Starting /dee2/code/volunteer_pipeline.sh SRR3207938 current disk space = 3053417304064 free memory = 1483024364 SRR3207938 SRAfilesize 3df912ece238c5c6795985be791cb503 SRR3207938.sra SRR3207938.sra file validated SRR3207938 is single end SRR3207938 is conventional basespace SRR3207938 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207938_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9495 34.0 31.0 34.0 31.0 34.0 2 33.177 34.0 33.0 34.0 31.0 34.0 3 33.21975 34.0 34.0 34.0 31.0 34.0 4 36.52425 37.0 37.0 37.0 35.0 37.0 5 36.36575 37.0 37.0 37.0 35.0 37.0 6 36.36625 37.0 37.0 37.0 35.0 37.0 7 36.43525 37.0 37.0 37.0 35.0 37.0 8 36.38275 37.0 37.0 37.0 35.0 37.0 9 38.1785 39.0 39.0 39.0 37.0 39.0 10-11 38.208375000000004 39.0 39.0 39.0 37.0 39.0 12-13 38.18725 39.0 39.0 39.0 37.0 39.0 14-15 39.867875 41.0 40.0 41.0 38.0 41.0 16-17 39.852374999999995 41.0 40.0 41.0 38.0 41.0 18-19 39.826499999999996 41.0 40.0 41.0 38.0 41.0 20-21 39.680125000000004 41.0 40.0 41.0 37.5 41.0 22-23 39.23125 41.0 40.0 41.0 36.0 41.0 24-25 39.623625 41.0 40.0 41.0 37.5 41.0 26-27 39.6005 41.0 40.0 41.0 37.0 41.0 28-29 39.469875 41.0 40.0 41.0 37.0 41.0 30-31 39.29975 41.0 40.0 41.0 36.5 41.0 32-33 39.074625 41.0 39.0 41.0 36.0 41.0 34-35 39.176125 41.0 39.0 41.0 36.5 41.0 36-37 39.142250000000004 41.0 39.5 41.0 36.0 41.0 38-39 38.853625 41.0 39.0 41.0 35.5 41.0 40-41 38.680625 41.0 39.0 41.0 35.0 41.0 42-43 38.680125000000004 40.5 39.0 41.0 35.0 41.0 44-45 38.692625 41.0 39.0 41.0 35.0 41.0 46-47 38.612625 41.0 39.0 41.0 35.0 41.0 48-49 38.2655 40.0 38.5 41.0 34.5 41.0 50-51 38.606125 41.0 39.0 41.0 35.0 41.0 52-53 38.663 41.0 39.0 41.0 35.0 41.0 54-55 38.364375 41.0 39.0 41.0 34.5 41.0 56-57 38.174 41.0 38.5 41.0 34.5 41.0 58-59 37.765875 40.0 37.5 41.0 34.0 41.0 60-61 37.633250000000004 40.0 37.0 41.0 34.0 41.0 62-63 37.448 40.0 37.0 41.0 34.0 41.0 64-65 37.108 39.0 36.5 41.0 33.0 41.0 66-67 36.74625 39.0 36.0 41.0 33.0 41.0 68-69 36.428875 38.5 35.0 40.5 32.5 41.0 70-71 35.987875 37.0 35.0 39.5 33.0 41.0 72-73 35.164500000000004 37.0 35.0 39.0 31.5 41.0 74-75 34.609624999999994 36.0 35.0 39.0 31.0 40.5 76-77 33.7255 35.5 34.0 37.0 29.5 39.0 78-79 33.72225 35.5 35.0 37.0 30.0 39.0 80-81 33.441625 35.0 35.0 37.0 29.5 39.0 82-83 33.180625 35.0 35.0 36.0 30.0 37.0 84-85 33.003375 35.0 35.0 36.0 30.0 37.0 86-87 32.801125 35.0 34.5 36.0 30.0 36.5 88-89 32.312 35.0 34.0 35.0 27.5 36.0 90-91 32.407375 35.0 34.0 35.0 29.0 36.0 92-93 32.407624999999996 35.0 34.0 35.0 29.0 36.0 94-95 32.3125 35.0 34.0 35.0 29.0 36.0 96-97 32.164375 35.0 34.0 35.0 29.0 35.0 98-99 32.032 35.0 34.0 35.0 29.0 35.0 100 31.95825 35.0 34.0 35.0 28.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 2.0 7 3.0 8 6.0 9 2.0 10 12.0 11 12.0 12 9.0 13 5.0 14 5.0 15 11.0 16 6.0 17 4.0 18 9.0 19 8.0 20 6.0 21 9.0 22 15.0 23 13.0 24 14.0 25 12.0 26 16.0 27 22.0 28 46.0 29 20.0 30 40.0 31 44.0 32 49.0 33 66.0 34 97.0 35 141.0 36 262.0 37 746.0 38 1731.0 39 556.