Starting /dee2/code/volunteer_pipeline.sh SRR3207940 current disk space = 3053287358464 free memory = 1573560300 SRR3207940 SRAfilesize 537b13d897c719cecba8895c14deea31 SRR3207940.sra SRR3207940.sra file validated SRR3207940 is single end SRR3207940 is conventional basespace SRR3207940 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207940_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.13775 34.0 33.0 34.0 31.0 34.0 2 33.221 34.0 34.0 34.0 31.0 34.0 3 33.3045 34.0 34.0 34.0 31.0 34.0 4 36.54675 37.0 37.0 37.0 35.0 37.0 5 36.52075 37.0 37.0 37.0 35.0 37.0 6 36.4265 37.0 37.0 37.0 35.0 37.0 7 36.44325 37.0 37.0 37.0 35.0 37.0 8 36.42375 37.0 37.0 37.0 35.0 37.0 9 38.28125 39.0 39.0 39.0 37.0 39.0 10-11 38.26175 39.0 39.0 39.0 37.0 39.0 12-13 37.956625 39.0 38.5 39.0 36.0 39.0 14-15 39.911625 41.0 40.0 41.0 38.0 41.0 16-17 39.96075 41.0 40.0 41.0 38.0 41.0 18-19 39.800250000000005 41.0 40.0 41.0 38.0 41.0 20-21 39.88975 41.0 40.0 41.0 38.0 41.0 22-23 39.881249999999994 41.0 40.0 41.0 38.0 41.0 24-25 39.8255 41.0 40.0 41.0 38.0 41.0 26-27 39.8185 41.0 40.0 41.0 38.0 41.0 28-29 39.638000000000005 41.0 40.0 41.0 37.0 41.0 30-31 39.55775 41.0 40.0 41.0 37.0 41.0 32-33 39.447 41.0 40.0 41.0 36.5 41.0 34-35 39.43225 41.0 40.0 41.0 37.0 41.0 36-37 39.427 41.0 40.0 41.0 37.0 41.0 38-39 39.29375 41.0 39.5 41.0 36.0 41.0 40-41 39.226625 41.0 39.0 41.0 36.0 41.0 42-43 39.25425 41.0 39.0 41.0 36.0 41.0 44-45 38.935625 41.0 39.0 41.0 35.5 41.0 46-47 39.060375 41.0 39.0 41.0 35.5 41.0 48-49 39.064875 41.0 39.0 41.0 35.0 41.0 50-51 39.217749999999995 41.0 39.0 41.0 35.5 41.0 52-53 39.255875 41.0 39.0 41.0 36.0 41.0 54-55 38.954125000000005 41.0 39.0 41.0 35.0 41.0 56-57 38.909125 41.0 39.0 41.0 35.0 41.0 58-59 38.6995 40.5 38.5 41.0 35.0 41.0 60-61 38.616875 40.0 38.0 41.0 35.0 41.0 62-63 38.3375 40.0 37.5 41.0 34.5 41.0 64-65 38.00775 39.5 37.0 41.0 34.0 41.0 66-67 37.72325 39.0 36.5 41.0 34.0 41.0 68-69 37.336 39.0 36.0 41.0 34.0 41.0 70-71 36.974000000000004 37.5 35.5 40.0 34.0 41.0 72-73 36.447125 37.0 35.0 39.0 33.0 41.0 74-75 36.08475 37.0 35.0 39.0 33.0 41.0 76-77 35.134875 36.0 34.5 37.5 31.5 39.0 78-79 35.154625 36.0 35.0 37.0 32.0 39.0 80-81 34.901625 35.0 35.0 37.0 33.0 39.0 82-83 34.605125 35.0 35.0 36.5 32.5 37.0 84-85 34.391 35.0 35.0 36.0 32.0 37.0 86-87 34.223 35.0 35.0 36.0 32.0 37.0 88-89 33.9165 35.0 35.0 35.5 32.0 36.0 90-91 33.658874999999995 35.0 34.0 35.0 31.0 36.0 92-93 33.437 35.0 34.0 35.0 31.0 36.0 94-95 33.476375000000004 35.0 34.0 35.0 31.0 36.0 96-97 33.426500000000004 35.0 34.0 35.0 32.0 35.5 98-99 33.2775 35.0 34.0 35.0 31.0 35.0 100 33.28275 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 4.0 12 0.0 13 1.0 14 2.0 15 2.0 16 3.0 17 4.0 18 3.0 19 6.0 20 2.0 21 4.0 22 4.0 23 4.0 24 10.0 25 11.0 26 17.0 27 14.0 28 23.0 29 26.0 30 41.0 31 29.0 32 53.0 33 69.0 34 95.0 35 157.0 36 240.0 37 710.0 38 1812.0 39 653.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.700000000000003 13.8 12.725 45.775 2 18.3 20.75 38.05 22.900000000000002 3 20.525 25.874999999999996 27.800000000000004 25.8 4 23.674999999999997 30.425 20.325 25.575 5 24.675 34.875 22.650000000000002 17.8 6 20.325 36.75 24.625 18.3 7 17.25 20.125 42.3 20.325 8 18.625 25.025 31.825 24.525 9 18.675 24.05 34.35 22.925 10-11 21.8125 33.0625 24.4125 20.7125 12-13 19.950000000000003 26.825 30.0375 23.1875 14-15 20.2625 28.3625 29.4875 21.8875 16-17 21.762500000000003 28.575 27.6375 22.025 18-19 21.3625 29.9 27.462500000000002 21.275 20-21 20.7125 29.15 28.175 21.9625 22-23 21.9 29.9625 26.525 21.6125 24-25 20.5375 29.012500000000003 28.287499999999998 22.162499999999998 26-27 20.974999999999998 28.262500000000003 28.475 22.287499999999998 28-29 21.745654620482682 28.9108415655871 28.360635238214332 20.982868575715894 30-31 20.832812304614233 29.14843066149806 27.872952357133922 22.145804676753784 32-33 21.912499999999998 29.062500000000004 27.450000000000003 21.575 34-35 21.837500000000002 28.1375 