Starting /dee2/code/volunteer_pipeline.sh SRR3207936 current disk space = 3049093083136 free memory = 1195456652 SRR3207936 SRAfilesize b91ff2c7af300886c3c2a2821d2aeddc SRR3207936.sra SRR3207936.sra file validated SRR3207936 is single end SRR3207936 is conventional basespace SRR3207936 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207936_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.08125 34.0 33.0 34.0 31.0 34.0 2 33.23125 34.0 34.0 34.0 31.0 34.0 3 33.28425 34.0 34.0 34.0 31.0 34.0 4 36.51925 37.0 37.0 37.0 35.0 37.0 5 36.48025 37.0 37.0 37.0 35.0 37.0 6 36.43025 37.0 37.0 37.0 35.0 37.0 7 36.405 37.0 37.0 37.0 35.0 37.0 8 36.41125 37.0 37.0 37.0 35.0 37.0 9 38.31625 39.0 39.0 39.0 37.0 39.0 10-11 38.200874999999996 39.0 39.0 39.0 37.0 39.0 12-13 37.84975 39.0 38.5 39.0 36.0 39.0 14-15 39.823125000000005 41.0 40.0 41.0 38.0 41.0 16-17 39.855000000000004 41.0 40.0 41.0 38.0 41.0 18-19 39.696625 41.0 40.0 41.0 37.5 41.0 20-21 39.8185 41.0 40.0 41.0 37.5 41.0 22-23 39.83825 41.0 40.0 41.0 38.0 41.0 24-25 39.751374999999996 41.0 40.0 41.0 37.5 41.0 26-27 39.709875 41.0 40.0 41.0 37.0 41.0 28-29 39.6295 41.0 40.0 41.0 37.0 41.0 30-31 39.488375000000005 41.0 40.0 41.0 37.0 41.0 32-33 39.3665 41.0 40.0 41.0 36.5 41.0 34-35 39.34 41.0 40.0 41.0 36.5 41.0 36-37 39.308375 41.0 39.5 41.0 36.5 41.0 38-39 39.192875 41.0 39.0 41.0 36.0 41.0 40-41 39.086124999999996 40.5 39.0 41.0 35.5 41.0 42-43 39.064750000000004 40.5 39.0 41.0 35.5 41.0 44-45 38.879625 41.0 39.0 41.0 35.0 41.0 46-47 38.962875 41.0 39.0 41.0 35.0 41.0 48-49 38.970375000000004 41.0 39.0 41.0 35.0 41.0 50-51 39.192375 41.0 39.0 41.0 36.0 41.0 52-53 39.172 41.0 39.0 41.0 35.5 41.0 54-55 38.828875 41.0 39.0 41.0 35.0 41.0 56-57 38.878875 41.0 39.0 41.0 35.0 41.0 58-59 38.59125 40.0 38.0 41.0 35.0 41.0 60-61 38.5155 40.0 37.5 41.0 35.0 41.0 62-63 38.104625 40.0 37.0 41.0 34.0 41.0 64-65 37.771125 39.0 36.5 41.0 34.0 41.0 66-67 37.57275 39.0 36.0 41.0 34.0 41.0 68-69 37.1215 39.0 35.5 40.5 33.5 41.0 70-71 36.367875 37.5 35.0 40.0 33.0 41.0 72-73 35.81175 37.0 35.0 39.0 32.0 41.0 74-75 35.463499999999996 36.5 35.0 39.0 32.0 40.5 76-77 34.556875000000005 36.0 34.5 37.0 30.5 39.0 78-79 34.565124999999995 35.5 35.0 37.0 31.5 39.0 80-81 34.31675 35.0 35.0 37.0 32.0 39.0 82-83 34.056749999999994 35.0 35.0 36.0 32.0 37.0 84-85 33.804125 35.0 35.0 36.0 31.5 37.0 86-87 33.581 35.0 35.0 36.0 31.0 36.5 88-89 33.350625 35.0 35.0 35.0 31.5 36.0 90-91 33.104875 35.0 34.0 35.0 30.5 36.0 92-93 32.86025 35.0 34.0 35.0 30.0 36.0 94-95 32.888 35.0 34.0 35.0 30.5 36.0 96-97 32.862750000000005 35.0 34.0 35.0 30.5 35.5 98-99 32.723124999999996 35.0 34.0 35.0 30.0 35.0 100 32.666 35.0 34.0 35.0 30.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 2.0 9 1.0 10 3.0 11 2.0 12 1.0 13 4.0 14 2.0 15 2.0 16 2.0 17 2.0 18 1.0 19 4.0 20 3.0 21 6.0 22 5.0 23 6.0 24 10.0 25 18.0 26 30.0 27 41.0 28 26.0 29 27.0 30 37.0 31 50.0 32 49.0 33 72.0 34 88.0 35 150.0 36 267.0 37 708.0 38 1778.0 39 601.