Starting /dee2/code/volunteer_pipeline.sh SRR3207933 current disk space = 3048425668608 free memory = 1436537380 SRR3207933 SRAfilesize efb51978c559dec3f8b534e8c8b4ecd7 SRR3207933.sra SRR3207933.sra file validated SRR3207933 is single end SRR3207933 is conventional basespace SRR3207933 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207933_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0005 34.0 33.0 34.0 31.0 34.0 2 33.17225 34.0 34.0 34.0 31.0 34.0 3 33.21875 34.0 34.0 34.0 31.0 34.0 4 36.47275 37.0 37.0 37.0 35.0 37.0 5 36.3785 37.0 37.0 37.0 35.0 37.0 6 36.3775 37.0 37.0 37.0 35.0 37.0 7 36.33075 37.0 37.0 37.0 35.0 37.0 8 36.36875 37.0 37.0 37.0 35.0 37.0 9 38.20525 39.0 39.0 39.0 37.0 39.0 10-11 38.193625 39.0 39.0 39.0 37.0 39.0 12-13 37.94175 39.0 38.5 39.0 36.0 39.0 14-15 39.755875 41.0 40.0 41.0 37.0 41.0 16-17 39.75125 41.0 40.0 41.0 37.5 41.0 18-19 39.589749999999995 41.0 40.0 41.0 37.0 41.0 20-21 39.733125 41.0 40.0 41.0 37.0 41.0 22-23 39.739875 41.0 40.0 41.0 37.0 41.0 24-25 39.64 41.0 40.0 41.0 37.0 41.0 26-27 39.637249999999995 41.0 40.0 41.0 37.0 41.0 28-29 39.502250000000004 41.0 40.0 41.0 37.0 41.0 30-31 39.394375 41.0 40.0 41.0 37.0 41.0 32-33 39.36425 41.0 40.0 41.0 36.5 41.0 34-35 39.2445 41.0 39.5 41.0 36.0 41.0 36-37 39.11125 41.0 39.0 41.0 36.0 41.0 38-39 39.057125 41.0 39.0 41.0 35.0 41.0 40-41 38.987375 40.5 39.0 41.0 35.5 41.0 42-43 38.887375 40.5 39.0 41.0 35.0 41.0 44-45 38.6485 40.5 38.5 41.0 34.5 41.0 46-47 38.716375 40.0 38.5 41.0 35.0 41.0 48-49 38.64125 40.0 38.5 41.0 35.0 41.0 50-51 38.754375 41.0 39.0 41.0 35.0 41.0 52-53 38.799625 41.0 39.0 41.0 35.0 41.0 54-55 38.55375 41.0 38.5 41.0 34.5 41.0 56-57 38.504625000000004 40.5 38.0 41.0 35.0 41.0 58-59 38.236875 40.0 38.0 41.0 34.0 41.0 60-61 38.118875 40.0 37.0 41.0 34.0 41.0 62-63 37.805375 40.0 37.0 41.0 34.0 41.0 64-65 37.500625 39.5 36.0 41.0 33.5 41.0 66-67 37.174875 39.0 36.0 41.0 33.0 41.0 68-69 36.800125 39.0 35.0 41.0 32.5 41.0 70-71 36.45825 37.5 35.0 40.0 32.5 41.0 72-73 35.702 37.0 35.0 39.0 31.5 41.0 74-75 35.168125 36.5 35.0 39.0 31.5 40.5 76-77 34.2715 35.5 34.5 37.0 30.5 39.0 78-79 34.318625 35.5 35.0 37.0 31.0 39.0 80-81 34.11025 35.0 35.0 37.0 31.0 39.0 82-83 33.756249999999994 35.0 35.0 36.0 31.0 37.0 84-85 33.465 35.0 35.0 36.0 31.0 37.0 86-87 33.23025 35.0 34.0 36.0 30.5 37.0 88-89 32.983374999999995 35.0 34.0 35.0 30.0 36.0 90-91 32.6935 35.0 34.0 35.0 29.0 36.0 92-93 32.460375 35.0 34.0 35.0 29.0 36.0 94-95 32.54 35.0 34.0 35.0 29.0 36.0 96-97 32.409125 35.0 34.0 35.0 29.0 35.0 98-99 32.269375 35.0 34.0 35.0 29.0 35.0 100 32.2225 35.0 34.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 1.0 9 2.0 10 2.0 11 1.0 12 4.0 13 4.0 14 5.0 15 4.0 16 2.0 17 1.0 18 11.0 19 2.0 20 2.0 21 15.0 22 14.0 23 12.0 24 2.0 25 20.0 26 24.0 27 39.0 28 42.0 29 29.0 30 49.0 31 46.0 32 40.0 33 89.0 34 112.0 35 155.0 36 265.0 37 680.0 38 1756.0 39 563.0 40 4.