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.325 18.35 16.75 37.574999999999996 2 18.625 26.974999999999998 36.25 18.15 3 20.1 27.375 30.075000000000003 22.45 4 25.324999999999996 32.675 20.375 21.625 5 23.967975981986488 36.177132849637225 21.841381035776834 18.01351013259945 6 20.025000000000002 35.625 25.275 19.075 7 16.325 20.4 41.5 21.775 8 17.075000000000003 25.474999999999998 27.400000000000002 30.049999999999997 9 22.25 23.175 29.375 25.2 10-11 23.599999999999998 32.6125 22.375 21.4125 12-13 20.2625 27.35 28.599999999999998 23.7875 14-15 20.0875 27.825 28.499999999999996 23.5875 16-17 21.637500000000003 28.8375 26.525 23.0 18-19 21.625 28.237499999999997 27.725 22.412499999999998 20-21 22.650000000000002 27.9125 27.8375 21.6 22-23 21.25 30.55 26.900000000000002 21.3 24-25 20.4625 28.125 27.85 23.5625 26-27 20.7 27.875 26.3 25.124999999999996 28-29 21.3875 29.925 26.8625 21.825 30-31 20.962500000000002 27.900000000000002 28.212500000000002 22.925 32-33 21.9 27.6125 28.9875 21.5 34-35 21.099999999999998 28.4375 28.8625 21.6 36-37 21.4875 27.987499999999997 27.6 22.925 38-39 21.325 28.812500000000004 27.900000000000002 21.9625 40-41 22.237499999999997 29.4 26.487500000000004 21.875 42-43 21.725 28.749999999999996 27.375 22.15 44-45 21.0375 28.0875 27.500000000000004 23.375 46-47 21.9625 27.675 26.187500000000004 24.175 48-49 21.425 28.1 28.762500000000003 21.712500000000002 50-51 22.2125 27.200000000000003 29.862499999999997 20.724999999999998 52-53 20.9125 27.9375 26.5375 24.6125 54-55 23.150000000000002 28.299999999999997 26.900000000000002 21.65 56-57 21.212500000000002 26.7125 29.012500000000003 23.0625 58-59 21.4125 27.9375 27.6375 23.0125 60-61 21.8625 28.012500000000003 28.499999999999996 21.625 62-63 21.875 27.975 28.512500000000003 21.637500000000003 64-65 21.4 28.212500000000002 28.825 21.5625 66-67 22.3875 30.2 26.4625 20.95 68-69 22.55 30.099999999999998 26.387500000000003 20.962500000000002 70-71 21.224999999999998 28.825 28.000000000000004 21.95 72-73 21.637500000000003 28.6875 27.987499999999997 21.6875 74-75 21.325 29.862499999999997 27.075 21.7375 76-77 21.987499999999997 28.1375 27.325 22.55 78-79 21.15 29.1625 27.500000000000004 22.1875 80-81 23.05 28.5625 27.187499999999996 21.2 82-83 21.45 27.775 28.1125 22.662499999999998 84-85 21.45 27.8375 28.525 22.1875 86-87 22.4375 28.4 27.775 21.3875 88-89 22.0 27.750000000000004 27.200000000000003 23.05 90-91 21.475 28.6125 28.349999999999998 21.5625 92-93 22.0625 28.8875 27.537499999999998 21.512500000000003 94-95 22.375 29.6875 26.200000000000003 21.7375 96-97 22.1375 28.725 27.6875 21.45 98-99 22.662499999999998 28.9 26.937499999999996 21.5 100 20.974999999999998 28.275 28.925 21.