Starting /dee2/code/volunteer_pipeline.sh SRR3207935 current disk space = 3053451452416 free memory = 1501929748 SRR3207935 SRAfilesize 1f2155b945cca9d35af805f4a615d5d4 SRR3207935.sra SRR3207935.sra file validated SRR3207935 is single end SRR3207935 is conventional basespace SRR3207935 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207935_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.173 34.0 33.0 34.0 31.0 34.0 2 33.289 34.0 34.0 34.0 31.0 34.0 3 33.3175 34.0 34.0 34.0 31.0 34.0 4 36.58025 37.0 37.0 37.0 35.0 37.0 5 36.53175 37.0 37.0 37.0 35.0 37.0 6 36.50725 37.0 37.0 37.0 35.0 37.0 7 36.4735 37.0 37.0 37.0 35.0 37.0 8 36.45975 37.0 37.0 37.0 35.0 37.0 9 38.35375 39.0 39.0 39.0 37.0 39.0 10-11 38.320625 39.0 39.0 39.0 37.0 39.0 12-13 38.00925 39.0 39.0 39.0 36.0 39.0 14-15 39.953375 41.0 40.0 41.0 38.0 41.0 16-17 39.943625 41.0 40.0 41.0 38.0 41.0 18-19 39.831625 41.0 40.0 41.0 38.0 41.0 20-21 39.9255 41.0 40.0 41.0 38.0 41.0 22-23 39.914125 41.0 40.0 41.0 38.0 41.0 24-25 39.87575 41.0 40.0 41.0 38.0 41.0 26-27 39.854375000000005 41.0 40.0 41.0 38.0 41.0 28-29 39.723 41.0 40.0 41.0 38.0 41.0 30-31 39.59325 41.0 40.0 41.0 37.0 41.0 32-33 39.533375 41.0 40.0 41.0 37.0 41.0 34-35 39.532250000000005 41.0 40.0 41.0 37.0 41.0 36-37 39.471500000000006 41.0 40.0 41.0 37.0 41.0 38-39 39.363125 41.0 39.5 41.0 36.5 41.0 40-41 39.19775 41.0 39.0 41.0 36.0 41.0 42-43 39.206375 41.0 39.0 41.0 36.0 41.0 44-45 38.9775 40.5 39.0 41.0 35.5 41.0 46-47 39.120875 41.0 39.0 41.0 35.5 41.0 48-49 39.159499999999994 41.0 39.0 41.0 36.0 41.0 50-51 39.319500000000005 41.0 39.0 41.0 36.0 41.0 52-53 39.3 41.0 39.0 41.0 36.0 41.0 54-55 39.047124999999994 41.0 39.0 41.0 35.5 41.0 56-57 38.996625 41.0 39.0 41.0 35.0 41.0 58-59 38.716875 40.5 38.5 41.0 35.0 41.0 60-61 38.682249999999996 40.0 38.0 41.0 35.0 41.0 62-63 38.31375 40.0 37.5 41.0 34.5 41.0 64-65 38.146125 39.5 37.0 41.0 34.5 41.0 66-67 37.838750000000005 39.0 36.5 41.0 34.0 41.0 68-69 37.466 39.0 36.0 41.0 34.0 41.0 70-71 37.028625000000005 38.0 35.5 40.0 34.0 41.0 72-73 36.49425 37.0 35.0 39.0 33.5 41.0 74-75 36.092875 37.0 35.0 39.0 33.0 41.0 76-77 35.130250000000004 36.0 34.5 37.5 31.5 39.0 78-79 35.138374999999996 36.0 35.0 37.0 32.5 39.0 80-81 34.885 35.0 35.0 37.0 32.5 39.0 82-83 34.5895 35.0 35.0 36.5 33.0 37.0 84-85 34.441500000000005 35.0 35.0 36.0 33.0 37.0 86-87 34.224875 35.0 35.0 36.0 32.5 37.0 88-89 33.966875 35.0 35.0 35.5 32.0 36.0 90-91 33.7435 35.0 34.5 35.0 32.0 36.0 92-93 33.490625 35.0 34.0 35.0 31.5 36.0 94-95 33.544125 35.0 34.0 35.0 32.0 36.0 96-97 33.482 35.0 34.0 35.0 32.0 36.0 98-99 33.351124999999996 35.0 34.0 35.0 31.5 35.0 100 33.2455 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 2.0 10 0.0 11 2.0 12 0.0 13 3.0 14 1.0 15 1.0 16 4.0 17 3.0 18 3.0 19 1.0 20 8.0 21 6.0 22 3.0 23 5.0 24 7.0 25 6.0 26 14.0 27 15.0 28 16.0 29 34.0 30 32.0 31 34.0 32 47.0 33 62.0 34 92.0 35 143.0 36 254.0 37 723.0 38 1819.0 39 659.