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.324999999999996 18.2 13.850000000000001 42.625 2 21.5 23.425 36.65 18.425 3 20.8 27.075 28.349999999999998 23.775 4 22.0 31.574999999999996 23.45 22.975 5 24.73736868434217 34.19209604802401 23.06153076538269 18.009004502251123 6 20.95 35.075 24.875 19.1 7 17.375 20.674999999999997 41.949999999999996 20.0 8 19.3 25.75 28.775000000000002 26.174999999999997 9 19.375 24.6 32.05 23.974999999999998 10-11 23.75 32.15 22.625 21.475 12-13 19.662499999999998 26.7625 30.95 22.625 14-15 20.375 28.025 28.525 23.075000000000003 16-17 22.05 28.875 27.037499999999998 22.037499999999998 18-19 21.6875 27.725 27.787499999999998 22.8 20-21 21.05 27.9125 28.787499999999998 22.25 22-23 20.8125 29.599999999999998 27.6375 21.95 24-25 20.76509563695462 29.316164520565067 27.315914489311165 22.602825353169145 26-27 21.0625 28.712500000000002 27.175 23.05 28-29 21.48305614605477 29.19844941853195 27.12267100162561 22.19582343378767 30-31 20.95785919719895 27.01012879829936 28.710766537451544 23.321245467050144 32-33 21.6125 28.1375 27.35 22.900000000000002 34-35 21.5 27.775 26.8625 23.8625 36-37 21.825 27.200000000000003 28.6625 22.3125 38-39 20.474999999999998 28.537499999999998 27.950000000000003 23.0375 40-41 21.825 28.712500000000002 26.2625 23.200000000000003 42-43 21.099999999999998 28.962500000000002 28.275 21.6625 44-45 21.099999999999998 27.1125 28.6125 23.175 46-47 22.0125 27.825 27.925 22.237499999999997 48-49 21.1875 29.562500000000004 28.1125 21.1375 50-51 22.400000000000002 29.262500000000003 27.200000000000003 21.1375 52-53 21.7 28.9125 26.7125 22.675 54-55 22.6125 27.962500000000002 27.712500000000002 21.712500000000002 56-57 21.9625 26.875 27.950000000000003 23.2125 58-59 22.225 27.5875 28.975 21.212500000000002 60-61 21.912499999999998 27.825 29.425 20.837500000000002 62-63 21.224999999999998 28.212500000000002 28.449999999999996 22.112499999999997 64-65 21.975 28.487499999999997 28.1125 21.425 66-67 21.987499999999997 29.599999999999998 26.5 21.912499999999998 68-69 21.4875 29.5375 27.375 21.6 70-71 20.4875 31.025000000000002 27.200000000000003 21.2875 72-73 21.825 29.125 27.987499999999997 21.0625 74-75 21.2375 29.562500000000004 27.8375 21.3625 76-77 21.1625 29.75 27.250000000000004 21.837500000000002 78-79 21.1125 29.7 27.1125 22.075 80-81 21.675 28.962500000000002 26.9125 22.45 82-83 21.8875 29.45 27.975 20.6875 84-85 21.8625 28.4 27.6125 22.125 86-87 21.175 28.725 28.299999999999997 21.8 88-89 21.8 29.312500000000004 27.1 21.7875 90-91 21.925 28.812500000000004 27.4125 21.85 92-93 21.462500000000002 29.037499999999998 27.325 22.175 94-95 22.4375 28.749999999999996 26.8125 22.0 96-97 21.7375 28.9375 27.5625 21.762500000000003 98-99 22.3125 28.525 27.650000000000002 21.512500000000003 100 21.95 27.425 28.025 22.6 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 5.0 1 2.