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 2.5 21 2.5 22 1.5 23 2.0 24 3.0 25 3.5 26 3.5 27 11.5 28 15.0 29 14.0 30 22.0 31 33.5 32 42.0 33 47.5 34 53.0 35 67.0 36 86.5 37 117.5 38 147.0 39 175.5 40 194.5 41 207.0 42 228.0 43 250.0 44 264.0 45 243.0 46 247.5 47 234.5 48 210.0 49 216.5 50 178.0 51 136.5 52 124.0 53 105.5 54 76.0 55 56.5 56 43.0 57 28.0 58 22.0 59 20.0 60 12.5 61 6.0 62 7.0 63 6.0 64 3.5 65 5.5 66 7.5 67 5.0 68 3.0 69 2.0 70 1.0 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.48572897917202 96.72500000000001 2 0.3857032656209822 0.75 3 0.05142710208279763 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05142710208279763 0.8750000000000001 >50 0.025713551041398816 1.5 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTAT 60 1.5 TruSeq Adapter, Index 15 (97% over 40bp) AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCT 25 0.625 Illumina Single End PCR Primer 1 (100% over 50bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTA 10 0.25 TruSeq Adapter, Index 15 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.3 0.0 0.0 0.0 0.0 2 0.3 0.0 0.0 0.0 0.0 3 0.3 0.0 0.0 0.0 0.0 4 0.3 0.0 0.0 0.0 0.0 5 0.3 0.0 0.0 0.0 0.0 6 0.3 0.0 0.0 0.0 0.0 7 0.3 0.0 0.0 0.0 0.0 8 0.3 0.0 0.0 0.0 0.0 9 0.3 0.0 0.0 0.0 0.0 10-11 0.3 0.0 0.0 0.0 0.0 12-13 0.3 0.0 0.0 0.0 0.0 14-15 0.3 0.0 0.0 0.0 0.0 16-17 0.3 0.0 0.0 0.0 0.0 18-19 0.3 0.0 0.0 0.0 0.0 20-21 0.325 0.0 0.0 0.0 0.0 22-23 0.325 0.0 0.0 0.0 0.0 24-25 0.325 0.0 0.0 0.0 0.0 26-27 0.325 0.0 0.0 0.0 0.0 28-29 0.325 0.0 0.0 0.0 0.0 30-31 0.325 0.0 0.0 0.0 0.0 32-33 0.35 0.0 0.0 0.0 0.0 34-35 0.4 0.0 0.0 0.0 0.0 36-37 0.4 0.0 0.0 0.0 0.0 38-39 0.4 0.0 0.0 0.0 0.0 40-41 0.4 0.0 0.0 0.0 0.0 42-43 0.4 0.0 0.0 0.0 0.0 44-45 0.4 0.0 0.0 0.0 0.0 46-47 0.4 0.0 0.0 0.0 0.0 48-49 0.4 0.0 0.0 0.0 0.0 50-51 0.4 0.0 0.0 0.0 0.0 52-53 0.425 0.0 0.0 0.0 0.0 54-55 0.425 0.0 0.0 0.0 0.0 56-57 0.45 0.0 0.0 0.0 0.0 58-59 0.45 0.0 0.0 0.0 0.0 60-61 0.4625 0.0 0.0 0.0 0.0 62-63 0.475 0.0 0.0 0.0 0.0 64-65 0.475 0.0 0.0 0.0 0.0 66-67 0.5 0.0 0.0 0.0 0.0 68-69 0.525 0.0 0.0 0.0 0.0 70-71 0.5375000000000001 0.0 0.0 0.0 0.0 72-73 0.575 0.0 0.0 0.0 0.0 74-75 0.6125 0.0 0.0 0.0 0.0 76-77 0.65 0.0 0.0 0.0 0.0 78-79 0.6875 0.0 0.0 0.0 0.0 80-81 0.7375 0.0 0.0 0.0 0.0 82-83 0.7625 0.0 0.0 0.0 0.0 84-85 0.85 0.0 0.0 0.0 0.0 86-87 0.9375 0.0 0.0 0.0 0.0 88 0.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 613346 spots for SRR3207938.sra Written 613346 spots for SRR3207938.sra Read 613346 spots for SRR3207938.sra Written 613346 spots for SRR3207938.sra Read 613346 spots for SRR3207938.sra Written 613346 spots for SRR3207938.sra Read 613346 spots for SRR3207938.sra Written 613346 spots for SRR3207938.sra Read 613346 spots for SRR3207938.sra Written 613346 spots for SRR3207938.sra Read 613346 spots for SRR3207938.sra Written 613346 spots for SRR3207938.sra Read 613346 spots for SRR3207938.sra Written 613346 spots for SRR3207938.sra Read 613346 spots for SRR3207938.sra Written 613346 spots for SRR3207938.sra Read 613346 spots for SRR3207938.sra Written 