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.05 15.35 17.7 40.9 2 18.7 25.85 36.7 18.75 3 21.65 26.8 28.775000000000002 22.775000000000002 4 23.1 32.85 21.175 22.875 5 24.537268634317158 35.89294647323662 21.68584292146073 17.883941970985493 6 19.75 37.775 22.325 20.150000000000002 7 16.425 19.3 44.025 20.25 8 20.0 24.0 28.7 27.3 9 21.349999999999998 24.175 30.175 24.3 10-11 22.6875 33.300000000000004 22.85 21.1625 12-13 20.5375 26.85 29.549999999999997 23.0625 14-15 20.9 28.7 27.625 22.775000000000002 16-17 21.8875 28.549999999999997 27.3125 22.25 18-19 21.4125 28.1 28.462500000000002 22.025 20-21 20.474999999999998 27.712500000000002 28.9375 22.875 22-23 21.925 29.275000000000002 27.6875 21.1125 24-25 21.0 28.199999999999996 28.125 22.675 26-27 20.6125 27.987499999999997 27.712500000000002 23.6875 28-29 20.913070669168228 29.255784865540964 27.479674796747965 22.35146966854284 30-31 21.350844277673545 28.580362726704188 28.730456535334586 21.338336460287678 32-33 21.4125 28.462500000000002 27.5625 22.5625 34-35 21.875 26.937499999999996 27.450000000000003 23.7375 36-37 20.200000000000003 28.0875 27.9375 23.775 38-39 21.1125 28.825 28.537499999999998 21.525 40-41 21.762500000000003 28.575 27.8375 21.825 42-43 20.6125 27.750000000000004 29.275000000000002 22.3625 44-45 21.95 28.012500000000003 27.1125 22.925 46-47 22.537499999999998 29.7 27.3 20.4625 48-49 22.475 27.487499999999997 28.499999999999996 21.5375 50-51 21.475 27.725 27.5875 23.2125 52-53 22.875 27.237499999999997 27.8125 22.075 54-55 20.8125 28.037499999999998 28.487499999999997 22.662499999999998 56-57 22.15 27.3 28.6375 21.912499999999998 58-59 22.2625 27.900000000000002 27.875 21.9625 60-61 21.637500000000003 28.3875 27.200000000000003 22.775000000000002 62-63 22.662499999999998 27.500000000000004 29.1625 20.674999999999997 64-65 21.95 29.1375 28.325 20.5875 66-67 20.65 29.7875 27.712500000000002 21.85 68-69 21.75 29.525000000000002 27.1125 21.6125 70-71 21.15 29.45 27.675 21.725 72-73 20.525 29.8375 27.762500000000003 21.875 74-75 20.9 29.45 28.787499999999998 20.8625 76-77 22.575 27.825 28.475 21.125 78-79 22.1 28.237499999999997 27.825 21.837500000000002 80-81 21.975 28.499999999999996 28.075 21.45 82-83 21.4875 28.425 28.1125 21.975 84-85 22.237499999999997 27.9125 28.175 21.675 86-87 22.075 28.15 28.199999999999996 21.575 88-89 22.237499999999997 28.9375 27.0875 21.7375 90-91 21.9 29.2 27.987499999999997 20.9125 92-93 22.2625 28.287499999999998 27.8125 21.637500000000003 94-95 22.675 27.5875 28.0875 21.65 96-97 21.8625 28.575 27.187499999999996 22.375 98-99 22.475 28.3875 27.775 21.3625 100 23.474999999999998 26.924999999999997 28.1 21.