Starting /dee2/code/volunteer_pipeline.sh SRR3207937 current disk space = 3049706733568 free memory = 1458175780 SRR3207937 SRAfilesize 03396801724cb86bacbe5ed93e0ce10f SRR3207937.sra SRR3207937.sra file validated SRR3207937 is single end SRR3207937 is conventional basespace SRR3207937 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207937_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.05175 34.0 33.0 34.0 31.0 34.0 2 33.26 34.0 34.0 34.0 31.0 34.0 3 33.356 34.0 34.0 34.0 31.0 34.0 4 36.5675 37.0 37.0 37.0 35.0 37.0 5 36.463 37.0 37.0 37.0 35.0 37.0 6 36.4895 37.0 37.0 37.0 35.0 37.0 7 36.53125 37.0 37.0 37.0 35.0 37.0 8 36.551 37.0 37.0 37.0 35.0 37.0 9 38.313 39.0 39.0 39.0 37.0 39.0 10-11 38.327875000000006 39.0 39.0 39.0 37.0 39.0 12-13 38.367999999999995 39.0 39.0 39.0 37.0 39.0 14-15 40.046625 41.0 40.0 41.0 38.0 41.0 16-17 40.067875 41.0 40.0 41.0 38.0 41.0 18-19 40.0285 41.0 40.0 41.0 38.0 41.0 20-21 39.983625 41.0 40.0 41.0 38.0 41.0 22-23 39.643874999999994 41.0 40.0 41.0 37.5 41.0 24-25 39.8615 41.0 40.0 41.0 38.0 41.0 26-27 39.799375 41.0 40.0 41.0 38.0 41.0 28-29 39.79375 41.0 40.0 41.0 38.0 41.0 30-31 39.699 41.0 40.0 41.0 38.0 41.0 32-33 39.404250000000005 41.0 40.0 41.0 37.0 41.0 34-35 39.524875 41.0 40.0 41.0 37.0 41.0 36-37 39.498875 41.0 40.0 41.0 37.0 41.0 38-39 39.398875000000004 41.0 40.0 41.0 37.0 41.0 40-41 39.227875 41.0 39.0 41.0 36.0 41.0 42-43 39.350625 41.0 39.5 41.0 36.5 41.0 44-45 39.324 41.0 39.0 41.0 36.0 41.0 46-47 39.296625000000006 41.0 39.0 41.0 36.0 41.0 48-49 39.145250000000004 41.0 39.0 41.0 35.5 41.0 50-51 39.38275 41.0 39.0 41.0 36.5 41.0 52-53 39.42775 41.0 40.0 41.0 37.0 41.0 54-55 39.167125 41.0 39.0 41.0 35.5 41.0 56-57 38.97425 41.0 39.0 41.0 35.0 41.0 58-59 38.663375 40.5 38.5 41.0 35.0 41.0 60-61 38.621875 40.0 38.0 41.0 35.0 41.0 62-63 38.532624999999996 40.0 37.5 41.0 35.0 41.0 64-65 38.229124999999996 40.0 37.0 41.0 35.0 41.0 66-67 37.934 39.0 36.5 41.0 34.5 41.0 68-69 37.487375 39.0 36.0 41.0 34.0 41.0 70-71 37.128 38.5 35.5 40.0 34.0 41.0 72-73 36.718625 37.0 35.0 39.0 34.0 41.0 74-75 36.235749999999996 37.0 35.0 39.0 33.5 41.0 76-77 35.25975 36.0 34.5 37.5 32.0 39.0 78-79 35.285875000000004 36.0 35.0 37.0 33.0 39.0 80-81 34.9405 35.0 35.0 37.0 33.0 39.0 82-83 34.656125 35.0 35.0 36.5 33.0 37.0 84-85 34.416624999999996 35.0 35.0 36.0 33.0 37.0 86-87 34.2645 35.0 35.0 36.0 33.0 37.0 88-89 33.687375 35.0 34.5 35.0 31.0 36.0 90-91 33.761125 35.0 35.0 35.0 32.0 36.0 92-93 33.732124999999996 35.0 35.0 35.0 32.0 36.0 94-95 33.682 35.0 35.0 35.0 32.0 36.0 96-97 33.542 35.0 34.5 35.0 32.0 36.0 98-99 33.42975 35.0 34.0 35.0 32.0 35.0 100 33.30825 35.0 34.0 35.0 32.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 2.0 10 3.0 11 1.0 12 0.0 13 0.0 14 3.0 15 2.0 16 0.0 17 2.0 18 5.0 19 4.0 20 9.0 21 3.0 22 6.0 23 5.0 24 4.0 25 8.0 26 10.0 27 6.0 28 20.0 29 17.0 30 34.0 31 28.0 32 46.0 33 59.0 34 89.0 35 138.0 36 263.0 37 745.0 38 1829.0 39 657.