613346 spots for SRR3207938.sra Read 613346 spots for SRR3207938.sra Written 613346 spots for SRR3207938.sra Read 613346 spots for SRR3207938.sra Written 613346 spots for SRR3207938.sra Read 613346 spots for SRR3207938.sra Written 613346 spots for SRR3207938.sra Read 613346 spots for SRR3207938.sra Written 613346 spots for SRR3207938.sra Read 613346 spots for SRR3207938.sra Written 613346 spots for SRR3207938.sra Read 613346 spots for SRR3207938.sra Written 613346 spots for SRR3207938.sra Read 613346 spots for SRR3207938.sra Written 613346 spots for SRR3207938.sra Read 613346 spots for SRR3207938.sra Written 613346 spots for SRR3207938.sra Read 613365 spots for SRR3207938.sra Written 613365 spots for SRR3207938.sra Read 613346 spots for SRR3207938.sra Written 613346 spots for SRR3207938.sra Read 613346 spots for SRR3207938.sra Written 613346 spots for SRR3207938.sra SRR ids: ['SRR3207938.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t33ak9u8 SRR3207938.sra spots: 12266939 blocks: [[1, 613346], [613347, 1226692], [1226693, 1840038], [1840039, 2453384], [2453385, 3066730], [3066731, 3680076], [3680077, 4293422], [4293423, 4906768], [4906769, 5520114], [5520115, 6133460], [6133461, 6746806], [6746807, 7360152], [7360153, 7973498], [7973499, 8586844], [8586845, 9200190], [9200191, 9813536], [9813537, 10426882], [10426883, 11040228], [11040229, 11653574], [11653575, 12266939]] SRR3207938 file size 3181524 SRR3207938 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207938 SRR3207938_1.fastq Input file: SRR3207938_1.fastq trimmed: SRR3207938-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 18:19:47 2025 >> started Tue Feb 11 18:19:53 2025 >> done (5.322s) 12266939 reads processed; of these: 3606 ( 0.03%) short reads filtered out after trimming by size control 299848 ( 2.44%) empty reads filtered out after trimming by size control 11963485 (97.53%) reads available; of these: 768643 ( 6.42%) trimmed reads available after processing 11194842 (93.58%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1203 0.01% 19 1550 0.01% 20 980 0.01% 21 1076 0.01% 22 908 0.01% 23 1151 0.01% 24 1881 0.02% 25 2400 0.02% 26 2203 0.02% 27 2706 0.02% 28 2470 0.02% 29 3182 0.03% 30 2340 0.02% 31 2835 0.02% 32 3977 0.03% 33 4530 0.04% 34 4680 0.04% 35 2650 0.02% 36 3787 0.03% 37 11143 0.09% 38 5749 0.05% 39 4214 0.04% 40 8681 0.07% 41 5595 0.05% 42 9470 0.08% 43 6848 0.06% 44 5005 0.04% 45 7374 0.06% 46 4370 0.04% 47 4895 0.04% 48 4363 0.04% 49 5107 0.04% 50 5456 0.05% 51 6996 0.06% 52 7925 0.07% 53 13889 0.12% 54 8807 0.07% 55 8535 0.07% 56 8193 0.07% 57 10155 0.08% 58 12217 0.10% 59 12928 0.11% 60 11432 0.10% 61 10035 0.08% 62 16495 0.14% 63 10218 0.09% 64 11187 0.09% 65 14649 0.12% 66 9166 0.08% 67 8077 0.07% 68 9866 0.08% 69 7654 0.06% 70 9758 0.08% 71 13841 0.12% 72 13260 0.11% 73 9907 0.08% 74 6744 0.06% 75 6895 0.06% 76 5168 0.04% 77 5486 0.05% 78 6360 0.05% 