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 1.0 22 2.0 23 2.5 24 4.0 25 6.5 26 7.5 27 8.0 28 9.5 29 13.0 30 21.0 31 26.0 32 32.0 33 47.0 34 60.0 35 69.0 36 95.5 37 126.5 38 149.5 39 179.0 40 211.0 41 217.0 42 225.0 43 270.5 44 274.0 45 258.0 46 247.5 47 243.5 48 231.0 49 197.5 50 166.0 51 127.5 52 105.0 53 79.0 54 60.0 55 42.5 56 31.5 57 32.0 58 25.5 59 16.0 60 11.0 61 11.5 62 7.0 63 6.5 64 7.5 65 6.5 66 5.5 67 2.5 68 3.5 69 3.0 70 1.0 71 1.5 72 1.0 73 1.5 74 1.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0125 26-27 0.0 28-29 0.0375 30-31 0.0375 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69293756397134 97.39999999999999 2 0.23029682702149437 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0255885363357216 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0511770726714432 2.025 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTAT 44 1.0999999999999999 TruSeq Adapter, Index 16 (97% over 40bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTA 37 0.9249999999999999 TruSeq Adapter, Index 16 (97% over 40bp) AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.975 0.0 0.0 0.0 0.0 2 0.975 0.0 0.0 0.0 0.0 3 0.975 0.0 0.0 0.0 0.0 4 0.975 0.0 0.0 0.0 0.0 5 0.975 0.0 0.0 0.0 0.0 6 0.975 0.0 0.0 0.0 0.0 7 0.975 0.0 0.0 0.0 0.0 8 0.975 0.0 0.0 0.0 0.0 9 0.975 0.0 0.0 0.0 0.0 10-11 0.975 0.0 0.0 0.0 0.0 12-13 0.975 0.0 0.0 0.0 0.0 14-15 0.975 0.0 0.0 0.0 0.0 16-17 0.975 0.0 0.0 0.0 0.0 18-19 0.975 0.0 0.0 0.0 0.0 20-21 0.9875 0.0 0.0 0.0 0.0 22-23 1.0 0.0 0.0 0.0 0.0 24-25 1.0 0.0 0.0 0.0 0.0 26-27 1.0 0.0 0.0 0.0 0.0 28-29 1.0 0.0 0.0 0.0 0.0 30-31 1.0 0.0 0.0 0.0 0.0 32-33 1.0 0.0 0.0 0.0 0.0 34-35 1.0 0.0 0.0 0.0 0.0 36-37 1.0 0.0 0.0 0.0 0.0 38-39 1.0 0.0 0.0 0.0 0.0 40-41 1.0 0.0 0.0 0.0 0.0 42-43 1.0125 0.0 0.0 0.0 0.0 44-45 1.025 0.0 0.0 0.0 0.0 46-47 1.025 0.0 0.0 0.0 0.0 48-49 1.05 0.0 0.0 0.0 0.0 50-51 1.05 0.0 0.0 0.0 0.0 52-53 1.05 0.0 0.0 0.0 0.0 54-55 1.05 0.0 0.0 0.0 0.0 56-57 1.05 0.0 0.0 0.0 0.0 58-59 1.05 0.0 0.0 0.0 0.0 60-61 1.075 0.0 0.0 0.0 0.0 62-63 1.1125 0.0 0.0 0.0 0.0 64-65 1.1375 0.0 0.0 0.0 0.0 66-67 1.1625 0.0 0.0 0.0 0.0 68-69 1.175 0.0 0.0 0.0 0.0 70-71 1.1875 0.0 0.0 0.0 0.0 72-73 1.2625 0.0 0.0 0.0 0.0 74-75 1.2875 0.0 0.0 0.0 0.0 76-77 1.3624999999999998 0.0 0.0 0.0 0.0 78-79 1.4875 0.0 0.0 0.0 0.0 80-81 1.5750000000000002 0.0 0.0 0.0 0.0 82-83 1.6375 0.0 0.0 0.0 0.0 84-85 1.7374999999999998 0.0 0.0 0.0 0.0 86-87 1.8125 0.0 0.0 0.0 0.0 88 1.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 453533 spots for SRR3207933.sra Written 453533 spots for SRR3207933.sra Read 453533 spots for SRR3207933.sra Written 453533 spots for SRR3207933.sra Read 453533 spots for SRR3207933.sra Written 453533 spots for SRR3207933.sra Read 453533 spots for SRR3207933.sra Written 453533 spots for SRR3207933.sra Read 453533 spots for SRR3207933.sra Written 453533 spots for SRR3207933.sra Read 453533 spots for SRR3207933.sra Written 453533 spots for SRR3207933.sra Read 453533 spots for