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.799999999999997 15.675 11.05 49.475 2 18.75 22.75 40.025 18.475 3 20.65 26.900000000000002 26.875 25.575 4 23.425 31.474999999999998 21.175 23.925 5 24.50612653163291 34.958739684921234 23.080770192548137 17.454363590897724 6 18.675 39.0 23.799999999999997 18.525 7 16.25 21.0 43.05 19.7 8 17.175 24.2 32.074999999999996 26.55 9 19.45 23.05 34.5 23.0 10-11 22.05 33.387499999999996 24.1875 20.375 12-13 19.8 27.8875 30.25 22.0625 14-15 20.674999999999997 28.599999999999998 28.9 21.825 16-17 22.05 27.975 27.5875 22.3875 18-19 21.2875 29.075 27.35 22.287499999999998 20-21 21.675 29.062500000000004 27.9125 21.349999999999998 22-23 21.2375 29.075 27.8875 21.8 24-25 21.462500000000002 29.175 27.987499999999997 21.375 26-27 21.7 28.3625 28.1875 21.75 28-29 21.398199099549775 28.901950975487743 28.08904452226113 21.61080540270135 30-31 21.195448293109916 29.085907215205705 27.710391396773794 22.00825309491059 32-33 21.6875 28.875 27.625 21.8125 34-35 20.4375 29.95 27.712500000000002 21.9 36-37 21.224999999999998 28.9 27.275 22.6 38-39 21.2375 28.6125 28.249999999999996 21.9 40-41 21.4 28.7375 28.037499999999998 21.825 42-43 21.325 29.125 28.012500000000003 21.5375 44-45 20.5625 28.6875 29.375 21.375 46-47 21.3 28.575 28.575 21.55 48-49 21.0625 28.8875 28.512500000000003 21.5375 50-51 21.8125 28.625 28.037499999999998 21.525 52-53 21.587500000000002 29.75 26.450000000000003 22.2125 54-55 21.1125 28.225 29.25 21.4125 56-57 21.087500000000002 28.275 27.975 22.662499999999998 58-59 22.1 28.5625 28.5625 20.775 60-61 21.1375 28.012500000000003 29.049999999999997 21.8 62-63 21.8125 29.262500000000003 27.474999999999998 21.45 64-65 21.5 27.925 28.525 22.05 66-67 21.2 28.525 28.799999999999997 21.475 68-69 21.725 28.499999999999996 27.775 22.0 70-71 21.0125 28.425 28.962500000000002 21.6 72-73 20.8625 28.875 28.299999999999997 21.9625 74-75 21.375 30.1375 27.750000000000004 20.7375 76-77 21.375 28.5625 28.6375 21.425 78-79 22.537499999999998 27.3875 28.749999999999996 21.325 80-81 21.1625 29.0875 27.825 21.925 82-83 21.65 28.6875 28.012500000000003 21.65 84-85 21.9375 29.1875 28.0625 20.8125 86-87 21.087500000000002 28.675 28.025 22.2125 88-89 21.85 28.812500000000004 28.0625 21.275 90-91 22.5875 27.725 27.900000000000002 21.7875 92-93 21.675 29.049999999999997 27.9125 21.3625 94-95 21.462500000000002 28.212500000000002 28.475 21.85 96-97 21.55 29.562500000000004 27.500000000000004 21.3875 98-99 22.0125 28.6375 28.512500000000003 20.837500000000002 100 22.5 27.525 28.799999999999997 21.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 2.0 24 2.5 25 5.0 26 5.0 27 6.5 28 12.5 29 14.0 30 19.0 31 31.5 32 45.5 33 52.5 34 68.5 35 91.0 36 112.5 37 132.5 38 152.0 39 187.5 40 208.0 41 235.5 42 253.5 43 254.0 44 265.5 45 272.0 46 265.0 47 251.5 48 227.5 49 195.0 50 159.0 51 110.5 52 87.0 53 76.5 54 51.5 55 33.5 56 28.0 57 22.0 58 15.0 59 10.5 60 7.0 61 4.0 62 6.0 63 5.0 64 3.0 65 3.5 66 2.0 67 2.0 68 1.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.05 30-31 0.0375 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79939819458376 99.5 2 0.15045135406218654 0.3 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.025075225677031094 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTAT 5 0.125 TruSeq Adapter, Index 14 (97% over 44bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.07500000000000001 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88 0.