79 10778 0.09% 80 7578 0.06% 81 6391 0.05% 82 7095 0.06% 83 8310 0.07% 84 9337 0.08% 85 10526 0.09% 86 11913 0.10% 87 10680 0.09% 88 12407 0.10% 89 14690 0.12% 90 22070 0.18% 91 15734 0.13% 92 15775 0.13% 93 17072 0.14% 94 20460 0.17% 95 23432 0.20% 96 28078 0.23% 97 32455 0.27% 98 36482 0.30% 99 36758 0.31% 100 11194842 93.58% 11963485 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=47.31 fanout-score-rank=5 prefix-density=0.58 prefix-fanout=37.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATGCCGTCTTCTGCTTGAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=15 fanout-score=167.97 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=21.5 sequence=AAAAGAAAAGAAAA Started job on | Feb 11 18:20:11 Started mapping on | Feb 11 18:20:12 Finished on | Feb 11 18:20:31 Mapping speed, Million of reads per hour | 2266.77 Number of input reads | 11963485 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 10848894 Uniquely mapped reads % | 90.68% Average mapped length | 98.83 Number of splices: Total | 3137389 Number of splices: Annotated (sjdb) | 3082910 Number of splices: GT/AG | 3090600 Number of splices: GC/AG | 38394 Number of splices: AT/AC | 3088 Number of splices: Non-canonical | 5307 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.02% Deletion average length | 1.97 Insertion rate per base | 0.01% Insertion average length | 1.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 250030 % of reads mapped to multiple loci | 2.09% Number of reads mapped to too many loci | 51854 % of reads mapped to too many loci | 0.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.77% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 864561 864561 864561 N_multimapping 250030 250030 250030 N_noFeature 414345 5564563 5607027 N_ambiguous 127108 17652 17946 UnstrandedReadsAssigned:10307441 PositiveStrandReadsAssigned:5266679 NegativeStrandReadsAssigned:5223921 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207938 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207938-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,963,485 reads, 10,578,189 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,207 rounds 52401 SRR3207938.ke.tsv 34699 SRR3207938.se.tsv 87100 total ==> SRR3207938.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 281 19.0443 Potri.005G024800.1.v4.1 1035 936 43 5.97485 Potri.004G059700.1.v4.1 961 862 19 2.86669 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 131.281 6.00352 Potri.016G087400.1.v4.1 270 171 491 373.439 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 14 1.0877 Potri.012G127500.1.v4.1 977 878 1570 232.563 ==> SRR3207938.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 854 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 221 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 49 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 12 SRR3207938 completed mapping pipeline successfully