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.0 16.35 11.55 48.1 2 18.475 22.55 40.25 18.725 3 21.125 24.45 26.8 27.625 4 23.425 32.525 21.099999999999998 22.95 5 24.781195298824706 36.23405851462866 22.155538884721178 16.829207301825456 6 18.525 39.275 25.025 17.175 7 17.175 20.849999999999998 41.975 20.0 8 17.075000000000003 24.9 32.225 25.8 9 19.85 23.35 33.6 23.200000000000003 10-11 22.05 34.0125 23.625 20.3125 12-13 21.3875 26.775 29.9 21.9375 14-15 21.587500000000002 28.599999999999998 28.3875 21.425 16-17 21.3 28.9125 27.675 22.112499999999997 18-19 21.45 28.037499999999998 28.050000000000004 22.4625 20-21 21.637500000000003 29.4125 27.275 21.675 22-23 21.175 29.225 28.3375 21.2625 24-25 21.630407601900476 28.49462365591398 27.45686421605401 22.418104526131533 26-27 21.2875 28.762500000000003 29.2375 20.7125 28-29 21.78973717146433 28.498122653316642 28.1351689612015 21.576971214017522 30-31 21.13892365456821 29.511889862327912 27.396745932415516 21.952440550688358 32-33 21.625 29.125 27.825 21.425 34-35 21.4375 27.737499999999997 28.749999999999996 22.075 36-37 20.724999999999998 29.525000000000002 27.6625 22.0875 38-39 21.637500000000003 28.749999999999996 28.549999999999997 21.0625 40-41 21.8125 27.875 28.65 21.6625 42-43 21.175 27.987499999999997 28.9 21.9375 44-45 22.037499999999998 28.749999999999996 27.462500000000002 21.75 46-47 21.5 28.1375 28.512500000000003 21.85 48-49 21.6125 28.1375 28.449999999999996 21.8 50-51 21.8125 28.775000000000002 28.025 21.3875 52-53 20.9875 29.299999999999997 28.525 21.1875 54-55 21.475 28.812500000000004 28.575 21.1375 56-57 21.637500000000003 28.6875 28.712500000000002 20.962500000000002 58-59 21.825 28.625 28.050000000000004 21.5 60-61 21.375 27.975 29.099999999999998 21.55 62-63 21.575 28.9 28.1125 21.4125 64-65 21.075 29.45 28.487499999999997 20.9875 66-67 21.6 28.925 28.5625 20.9125 68-69 21.712500000000002 29.15 28.212500000000002 20.925 70-71 22.037499999999998 28.025 28.175 21.762500000000003 72-73 21.45 28.8625 27.737499999999997 21.95 74-75 21.5375 28.7 28.075 21.6875 76-77 21.337500000000002 28.675 28.475 21.512500000000003 78-79 21.95 28.050000000000004 28.675 21.325 80-81 22.2125 28.050000000000004 28.449999999999996 21.2875 82-83 21.8625 28.4375 28.262500000000003 21.4375 84-85 21.275 28.325 28.375 22.025 86-87 21.3 27.775 29.6875 21.2375 88-89 21.762500000000003 27.825 28.999999999999996 21.4125 90-91 21.375 28.625 29.225 20.775 92-93 21.8 28.749999999999996 27.6875 21.762500000000003 94-95 22.0625 28.037499999999998 28.349999999999998 21.55 96-97 22.075 28.1 28.6125 21.212500000000002 98-99 22.525000000000002 29.15 26.974999999999998 21.349999999999998 100 22.95 28.299999999999997 27.650000000000002 21.099999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 1.0 25 2.5 26 3.0 27 5.0 28 7.5 29 10.5 30 23.0 31 30.0 32 36.0 33 49.5 34 69.5 35 91.5 36 109.0 37 133.5 38 164.5 39 186.5 40 208.0 41 241.0 42 265.5 43 283.0 44 298.5 45 291.5 46 249.5 47 221.5 48 206.5 49 169.0 50 137.5 51 119.0 52 100.5 53 82.0 54 63.0 55 40.0 56 25.0 57 17.0 58 14.5 59 12.0 60 7.0 61 6.5 62 5.0 63 3.5 64 2.0 65 1.5 66 1.0 67 1.0 68 1.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.025 26-27 0.0 28-29 0.125 30-31 0.125 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84973703981969 99.675 2 0.12521913348359628 0.25 3 0.025043826696719257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88 0.