Starting /dee2/code/volunteer_pipeline.sh SRR3207939 current disk space = 3053433946112 free memory = 1482204300 SRR3207939 SRAfilesize d4db3da861620cc5bae41c8e65f4a8fe SRR3207939.sra SRR3207939.sra file validated SRR3207939 is single end SRR3207939 is conventional basespace SRR3207939 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207939_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.92275 34.0 31.0 34.0 31.0 34.0 2 33.1405 34.0 33.0 34.0 31.0 34.0 3 33.22825 34.0 34.0 34.0 31.0 34.0 4 36.53175 37.0 37.0 37.0 35.0 37.0 5 36.36975 37.0 37.0 37.0 35.0 37.0 6 36.4645 37.0 37.0 37.0 35.0 37.0 7 36.45475 37.0 37.0 37.0 35.0 37.0 8 36.4825 37.0 37.0 37.0 35.0 37.0 9 38.2395 39.0 39.0 39.0 37.0 39.0 10-11 38.23975 39.0 39.0 39.0 37.0 39.0 12-13 38.207375 39.0 39.0 39.0 37.0 39.0 14-15 39.949375 41.0 40.0 41.0 38.0 41.0 16-17 39.91325 41.0 40.0 41.0 38.0 41.0 18-19 39.856875 41.0 40.0 41.0 38.0 41.0 20-21 39.897625 41.0 40.0 41.0 38.0 41.0 22-23 39.51025 41.0 40.0 41.0 36.5 41.0 24-25 39.821875000000006 41.0 40.0 41.0 37.5 41.0 26-27 39.774625 41.0 40.0 41.0 38.0 41.0 28-29 39.7285 41.0 40.0 41.0 37.5 41.0 30-31 39.50175 41.0 40.0 41.0 37.0 41.0 32-33 39.27175 41.0 39.5 41.0 36.0 41.0 34-35 39.409375 41.0 39.5 41.0 36.5 41.0 36-37 39.350875 41.0 39.5 41.0 36.5 41.0 38-39 39.20975 41.0 39.0 41.0 36.0 41.0 40-41 39.035125 40.0 39.0 41.0 35.0 41.0 42-43 39.117875 40.5 39.0 41.0 36.0 41.0 44-45 39.16475 41.0 39.0 41.0 36.0 41.0 46-47 39.113875 41.0 39.0 41.0 36.0 41.0 48-49 38.843125 40.5 39.0 41.0 35.0 41.0 50-51 39.1335 41.0 39.0 41.0 35.5 41.0 52-53 39.202875 41.0 39.0 41.0 36.0 41.0 54-55 38.966625 41.0 39.0 41.0 35.5 41.0 56-57 38.77375 40.5 38.5 41.0 35.0 41.0 58-59 38.54325 40.0 38.0 41.0 35.0 41.0 60-61 38.49925 40.0 37.5 41.0 35.0 41.0 62-63 38.304249999999996 40.0 37.0 41.0 35.0 41.0 64-65 37.959 39.0 37.0 41.0 34.0 41.0 66-67 37.742000000000004 39.0 36.0 41.0 34.0 41.0 68-69 37.32825 39.0 36.0 40.5 34.0 41.0 70-71 36.944500000000005 37.5 35.0 40.0 34.0 41.0 72-73 36.432500000000005 37.0 35.0 39.0 33.5 41.0 74-75 35.92275 36.5 35.0 39.0 33.0 41.0 76-77 34.929500000000004 35.5 34.0 37.0 31.5 39.0 78-79 35.010875 35.5 35.0 37.0 32.0 39.0 80-81 34.683125 35.0 35.0 37.0 32.5 39.0 82-83 34.428875000000005 35.0 35.0 36.0 32.0 37.0 84-85 34.20125 35.0 35.0 36.0 32.0 37.0 86-87 33.93375 35.0 35.0 36.0 32.0 37.0 88-89 33.422625 35.0 34.0 35.0 30.5 36.0 90-91 33.5045 35.0 34.0 35.0 31.0 36.0 92-93 33.503 35.0 34.0 35.0 32.0 36.0 94-95 33.37775 35.0 34.0 35.0 31.0 36.0 96-97 33.291124999999994 35.0 34.0 35.0 31.0 35.5 98-99 33.160375 35.0 34.0 35.0 31.0 35.0 100 33.10975 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 2.0 10 0.0 11 2.0 12 2.0 13 3.0 14 4.0 15 3.0 16 2.0 17 2.0 18 4.0 19 5.0 20 2.0 21 2.0 22 4.0 23 8.0 24 5.0 25 5.0 26 17.0 27 22.0 28 23.0 29 30.0 30 36.0 31 32.0 32 64.0 33 53.0 34 94.0 35 170.0 36 294.0 37 766.0 38 1771.0 39 572.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.75 16.775000000000002 14.924999999999999 43.55 2 18.15 25.575 38.875 17.4 3 20.150000000000002 26.650000000000002 28.999999999999996 24.2 4 22.125 34.075 21.675 22.125 5 23.93098274568642 35.708927231807955 22.18054513628407 18.179544886221557 6 18.75 36.525 25.624999999999996 19.1 7 16.05 18.425 43.625 21.9 8 18.275 24.075 31.2 26.450000000000003 9 18.925 24.099999999999998 31.075000000000003 25.900000000000002 10-11 22.35 32.95 22.8625 21.837500000000002 12-13 20.625 26.2125 29.6625 23.5 14-15 20.2875 28.212500000000002 28.212500000000002 23.2875 16-17 