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 933869 spots for SRR3207937.sra Written 933869 spots for SRR3207937.sra Read 933869 spots for SRR3207937.sra Written 933869 spots for SRR3207937.sra Read 933869 spots for SRR3207937.sra Written 933869 spots for SRR3207937.sra Read 933869 spots for SRR3207937.sra Written 933869 spots for SRR3207937.sra Read 933869 spots for SRR3207937.sra Written 933869 spots for SRR3207937.sra Read 933869 spots for SRR3207937.sra Written 933869 spots for SRR3207937.sra Read 933869 spots for SRR3207937.sra Written 933869 spots for SRR3207937.sra Read 933869 spots for SRR3207937.sra Written 933869 spots for SRR3207937.sra Read 933869 spots for SRR3207937.sra Written 933869 spots for SRR3207937.sra Read 933869 spots for SRR3207937.sra Written 933869 spots for SRR3207937.sra Read 933869 spots for SRR3207937.sra Written 933869 spots for SRR3207937.sra Read 933869 spots for SRR3207937.sra Written 933869 spots for SRR3207937.sra Read 933869 spots for SRR3207937.sra Written 933869 spots for SRR3207937.sra Read 933869 spots for SRR3207937.sra Written 933869 spots for SRR3207937.sra Read 933869 spots for SRR3207937.sra Written 933869 spots for SRR3207937.sra Read 933869 spots for SRR3207937.sra Written 933869 spots for SRR3207937.sra Read 933869 spots for SRR3207937.sra Written 933869 spots for SRR3207937.sra Read 933869 spots for SRR3207937.sra Written 933869 spots for SRR3207937.sra Read 933869 spots for SRR3207937.sra Written 933869 spots for SRR3207937.sra Read 933884 spots for SRR3207937.sra Written 933884 spots for SRR3207937.sra SRR ids: ['SRR3207937.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_auddef19 SRR3207937.sra spots: 18677395 blocks: [[1, 933869], [933870, 1867738], [1867739, 2801607], [2801608, 3735476], [3735477, 4669345], [4669346, 5603214], [5603215, 6537083], [6537084, 7470952], [7470953, 8404821], [8404822, 9338690], [9338691, 10272559], [10272560, 11206428], [11206429, 12140297], [12140298, 13074166], [13074167, 14008035], [14008036, 14941904], [14941905, 15875773], [15875774, 16809642], [16809643, 17743511], [17743512, 18677395]] SRR3207937 file size 4849795 SRR3207937 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207937 SRR3207937_1.fastq Input file: SRR3207937_1.fastq trimmed: SRR3207937-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 17:31:08 2025 >> started Tue Feb 11 17:31:17 2025 >> done (9.096s) 18677395 reads processed; of these: 1465 ( 0.01%) short reads filtered out after trimming by size control 29206 ( 0.16%) empty reads filtered out after trimming by size control 18646724 (99.84%) reads available; of these: 712118 ( 3.82%) trimmed reads available after processing 17934606 (96.18%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 247 0.00% 19 270 0.00% 20 454 0.00% 21 486 0.00% 22 756 0.00% 23 1100 0.01% 24 1503 0.01% 25 1859 0.01% 26 2154 0.01% 27 2224 0.01% 28 2112 0.01% 29 2248 0.01% 30 2178 0.01% 31 2341 0.01% 32 2391 0.01% 33 2361 0.01% 34 2611 0.01% 35 2653 0.01% 36 2747 0.01% 37 2754 0.01% 38 2834 0.02% 39 3000 0.02% 40 3044 0.02% 41 3116 0.02% 42 3315 0.02% 43 3378 0.02% 44 3520 0.02% 45 3623 0.02% 46 3634 0.02% 47 3805 0.02% 48 3934 0.02% 49 4172 0.02% 50 4163 0.02% 51 4519 0.02% 52 4488 0.02% 53 4746 0.03% 54 4788 0.03% 55 4813 