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1174139 spots for SRR3207935.sra Written 1174139 spots for SRR3207935.sra Read 1174139 spots for SRR3207935.sra Written 1174139 spots for SRR3207935.sra Read 1174139 spots for SRR3207935.sra Written 1174139 spots for SRR3207935.sra Read 1174139 spots for SRR3207935.sra Written 1174139 spots for SRR3207935.sra Read 1174139 spots for SRR3207935.sra Written 1174139 spots for SRR3207935.sra Read 1174139 spots for SRR3207935.sra Written 1174139 spots for SRR3207935.sra Read 1174139 spots for SRR3207935.sra Written 1174139 spots for SRR3207935.sra Read 1174139 spots for SRR3207935.sra Written 1174139 spots for SRR3207935.sra Read 1174139 spots for SRR3207935.sra Written 1174139 spots for SRR3207935.sra Read 1174139 spots for SRR3207935.sra Written 1174139 spots for SRR3207935.sra Read 1174139 spots for SRR3207935.sra Written 1174139 spots for SRR3207935.sra Read 1174139 spots for SRR3207935.sra Written 1174139 spots for SRR3207935.sra Read 1174139 spots for SRR3207935.sra Written 1174139 spots for SRR3207935.sra Read 1174139 spots for SRR3207935.sra Written 1174139 spots for SRR3207935.sra Read 1174139 spots for SRR3207935.sra Written 1174139 spots for SRR3207935.sra Read 1174139 spots for SRR3207935.sra Written 1174139 spots for SRR3207935.sra Read 1174139 spots for SRR3207935.sra Written 1174139 spots for SRR3207935.sra Read 1174147 spots for SRR3207935.sra Written 1174147 spots for SRR3207935.sra Read 1174139 spots for SRR3207935.sra Written 1174139 spots for SRR3207935.sra Read 1174139 spots for SRR3207935.sra Written 1174139 spots for SRR3207935.sra SRR ids: ['SRR3207935.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m04rrjf9 SRR3207935.sra spots: 23482788 blocks: [[1, 1174139], [1174140, 2348278], [2348279, 3522417], [3522418, 4696556], [4696557, 5870695], [5870696, 7044834], [7044835, 8218973], [8218974, 9393112], [9393113, 10567251], [10567252, 11741390], [11741391, 12915529], [12915530, 14089668], [14089669, 15263807], [15263808, 16437946], [16437947, 17612085], [17612086, 18786224], [18786225, 19960363], [19960364, 21134502], [21134503, 22308641], [22308642, 23482788]] SRR3207935 file size 6100412 SRR3207935 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207935 SRR3207935_1.fastq Input file: SRR3207935_1.fastq trimmed: SRR3207935-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 18:01:43 2025 >> started Tue Feb 11 18:01:56 2025 >> done (12.498s) 23482788 reads processed; of these: 1749 ( 0.01%) short reads filtered out after trimming by size control 33172 ( 0.14%) empty reads filtered out after trimming by size control 23447867 (99.85%) reads available; of these: 872363 ( 3.72%) trimmed reads available after processing 22575504 (96.28%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 285 0.00% 19 360 0.00% 20 516 0.00% 21 663 0.00% 22 994 0.00% 23 1377 0.01% 24 1832 0.01% 25 2282 0.01% 26 2450 0.01% 27 2516 0.01% 28 2502 0.01% 29 2551 0.01% 30 2672 0.01% 31 2712 0.01% 32 2798 0.01% 33 2887 0.01% 34 3077 0.01% 35 3160 0.01% 36 3109 0.01% 37 3298 0.01% 38 3369 0.01% 39 3484 0.01% 40 3587 0.02% 41 3798 0.02% 42 3858 0.02% 43 4126 0.02% 44 4072 0.02% 45 4214 0.02% 46 4431 0.02% 47 4441 0.02% 48 4510 0.02% 49 4828 0.02% 50 4760 0.02% 51 