21.9375 27.0125 28.549999999999997 22.5 18-19 20.95 28.4 28.025 22.625 20-21 20.6625 29.312500000000004 27.375 22.650000000000002 22-23 21.224999999999998 28.999999999999996 27.450000000000003 22.325 24-25 22.177772221527693 28.353544193024128 27.51593949243655 21.952744093011624 26-27 21.2375 29.275000000000002 27.05 22.4375 28-29 21.583093660122547 28.623233712642243 27.822933600100036 21.970739027135174 30-31 21.003252439329497 28.596447335501622 27.833375031273455 22.566925193895422 32-33 20.837500000000002 29.549999999999997 27.5125 22.1 34-35 21.1125 28.9 28.237499999999997 21.75 36-37 21.825 28.4125 28.275 21.4875 38-39 22.025 28.237499999999997 27.425 22.3125 40-41 22.275 27.575 28.0875 22.0625 42-43 21.3125 28.375 27.474999999999998 22.8375 44-45 22.175 27.6375 28.65 21.5375 46-47 21.349999999999998 27.525 28.287499999999998 22.8375 48-49 22.3875 28.249999999999996 27.8375 21.525 50-51 21.512500000000003 28.0625 29.1625 21.2625 52-53 22.162499999999998 27.6875 27.0875 23.0625 54-55 21.6 28.15 28.525 21.725 56-57 21.55 27.962500000000002 28.1875 22.3 58-59 21.7875 28.9875 27.224999999999998 22.0 60-61 21.55 28.175 27.875 22.400000000000002 62-63 22.0125 28.4375 28.1 21.45 64-65 22.125 28.199999999999996 28.025 21.65 66-67 21.6875 28.262500000000003 28.487499999999997 21.5625 68-69 21.85 27.975 28.487499999999997 21.6875 70-71 22.125 29.625 27.037499999999998 21.212500000000002 72-73 22.275 28.262500000000003 27.825 21.637500000000003 74-75 22.0875 28.925 27.375 21.6125 76-77 21.9375 28.799999999999997 27.987499999999997 21.275 78-79 22.175 28.125 27.437499999999996 22.2625 80-81 22.400000000000002 27.962500000000002 27.487499999999997 22.15 82-83 21.6625 28.462500000000002 28.325 21.55 84-85 22.625 27.6375 28.5625 21.175 86-87 22.2 28.499999999999996 27.737499999999997 21.5625 88-89 23.1 27.55 28.275 21.075 90-91 22.2 28.7375 26.7625 22.3 92-93 21.6875 29.3875 28.1375 20.7875 94-95 23.225 27.8625 28.075 20.837500000000002 96-97 21.0 28.999999999999996 28.4 21.6 98-99 22.787499999999998 29.2 26.937499999999996 21.075 100 22.575 28.65 27.150000000000002 21.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 1.0 23 1.5 24 1.0 25 2.0 26 5.0 27 8.0 28 10.5 29 11.5 30 16.5 31 24.0 32 35.0 33 42.5 34 56.0 35 78.0 36 95.5 37 120.0 38 150.0 39 185.0 40 203.0 41 222.0 42 247.5 43 265.5 44 272.5 45 280.0 46 270.5 47 241.0 48 215.5 49 191.0 50 175.5 51 135.5 52 97.0 53 80.0 54 65.5 55 50.0 56 36.5 57 24.0 58 17.5 59 18.0 60 12.0 61 8.0 62 8.0 63 4.0 64 2.5 65 4.0 66 2.5 67 1.0 68 0.0 69 1.0 70 1.0 71 0.5 72 0.5 73 0.0 74 1.0 75 1.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0125 26-27 0.0 28-29 0.0375 30-31 0.075 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84943538268507 99.47500000000001 2 0.12547051442910914 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02509410288582183 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTAT 11 0.27499999999999997 TruSeq Adapter, Index 16 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.025 0.0 18-19 0.075 0.0 0.0 0.025 0.0 20-21 0.075 0.0 0.0 0.025 0.0 22-23 0.075 0.0 0.0 0.025 0.0 24-25 0.075 0.0 0.0 0.025 0.0 26-27 0.075 0.0 0.0 0.025 0.0 28-29 0.075 0.0 0.0 0.025 0.0 30-31 0.075 0.0 0.0 0.025 0.0 32-33 0.075 0.0 0.0 0.025 0.0 34-35 0.075 0.0 0.0 0.025 0.0 36-37 0.075 0.0 0.0 0.025 0.0 38-39 0.075 0.0 0.0 0.025 0.0 40-41 0.075 0.0 0.0 0.025 0.0 42-43 0.075 0.0 0.0 0.025 0.0 44-45 0.075 0.0 0.0 0.025 0.0 46-47 0.075 0.0 0.0 0.025 0.0 48-49 0.075 0.0 0.0 0.025 0.0 50-51 0.075 0.0 0.0 0.025 0.0 