SRR3207933.sra Written 453533 spots for SRR3207933.sra Read 453533 spots for SRR3207933.sra Written 453533 spots for SRR3207933.sra Read 453533 spots for SRR3207933.sra Written 453533 spots for SRR3207933.sra Read 453533 spots for SRR3207933.sra Written 453533 spots for SRR3207933.sra Read 453533 spots for SRR3207933.sra Written 453533 spots for SRR3207933.sra Read 453533 spots for SRR3207933.sra Written 453533 spots for SRR3207933.sra Read 453533 spots for SRR3207933.sra Written 453533 spots for SRR3207933.sra Read 453533 spots for SRR3207933.sra Written 453533 spots for SRR3207933.sra Read 453533 spots for SRR3207933.sra Written 453533 spots for SRR3207933.sra Read 453533 spots for SRR3207933.sra Written 453533 spots for SRR3207933.sra Read 453533 spots for SRR3207933.sra Written 453533 spots for SRR3207933.sra Read 453533 spots for SRR3207933.sra Written 453533 spots for SRR3207933.sra Read 453550 spots for SRR3207933.sra Written 453550 spots for SRR3207933.sra Read 453533 spots for SRR3207933.sra Written 453533 spots for SRR3207933.sra SRR ids: ['SRR3207933.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vip5_1dc SRR3207933.sra spots: 9070677 blocks: [[1, 453533], [453534, 907066], [907067, 1360599], [1360600, 1814132], [1814133, 2267665], [2267666, 2721198], [2721199, 3174731], [3174732, 3628264], [3628265, 4081797], [4081798, 4535330], [4535331, 4988863], [4988864, 5442396], [5442397, 5895929], [5895930, 6349462], [6349463, 6802995], [6802996, 7256528], [7256529, 7710061], [7710062, 8163594], [8163595, 8617127], [8617128, 9070677]] SRR3207933 file size 2350644 SRR3207933 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207933 SRR3207933_1.fastq Input file: SRR3207933_1.fastq trimmed: SRR3207933-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 16:59:48 2025 >> started Tue Feb 11 16:59:52 2025 >> done (4.337s) 9070677 reads processed; of these: 1270 ( 0.01%) short reads filtered out after trimming by size control 223736 ( 2.47%) empty reads filtered out after trimming by size control 8845671 (97.52%) reads available; of these: 392757 ( 4.44%) trimmed reads available after processing 8452914 (95.56%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 236 0.00% 19 545 0.01% 20 3142 0.04% 21 472 0.01% 22 464 0.01% 23 700 0.01% 24 932 0.01% 25 1077 0.01% 26 1416 0.02% 27 1277 0.01% 28 1429 0.02% 29 1507 0.02% 30 1478 0.02% 31 1649 0.02% 32 2183 0.02% 33 1606 0.02% 34 1437 0.02% 35 1512 0.02% 36 1551 0.02% 37 1623 0.02% 38 1680 0.02% 39 1812 0.02% 40 1801 0.02% 41 1892 0.02% 42 1827 0.02% 43 1920 0.02% 44 2056 0.02% 45 2015 0.02% 46 2057 0.02% 47 2224 0.03% 48 2474 0.03% 49 2455 0.03% 50 2436 0.03% 51 2530 0.03% 52 2660 0.03% 53 2632 0.03% 54 2910 0.03% 55 2907 0.03% 56 3026 0.03% 57 3287 0.04% 58 3557 0.04% 59 3642 0.04% 60 3591 0.04% 61 3744 0.04% 62 3900 0.04% 63 3778 0.04% 64 4043 0.05% 65 4814 0.05% 66 4351 0.05% 67 4528 0.05% 68 4859 0.05% 69 3553 0.04% 