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.5 22 0.5 23 2.0 24 4.5 25 4.0 26 4.0 27 6.0 28 11.0 29 14.5 30 18.0 31 23.0 32 27.5 33 41.0 34 58.5 35 79.5 36 103.0 37 123.5 38 163.0 39 190.0 40 189.5 41 212.0 42 240.5 43 252.0 44 273.0 45 276.5 46 250.0 47 242.0 48 237.5 49 198.5 50 155.0 51 135.5 52 116.0 53 90.0 54 66.0 55 45.5 56 35.0 57 22.5 58 16.5 59 17.0 60 12.0 61 7.5 62 5.5 63 4.5 64 4.5 65 5.5 66 3.0 67 2.0 68 1.0 69 0.5 70 0.5 71 1.5 72 1.5 73 0.5 74 0.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0625 30-31 0.0625 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59225280326199 97.7 2 0.3567787971457696 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05096839959225281 1.6 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGC 44 1.0999999999999999 TruSeq Adapter, Index 6 (100% over 50bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATG 20 0.5 TruSeq Adapter, Index 6 (100% over 49bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.6 0.0 0.0 0.0 0.0 2 0.6 0.0 0.0 0.0 0.0 3 0.6 0.0 0.0 0.0 0.0 4 0.6 0.0 0.0 0.0 0.0 5 0.6 0.0 0.0 0.0 0.0 6 0.6 0.0 0.0 0.0 0.0 7 0.6 0.0 0.0 0.0 0.0 8 0.6 0.0 0.0 0.0 0.0 9 0.6 0.0 0.0 0.0 0.0 10-11 0.6 0.0 0.0 0.0 0.0 12-13 0.6 0.0 0.0 0.0 0.0 14-15 0.6 0.0 0.0 0.0 0.0 16-17 0.6 0.0 0.0 0.0 0.0 18-19 0.6 0.0 0.0 0.0 0.0 20-21 0.6 0.0 0.0 0.0 0.0 22-23 0.6 0.0 0.0 0.0 0.0 24-25 0.6 0.0 0.0 0.0 0.0 26-27 0.6 0.0 0.0 0.0 0.0 28-29 0.6 0.0 0.0 0.0 0.0 30-31 0.6 0.0 0.0 0.0 0.0 32-33 0.6 0.0 0.0 0.0 0.0 34-35 0.6 0.0 0.0 0.0 0.0 36-37 0.6 0.0 0.0 0.0 0.0 38-39 0.6 0.0 0.0 0.0 0.0 40-41 0.6 0.0 0.0 0.0 0.0 42-43 0.6 0.0 0.0 0.0 0.0 44-45 0.6 0.0 0.0 0.0 0.0 46-47 0.6 0.0 0.0 0.0 0.0 48-49 0.6 0.0 0.0 0.0 0.0 50-51 0.6 0.0 0.0 0.0 0.0 52-53 0.6 0.0 0.0 0.0 0.0 54-55 0.6 0.0 0.0 0.0 0.0 56-57 0.6 0.0 0.0 0.0 0.0 58-59 0.625 0.0 0.0 0.0 0.0 60-61 0.625 0.0 0.0 0.0 0.0 62-63 0.625 0.0 0.0 0.0 0.0 64-65 0.625 0.0 0.0 0.0 0.0 66-67 0.625 0.0 0.0 0.0 0.0 68-69 0.625 0.0 0.0 0.0 0.0 70-71 0.65 0.0 0.0 0.0 0.0 72-73 0.65 0.0 0.0 0.0 0.0 74-75 0.675 0.0 0.0 0.0 0.0 76-77 0.675 0.0 0.0 0.0 0.0 78-79 0.675 0.0 0.0 0.0 0.0 80-81 0.7 0.0 0.0 0.0 0.0 82-83 0.7 0.0 0.0 0.0 0.0 84-85 0.725 0.0 0.0 0.0 0.0 86-87 0.75 0.0 0.0 0.0 0.0 88 0.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGAGC 20 0.0020083564 70.5 6 >>END_MODULE Read 803076 spots for SRR3207936.sra Written 803076 spots for SRR3207936.sra Read 803076 spots for SRR3207936.sra Written 803076 spots for SRR3207936.sra Read 803076 spots for SRR3207936.sra Written 803076 spots for SRR3207936.sra Read 803076 spots for SRR3207936.sra Written 803076 spots for SRR3207936.sra Read 803076 spots for SRR3207936.sra Written 803076 spots for SRR3207936.sra Read 803076 spots for SRR3207936.sra Written 803076 spots for SRR3207936.sra Read 803076 spots for SRR3207936.sra Written 803076 spots for SRR3207936.sra Read 803076 spots for SRR3207936.sra Written 803076 spots for SRR3207936.sra Read 803076 spots for