52-53 0.075 0.0 0.0 0.025 0.0 54-55 0.075 0.0 0.0 0.025 0.0 56-57 0.075 0.0 0.0 0.025 0.0 58-59 0.075 0.0 0.0 0.025 0.0 60-61 0.075 0.0 0.0 0.025 0.0 62-63 0.075 0.0 0.0 0.025 0.0 64-65 0.0875 0.0 0.0 0.025 0.0 66-67 0.1 0.0 0.0 0.025 0.0 68-69 0.1 0.0 0.0 0.025 0.0 70-71 0.1 0.0 0.0 0.025 0.0 72-73 0.1375 0.0 0.0 0.025 0.0 74-75 0.16249999999999998 0.0 0.0 0.025 0.0 76-77 0.175 0.0 0.0 0.025 0.0 78-79 0.1875 0.0 0.0 0.025 0.0 80-81 0.2 0.0 0.0 0.025 0.0 82-83 0.275 0.0 0.0 0.025 0.0 84-85 0.36250000000000004 0.0 0.0 0.025 0.0 86-87 0.4625 0.0 0.0 0.025 0.0 88 0.475 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 731027 spots for SRR3207939.sra Written 731027 spots for SRR3207939.sra Read 731027 spots for SRR3207939.sra Written 731027 spots for SRR3207939.sra Read 731027 spots for SRR3207939.sra Written 731027 spots for SRR3207939.sra Read 731027 spots for SRR3207939.sra Written 731027 spots for SRR3207939.sra Read 731027 spots for SRR3207939.sra Written 731027 spots for SRR3207939.sra Read 731027 spots for SRR3207939.sra Written 731027 spots for SRR3207939.sra Read 731027 spots for SRR3207939.sra Written 731027 spots for SRR3207939.sra Read 731027 spots for SRR3207939.sra Written 731027 spots for SRR3207939.sra Read 731027 spots for SRR3207939.sra Written 731027 spots for SRR3207939.sra Read 731027 spots for SRR3207939.sra Written 731027 spots for SRR3207939.sra Read 731027 spots for SRR3207939.sra Written 731027 spots for SRR3207939.sra Read 731027 spots for SRR3207939.sra Written 731027 spots for SRR3207939.sra Read 731027 spots for SRR3207939.sra Written 731027 spots for SRR3207939.sra Read 731027 spots for SRR3207939.sra Written 731027 spots for SRR3207939.sra Read 731027 spots for SRR3207939.sra Written 731027 spots for SRR3207939.sra Read 731027 spots for SRR3207939.sra Written 731027 spots for SRR3207939.sra Read 731027 spots for SRR3207939.sra Written 731027 spots for SRR3207939.sra Read 731045 spots for SRR3207939.sra Written 731045 spots for SRR3207939.sra Read 731027 spots for SRR3207939.sra Written 731027 spots for SRR3207939.sra Read 731027 spots for SRR3207939.sra Written 731027 spots for SRR3207939.sra SRR ids: ['SRR3207939.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_njcb5vmy SRR3207939.sra spots: 14620558 blocks: [[1, 731027], [731028, 1462054], [1462055, 2193081], [2193082, 2924108], [2924109, 3655135], [3655136, 4386162], [4386163, 5117189], [5117190, 5848216], [5848217, 6579243], [6579244, 7310270], [7310271, 8041297], [8041298, 8772324], [8772325, 9503351], [9503352, 10234378], [10234379, 10965405], [10965406, 11696432], [11696433, 12427459], [12427460, 13158486], [13158487, 13889513], [13889514, 14620558]] SRR3207939 file size 3794025 SRR3207939 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207939 SRR3207939_1.fastq Input file: SRR3207939_1.fastq trimmed: SRR3207939-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 18:17:34 2025 >> started Tue Feb 11 18:17:41 2025 >> done (6.929s) 14620558 reads processed; of these: 1012 ( 0.01%) short reads filtered out after trimming by size control 93860 ( 0.64%) empty reads filtered out after trimming by size control 14525686 (99.35%) reads available; of these: 575748 ( 3.96%) trimmed reads available after processing 13949938 (96.04%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 173 0.00% 19 290 0.00% 20 755 0.01% 21 389 0.00% 22 510 0.00% 23 809 0.01% 24 1020 0.01% 25 1368 0.01% 26 1663 0.01% 27 1801 0.01% 28 1729 0.01% 29 1713 0.01% 30 1583 0.01% 31 1662 0.01% 32 