0.03% 56 5146 0.03% 57 5253 0.03% 58 5342 0.03% 59 5675 0.03% 60 5853 0.03% 61 5750 0.03% 62 6138 0.03% 63 6091 0.03% 64 6041 0.03% 65 6316 0.03% 66 6289 0.03% 67 6749 0.04% 68 7100 0.04% 69 6528 0.04% 70 7037 0.04% 71 7238 0.04% 72 7579 0.04% 73 7855 0.04% 74 7979 0.04% 75 8057 0.04% 76 5872 0.03% 77 6519 0.03% 78 7301 0.04% 79 7760 0.04% 80 8525 0.05% 81 8765 0.05% 82 9554 0.05% 83 10634 0.06% 84 10798 0.06% 85 11427 0.06% 86 12130 0.07% 87 13193 0.07% 88 14306 0.08% 89 15728 0.08% 90 17268 0.09% 91 18988 0.10% 92 21546 0.12% 93 24359 0.13% 94 28297 0.15% 95 32786 0.18% 96 38949 0.21% 97 45530 0.24% 98 53007 0.28% 99 54519 0.29% 100 17934606 96.18% 18646724 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=23.77 fanout-score-rank=11 prefix-density=0.20 prefix-fanout=21.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTATGC criterion=fanout-score sequence-density=0.04 sequence-density-rank=12 fanout-score=282.60 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=29.2 sequence=TTCTTCTTCTTT Started job on | Feb 11 17:31:37 Started mapping on | Feb 11 17:31:37 Finished on | Feb 11 17:31:56 Mapping speed, Million of reads per hour | 3533.06 Number of input reads | 18646724 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 17911637 Uniquely mapped reads % | 96.06% Average mapped length | 98.90 Number of splices: Total | 5276785 Number of splices: Annotated (sjdb) | 5181839 Number of splices: GT/AG | 5197012 Number of splices: GC/AG | 64620 Number of splices: AT/AC | 5513 Number of splices: Non-canonical | 9640 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.02% Deletion average length | 1.98 Insertion rate per base | 0.01% Insertion average length | 1.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 388986 % of reads mapped to multiple loci | 2.09% Number of reads mapped to too many loci | 64620 % of reads mapped to too many loci | 0.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.50% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 346101 346101 346101 N_multimapping 388986 388986 388986 N_noFeature 787517 9311338 9252927 N_ambiguous 196534 30693 31261 UnstrandedReadsAssigned:16927586 PositiveStrandReadsAssigned:8569606 NegativeStrandReadsAssigned:8627449 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207937 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207937-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,646,724 reads, 17,346,961 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,095 rounds 52401 SRR3207937.ke.tsv 34699 SRR3207937.se.tsv 87100 total ==> SRR3207937.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 481 21.6693 Potri.005G024800.1.v4.1 1035 936 68 6.28069 Potri.004G059700.1.v4.1 961 862 39 3.91139 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 284.601 8.65128 Potri.016G087400.1.v4.1 270 171 663 335.19 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 46 2.37562 Potri.012G127500.1.v4.1 977 878 1620 159.512 ==> SRR3207937.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1994 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 326 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 96 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR3207937 completed mapping pipeline successfully