SRR3207936.sra Written 803076 spots for SRR3207936.sra Read 803076 spots for SRR3207936.sra Written 803076 spots for SRR3207936.sra Read 803076 spots for SRR3207936.sra Written 803076 spots for SRR3207936.sra Read 803076 spots for SRR3207936.sra Written 803076 spots for SRR3207936.sra Read 803076 spots for SRR3207936.sra Written 803076 spots for SRR3207936.sra Read 803076 spots for SRR3207936.sra Written 803076 spots for SRR3207936.sra Read 803076 spots for SRR3207936.sra Written 803076 spots for SRR3207936.sra Read 803076 spots for SRR3207936.sra Written 803076 spots for SRR3207936.sra Read 803093 spots for SRR3207936.sra Written 803093 spots for SRR3207936.sra Read 803076 spots for SRR3207936.sra Written 803076 spots for SRR3207936.sra Read 803076 spots for SRR3207936.sra Written 803076 spots for SRR3207936.sra Read 803076 spots for SRR3207936.sra Written 803076 spots for SRR3207936.sra SRR ids: ['SRR3207936.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dtqk9llu SRR3207936.sra spots: 16061537 blocks: [[1, 803076], [803077, 1606152], [1606153, 2409228], [2409229, 3212304], [3212305, 4015380], [4015381, 4818456], [4818457, 5621532], [5621533, 6424608], [6424609, 7227684], [7227685, 8030760], [8030761, 8833836], [8833837, 9636912], [9636913, 10439988], [10439989, 11243064], [11243065, 12046140], [12046141, 12849216], [12849217, 13652292], [13652293, 14455368], [14455369, 15258444], [15258445, 16061537]] SRR3207936 file size 4169064 SRR3207936 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207936 SRR3207936_1.fastq Input file: SRR3207936_1.fastq trimmed: SRR3207936-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 17:25:47 2025 >> started Tue Feb 11 17:25:59 2025 >> done (12.257s) 16061537 reads processed; of these: 2029 ( 0.01%) short reads filtered out after trimming by size control 310127 ( 1.93%) empty reads filtered out after trimming by size control 15749381 (98.06%) reads available; of these: 641858 ( 4.08%) trimmed reads available after processing 15107523 (95.92%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 357 0.00% 19 388 0.00% 20 447 0.00% 21 610 0.00% 22 817 0.01% 23 1055 0.01% 24 1422 0.01% 25 1757 0.01% 26 1857 0.01% 27 1854 0.01% 28 1866 0.01% 29 1889 0.01% 30 1970 0.01% 31 1998 0.01% 32 2134 0.01% 33 2105 0.01% 34 2221 0.01% 35 2318 0.01% 36 2443 0.02% 37 2496 0.02% 38 2502 0.02% 39 2606 0.02% 40 2649 0.02% 41 2793 0.02% 42 2955 0.02% 43 3138 0.02% 44 3112 0.02% 45 3183 0.02% 46 3398 0.02% 47 3351 0.02% 48 3452 0.02% 49 3647 0.02% 50 3574 0.02% 51 3851 0.02% 52 4008 0.03% 53 4032 0.03% 54 4143 0.03% 55 4452 0.03% 56 4569 0.03% 57 4767 0.03% 58 4861 0.03% 59 4945 0.03% 60 5081 0.03% 61 4993 0.03% 62 5359 0.03% 63 5527 0.04% 64 5421 0.03% 65 5677 0.04% 66 5976 0.04% 67 6417 0.04% 68 7542 0.05% 69 9283 0.06% 70 7731 0.05% 71 7046 0.04% 72 6868 0.04% 73 7112 0.05% 74 7432 0.05% 