1853 0.01% 33 1729 0.01% 34 1886 0.01% 35 1993 0.01% 36 2004 0.01% 37 2097 0.01% 38 2097 0.01% 39 2135 0.01% 40 2168 0.01% 41 2396 0.02% 42 2541 0.02% 43 2505 0.02% 44 2642 0.02% 45 2722 0.02% 46 2825 0.02% 47 2988 0.02% 48 3031 0.02% 49 3151 0.02% 50 3150 0.02% 51 3354 0.02% 52 3384 0.02% 53 3692 0.03% 54 3651 0.03% 55 3832 0.03% 56 4025 0.03% 57 4095 0.03% 58 4172 0.03% 59 4383 0.03% 60 4541 0.03% 61 4649 0.03% 62 4772 0.03% 63 4832 0.03% 64 4981 0.03% 65 5312 0.04% 66 5374 0.04% 67 5550 0.04% 68 5618 0.04% 69 5248 0.04% 70 5783 0.04% 71 6425 0.04% 72 6442 0.04% 73 6397 0.04% 74 6319 0.04% 75 6574 0.05% 76 4729 0.03% 77 5083 0.03% 78 5849 0.04% 79 6300 0.04% 80 6748 0.05% 81 7232 0.05% 82 7767 0.05% 83 8543 0.06% 84 8851 0.06% 85 9291 0.06% 86 9753 0.07% 87 10695 0.07% 88 11598 0.08% 89 12695 0.09% 90 14243 0.10% 91 15623 0.11% 92 17723 0.12% 93 20167 0.14% 94 23216 0.16% 95 26682 0.18% 96 32646 0.22% 97 37697 0.26% 98 43357 0.30% 99 44477 0.31% 100 13949938 96.04% 14525686 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=49.15 fanout-score-rank=9 prefix-density=0.47 prefix-fanout=35.2 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTATGCCGTCTTCTGCTTGAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=11 fanout-score=271.46 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=28.3 sequence=TTCTTCTTCTTT Started job on | Feb 11 18:17:56 Started mapping on | Feb 11 18:17:56 Finished on | Feb 11 18:18:12 Mapping speed, Million of reads per hour | 3268.28 Number of input reads | 14525686 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 13954970 Uniquely mapped reads % | 96.07% Average mapped length | 98.96 Number of splices: Total | 4204017 Number of splices: Annotated (sjdb) | 4128649 Number of splices: GT/AG | 4140868 Number of splices: GC/AG | 52337 Number of splices: AT/AC | 4249 Number of splices: Non-canonical | 6563 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.02% Deletion average length | 1.96 Insertion rate per base | 0.01% Insertion average length | 1.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 311673 % of reads mapped to multiple loci | 2.15% Number of reads mapped to too many loci | 49075 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.44% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 259043 259043 259043 N_multimapping 311673 311673 311673 N_noFeature 614176 7179328 7292381 N_ambiguous 145003 23817 23941 UnstrandedReadsAssigned:13195791 PositiveStrandReadsAssigned:6751825 NegativeStrandReadsAssigned:6638648 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207939 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207939-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,525,686 reads, 13,498,846 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,216 rounds 52401 SRR3207939.ke.tsv 34699 SRR3207939.se.tsv 87100 total ==> SRR3207939.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 401 22.8185 Potri.005G024800.1.v4.1 1035 936 47 5.48327 Potri.004G059700.1.v4.1 961 862 14 1.77353 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 242.341 9.30496 Potri.016G087400.1.v4.1 270 171 468 298.86 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 36 2.34836 Potri.012G127500.1.v4.1 977 878 2043 254.092 ==> SRR3207939.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1294 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 308 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 78 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 9 SRR3207939 completed mapping pipeline successfully