.275 0.0 0.0 0.0 0.0 14-15 0.3 0.0 0.0 0.0 0.0 16-17 0.3 0.0 0.0 0.0 0.0 18-19 0.3 0.0 0.0 0.0 0.0 20-21 0.3 0.0 0.0 0.0 0.0 22-23 0.325 0.0 0.0 0.0 0.0 24-25 0.325 0.0 0.0 0.0 0.0 26-27 0.325 0.0 0.0 0.0 0.0 28-29 0.325 0.0 0.0 0.0 0.0 30-31 0.325 0.0 0.0 0.0 0.0 32-33 0.325 0.0 0.0 0.0 0.0 34-35 0.325 0.0 0.0 0.0 0.0 36-37 0.325 0.0 0.0 0.0 0.0 38-39 0.325 0.0 0.0 0.0 0.0 40-41 0.325 0.0 0.0 0.0 0.0 42-43 0.325 0.0 0.0 0.0 0.0 44-45 0.325 0.0 0.0 0.0 0.0 46-47 0.325 0.0 0.0 0.0 0.0 48-49 0.35 0.0 0.0 0.0 0.0 50-51 0.35 0.0 0.0 0.0 0.0 52-53 0.3625 0.0 0.0 0.0 0.0 54-55 0.375 0.0 0.0 0.0 0.0 56-57 0.375 0.0 0.0 0.0 0.0 58-59 0.4 0.0 0.0 0.0 0.0 60-61 0.45 0.0 0.0 0.0 0.0 62-63 0.45 0.0 0.0 0.0 0.0 64-65 0.4625 0.0 0.0 0.0 0.0 66-67 0.525 0.0 0.0 0.0 0.0 68-69 0.55 0.0 0.0 0.0 0.0 70-71 0.55 0.0 0.0 0.0 0.0 72-73 0.5625 0.0 0.0 0.0 0.0 74-75 0.625 0.0 0.0 0.0 0.0 76-77 0.625 0.0 0.0 0.0 0.0 78-79 0.625 0.0 0.0 0.0 0.0 80-81 0.65 0.0 0.0 0.0 0.0 82-83 0.6875 0.0 0.0 0.0 0.0 84-85 0.7 0.0 0.0 0.0 0.0 86-87 0.7625 0.0 0.0 0.0 0.0 88 0.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 837606 spots for SRR3207932.sra Written 837606 spots for SRR3207932.sra Read 837606 spots for SRR3207932.sra Written 837606 spots for SRR3207932.sra Read 837606 spots for SRR3207932.sra Written 837606 spots for SRR3207932.sra Read 837606 spots for SRR3207932.sra Written 837606 spots for SRR3207932.sra Read 837606 spots for SRR3207932.sra Written 837606 spots for SRR3207932.sra Read 837606 spots for SRR3207932.sra Written 837606 spots for SRR3207932.sra Read 837606 spots for SRR3207932.sra Written 837606 spots for SRR3207932.sra Read 837606 spots for SRR3207932.sra Written 837606 spots for SRR3207932.sra Read 837613 spots for SRR3207932.sra Written 837613 spots for SRR3207932.sra Read 837606 spots for SRR3207932.sra Written 837606 spots for SRR3207932.sra Read 837606 spots for SRR3207932.sra Written 837606 spots for SRR3207932.sra Read 837606 spots for SRR3207932.sra Written 837606 spots for SRR3207932.sra Read 837606 spots for SRR3207932.sra Written 837606 spots for SRR3207932.sra Read 837606 spots for SRR3207932.sra Written 837606 spots for SRR3207932.sra Read 837606 spots for SRR3207932.sra Written 837606 spots for SRR3207932.sra Read 837606 spots for SRR3207932.sra Written 837606 spots for SRR3207932.sra Read 837606 spots for SRR3207932.sra Written 837606 spots for SRR3207932.sra Read 837606 spots for SRR3207932.sra Written 837606 spots for SRR3207932.sra Read 837606 spots for SRR3207932.sra Written 837606 spots for SRR3207932.sra Read 837606 spots for SRR3207932.sra Written 837606 spots for SRR3207932.sra SRR ids: ['SRR3207932.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_v4126apx SRR3207932.sra spots: 16752127 blocks: [[1, 837606], [837607, 1675212], [1675213, 2512818], [2512819, 3350424], [3350425, 4188030], [4188031, 5025636], [5025637, 5863242], [5863243, 6700848], [6700849, 7538454], [7538455, 8376060], [8376061, 9213666], [9213667, 10051272], [10051273, 10888878], [10888879, 11726484], [11726485, 12564090], [12564091, 13401696], [13401697, 14239302], [14239303, 15076908], [15076909, 15914514], [15914515, 16752127]] SRR3207932 file size 4348788 SRR3207932 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207932 SRR3207932_1.fastq Input file: SRR3207932_1.fastq trimmed: SRR3207932-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 18:32:14 2025 >> started Tue Feb 11 18:32:22 2025 >> done (8.075s) 16752127 reads processed; of these: 3435 ( 0.02%) short reads filtered out after trimming by size control 157465 ( 0.94%) empty reads filtered out after trimming by size control 16591227 (99.04%) reads available; of these: 747322 ( 4.50%) trimmed reads available after processing 15843905 (95.50%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 715 0.00% 19 861 0.01% 20 766 0.00% 21 791 0.00% 22 996 0.01% 23 1244 0.01% 24 1747 0.01% 25 2144 0.01% 26 2129 0.01% 27 2164 0.01% 28 2208 0.01% 29 2311 0.01% 30 2358 0.01% 31 2550 0.02% 32 3166 0.02% 33 3555 0.02% 34 3068 0.02% 35 2781 0.02% 36 3092 0.02% 37 5046 0.03% 38 3867 0.02% 39 3563 0.02% 40 6024 0.04% 41 4383 0.03% 42 5500 0.03% 43 5401 0.03% 44 4319 0.03% 45 4969 0.03% 46 4252 0.03% 47 4304 0.03% 48 4512 0.03% 49 4882 0.03% 50 4919 0.03% 51 5538 0.03% 52 5787 0.03% 53 7310 0.04% 54 6685 0.04% 55 7288 0.04% 56 6728 0.04% 57 8034 0.05% 58 8092 0.05% 59 8239 0.05% 60 7872 0.05% 61 7563 0.05% 62 8703 0.05% 63 7687 0.05% 64 8672 0.05% 65 9971 0.06% 66 8025 0.05% 67 7777 0.05% 68 8638 0.05% 69 6977 0.04% 70 7947 0.05% 71 10300 0.06% 72 9378 0.06% 73 8259 0.05% 74 7789 0.05% 75 7659 0.05% 76 5574 0.03% 77 6221 0.04% 78 6960 0.04% 79 8405 0.05% 80 7899 0.05% 81 8120 0.05% 82 8805 0.05% 83 9876 0.06% 84 10481 0.06% 85 11053 0.07% 86 11902 0.07% 87 12284 0.07% 88 13623 0.08% 89 14748 0.09% 90 18109 0.11% 91 17899 0.11% 92 19730 0.12% 93 22009 0.13% 94 26208 0.16% 95 30402 0.18% 96 36594 0.22% 97 42331 0.26% 98 47471 0.29% 99 49113 0.30% 100 15843905 95.50% 16591227 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=38.73 fanout-score-rank=8 prefix-density=0.38 prefix-fanout=32.4 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATGCCGTCTTCTGCTTGAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=14 fanout-score=242.47 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=25.9 sequence=CTTCTTCTTCTT Started job on | Feb 11 18:32:41 Started mapping on | Feb 11 18:32:41 Finished on | Feb 11 18:33:00 Mapping speed, Million of reads per hour | 3143.60 Number of input reads | 16591227 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 15650996 Uniquely mapped reads % | 94.33% Average mapped length | 98.94 Number of splices: Total | 4710897 Number of splices: Annotated (sjdb) | 4627814 Number of splices: GT/AG | 4641409 Number of splices: GC/AG | 57233 Number of splices: AT/AC | 4821 Number of splices: Non-canonical | 7434 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.02% Deletion average length | 1.98 Insertion rate per base | 0.01% Insertion average length | 1.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 350120 % of reads mapped to multiple loci | 2.11% Number of reads mapped to too many loci | 73173 % of reads mapped to too many loci | 0.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.11% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 590111 590111 590111 N_multimapping 350120 350120 350120 N_noFeature 651726 8045596 8146233 N_ambiguous 163622 26146 26780 UnstrandedReadsAssigned:14835648 PositiveStrandReadsAssigned:7579254 NegativeStrandReadsAssigned:7477983 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207932 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207932-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,591,227 reads, 15,197,389 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,089 rounds 52401 SRR3207932.ke.tsv 34699 SRR3207932.se.tsv 87100 total ==> SRR3207932.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 481 24.7834 Potri.005G024800.1.v4.1 1035 936 57 6.0213 Potri.004G059700.1.v4.1 961 862 15 1.72058 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 275.639 9.58304 Potri.016G087400.1.v4.1 270 171 655 378.736 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 38 2.2445 Potri.012G127500.1.v4.1 977 878 1509 169.936 ==> SRR3207932.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1693 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 272 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 44 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3207932 completed mapping pipeline successfully