75 7394 0.05% 76 5190 0.03% 77 5863 0.04% 78 6379 0.04% 79 7022 0.04% 80 7481 0.05% 81 8169 0.05% 82 8549 0.05% 83 9263 0.06% 84 9997 0.06% 85 10227 0.06% 86 11154 0.07% 87 11751 0.07% 88 12544 0.08% 89 13752 0.09% 90 15249 0.10% 91 16734 0.11% 92 18877 0.12% 93 21628 0.14% 94 25457 0.16% 95 29901 0.19% 96 35009 0.22% 97 41012 0.26% 98 45773 0.29% 99 48026 0.30% 100 15107523 95.92% 15749381 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=25.07 fanout-score-rank=6 prefix-density=0.20 prefix-fanout=23.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTGAAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=17 fanout-score=186.96 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=23.3 sequence=AAGAAGAAGAAA Started job on | Feb 11 17:26:15 Started mapping on | Feb 11 17:26:15 Finished on | Feb 11 17:26:37 Mapping speed, Million of reads per hour | 2577.17 Number of input reads | 15749381 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 14993425 Uniquely mapped reads % | 95.20% Average mapped length | 98.95 Number of splices: Total | 4426907 Number of splices: Annotated (sjdb) | 4346950 Number of splices: GT/AG | 4361980 Number of splices: GC/AG | 53045 Number of splices: AT/AC | 4583 Number of splices: Non-canonical | 7299 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.02% Deletion average length | 1.98 Insertion rate per base | 0.01% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 324753 % of reads mapped to multiple loci | 2.06% Number of reads mapped to too many loci | 85543 % of reads mapped to too many loci | 0.54% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.16% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 431203 431203 431203 N_multimapping 324753 324753 324753 N_noFeature 667778 7753182 7804725 N_ambiguous 155943 26341 26502 UnstrandedReadsAssigned:14169704 PositiveStrandReadsAssigned:7213902 NegativeStrandReadsAssigned:7162198 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207936 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207936-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,749,381 reads, 14,533,366 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,103 rounds 52401 SRR3207936.ke.tsv 34699 SRR3207936.se.tsv 87100 total ==> SRR3207936.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 451 24.7495 Potri.005G024800.1.v4.1 1035 936 66 7.42562 Potri.004G059700.1.v4.1 961 862 4 0.488672 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 245.582 9.09352 Potri.016G087400.1.v4.1 270 171 559 344.255 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 58 3.64869 Potri.012G127500.1.v4.1 977 878 1064 127.618 ==> SRR3207936.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2318 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 275 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 12 SRR3207936 completed mapping pipeline successfully