70 4078 0.05% 71 5023 0.06% 72 4691 0.05% 73 4105 0.05% 74 4308 0.05% 75 4181 0.05% 76 2942 0.03% 77 3414 0.04% 78 3737 0.04% 79 3878 0.04% 80 4429 0.05% 81 4658 0.05% 82 4841 0.05% 83 5292 0.06% 84 5666 0.06% 85 5945 0.07% 86 6374 0.07% 87 6867 0.08% 88 7242 0.08% 89 7935 0.09% 90 8857 0.10% 91 9855 0.11% 92 11097 0.13% 93 12425 0.14% 94 14594 0.16% 95 17341 0.20% 96 20191 0.23% 97 23692 0.27% 98 26346 0.30% 99 27556 0.31% 100 8452914 95.56% 8845671 reads passed initial QC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=61.34 fanout-score-rank=3 prefix-density=0.84 prefix-fanout=44.6 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTATGCCGTCTTCTGCTTGAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=13 fanout-score=264.61 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=27.6 sequence=TTCTTCTTCTTTT Started job on | Feb 11 17:00:11 Started mapping on | Feb 11 17:00:11 Finished on | Feb 11 17:00:28 Mapping speed, Million of reads per hour | 1873.20 Number of input reads | 8845671 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 8007802 Uniquely mapped reads % | 90.53% Average mapped length | 98.93 Number of splices: Total | 2448522 Number of splices: Annotated (sjdb) | 2405317 Number of splices: GT/AG | 2412473 Number of splices: GC/AG | 30056 Number of splices: AT/AC | 2353 Number of splices: Non-canonical | 3640 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 1.97 Insertion rate per base | 0.01% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 182042 % of reads mapped to multiple loci | 2.06% Number of reads mapped to too many loci | 38164 % of reads mapped to too many loci | 0.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.96% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 655827 655827 655827 N_multimapping 182042 182042 182042 N_noFeature 324386 4091277 4183197 N_ambiguous 84659 13515 13537 UnstrandedReadsAssigned:7598757 PositiveStrandReadsAssigned:3903010 NegativeStrandReadsAssigned:3811068 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207933 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207933-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,845,671 reads, 7,785,588 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,199 rounds 52401 SRR3207933.ke.tsv 34699 SRR3207933.se.tsv 87100 total ==> SRR3207933.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 224 22.5555 Potri.005G024800.1.v4.1 1035 936 36 7.43202 Potri.004G059700.1.v4.1 961 862 5 1.12084 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 144.321 9.80571 Potri.016G087400.1.v4.1 270 171 252 284.764 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 35 4.04011 Potri.012G127500.1.v4.1 977 878 826 181.788 ==> SRR3207933.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 622 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 89 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR3207933 completed mapping pipeline successfully