5066 0.02% 52 5163 0.02% 53 5544 0.02% 54 5457 0.02% 55 5757 0.02% 56 6022 0.03% 57 6214 0.03% 58 6409 0.03% 59 6500 0.03% 60 6580 0.03% 61 6649 0.03% 62 7146 0.03% 63 7368 0.03% 64 7161 0.03% 65 7446 0.03% 66 7719 0.03% 67 8002 0.03% 68 8468 0.04% 69 8267 0.04% 70 8613 0.04% 71 8925 0.04% 72 9046 0.04% 73 9631 0.04% 74 10066 0.04% 75 9998 0.04% 76 7202 0.03% 77 8194 0.03% 78 9016 0.04% 79 9660 0.04% 80 10601 0.05% 81 10915 0.05% 82 11778 0.05% 83 13017 0.06% 84 13799 0.06% 85 14332 0.06% 86 15107 0.06% 87 16394 0.07% 88 17866 0.08% 89 19172 0.08% 90 21367 0.09% 91 23694 0.10% 92 26653 0.11% 93 30075 0.13% 94 35231 0.15% 95 41446 0.18% 96 48728 0.21% 97 57552 0.25% 98 64446 0.27% 99 67382 0.29% 100 22575504 96.28% 23447867 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=13.30 fanout-score-rank=19 prefix-density=0.10 prefix-fanout=13.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=20 fanout-score=355.09 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=30.2 sequence=TTCTTCTTCTTC Started job on | Feb 11 18:02:11 Started mapping on | Feb 11 18:02:12 Finished on | Feb 11 18:02:38 Mapping speed, Million of reads per hour | 3246.63 Number of input reads | 23447867 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 22508606 Uniquely mapped reads % | 95.99% Average mapped length | 98.96 Number of splices: Total | 6501744 Number of splices: Annotated (sjdb) | 6375702 Number of splices: GT/AG | 6401975 Number of splices: GC/AG | 81201 Number of splices: AT/AC | 6676 Number of splices: Non-canonical | 11892 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.02% Deletion average length | 2.03 Insertion rate per base | 0.02% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 481395 % of reads mapped to multiple loci | 2.05% Number of reads mapped to too many loci | 145407 % of reads mapped to too many loci | 0.62% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.33% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 457866 457866 457866 N_multimapping 481395 481395 481395 N_noFeature 1112805 11760478 11700833 N_ambiguous 239893 39653 40521 UnstrandedReadsAssigned:21155908 PositiveStrandReadsAssigned:10708475 NegativeStrandReadsAssigned:10767252 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207935 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207935-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,447,867 reads, 21,700,318 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,107 rounds 52401 SRR3207935.ke.tsv 34699 SRR3207935.se.tsv 87100 total ==> SRR3207935.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 715 26.2856 Potri.005G024800.1.v4.1 1035 936 98 7.38647 Potri.004G059700.1.v4.1 961 862 20 1.63685 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 307.505 7.62797 Potri.016G087400.1.v4.1 270 171 777.555 320.791 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 95 4.00364 Potri.012G127500.1.v4.1 977 878 3237 260.097 ==> SRR3207935.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2663 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 351 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 43 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR3207935 completed mapping pipeline successfully