28.512500000000003 21.512500000000003 36-37 22.075 28.175 27.875 21.875 38-39 21.45 28.249999999999996 27.537499999999998 22.7625 40-41 21.15 28.7375 28.6375 21.475 42-43 21.3875 28.525 27.9125 22.175 44-45 21.9625 27.762500000000003 28.212500000000002 22.0625 46-47 22.112499999999997 27.9125 28.3625 21.6125 48-49 21.4875 28.462500000000002 28.6125 21.4375 50-51 21.5625 28.0625 29.25 21.125 52-53 21.575 28.462500000000002 28.15 21.8125 54-55 21.25 28.799999999999997 27.525 22.425 56-57 21.875 28.999999999999996 27.2625 21.8625 58-59 21.5 28.775000000000002 29.1875 20.5375 60-61 21.3 28.5875 29.049999999999997 21.0625 62-63 21.712500000000002 28.799999999999997 27.975 21.512500000000003 64-65 21.4375 28.749999999999996 28.875 20.9375 66-67 21.224999999999998 28.249999999999996 28.625 21.9 68-69 22.2 27.8875 28.8875 21.025 70-71 22.0875 26.650000000000002 29.525000000000002 21.7375 72-73 21.087500000000002 28.262500000000003 29.225 21.425 74-75 21.0 27.987499999999997 28.525 22.4875 76-77 21.275 27.474999999999998 28.762500000000003 22.4875 78-79 21.6625 28.4 28.1375 21.8 80-81 21.375 27.6875 29.049999999999997 21.8875 82-83 20.9125 28.3375 29.2 21.55 84-85 21.2 28.462500000000002 29.4875 20.849999999999998 86-87 21.025 28.3375 28.775000000000002 21.8625 88-89 22.15 27.950000000000003 28.599999999999998 21.3 90-91 21.45 28.812500000000004 28.6125 21.125 92-93 20.6125 28.449999999999996 29.025000000000002 21.912499999999998 94-95 21.4 27.6875 28.999999999999996 21.912499999999998 96-97 21.45 28.262500000000003 29.012500000000003 21.275 98-99 21.95 27.787499999999998 29.45 20.8125 100 21.925 28.4 28.825 20.849999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.5 22 0.5 23 0.5 24 2.5 25 2.5 26 1.0 27 4.0 28 7.0 29 13.5 30 22.0 31 31.5 32 36.5 33 49.5 34 75.0 35 86.5 36 104.5 37 129.0 38 150.5 39 182.0 40 218.5 41 245.5 42 252.5 43 269.5 44 282.0 45 286.0 46 280.0 47 239.5 48 195.0 49 171.5 50 161.0 51 132.0 52 94.5 53 71.5 54 55.0 55 36.5 56 28.5 57 22.5 58 13.5 59 8.5 60 6.5 61 5.5 62 3.5 63 4.0 64 3.0 65 2.5 66 2.5 67 1.5 68 1.0 69 0.5 70 1.5 71 1.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0375 30-31 0.0375 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84962406015038 99.6 2 0.12531328320802004 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.02506265664160401 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC 6 0.15 TruSeq Adapter, Index 7 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88 0.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 646508 spots for SRR3207940.sra Written 646508 spots for SRR3207940.sra Read 646508 spots for SRR3207940.sra Written 646508 spots for SRR3207940.sra Read 646508 spots for SRR3207940.sra Written 646508 spots for SRR3207940.sra Read 646508 spots for SRR3207940.sra Written 646508 spots for SRR3207940.sra Read 646508 spots for SRR3207940.sra Written 646508 spots for SRR3207940.sra Read 646508 spots for SRR3207940.sra Written 646508 spots for SRR3207940.sra Read 646508 spots for SRR3207940.sra Written 646508 spots for SRR3207940.sra Read 646508 spots for SRR3207940.sra Written 646508 spots for SRR3207940.sra Read 646508 spots for SRR3207940.sra Written 646508 spots for SRR3207940.sra Read 646508 spots for SRR3207940.sra Written 646508 spots for SRR3207940.sra Read 646508 spots for SRR3207940.sra Written 646508 spots for SRR3207940.sra Read 646508 spots for SRR3207940.sra Written 646508 spots for SRR3207940.sra Read 646508 spots for SRR3207940.sra Written 646508 spots for SRR3207940.sra Read 646508 spots for SRR3207940.sra Written 646508 spots for SRR3207940.sra Read 646508 spots for SRR3207940.sra Written 646508 spots for SRR3207940.sra Read 646508 spots for SRR3207940.sra Written 646508 spots for SRR3207940.sra Read 646508 spots for SRR3207940.sra Written 646508 spots for SRR3207940.sra Read 646524 spots for SRR3207940.sra Written 646524 spots for SRR3207940.sra Read 646508 spots for SRR3207940.sra Written 646508 spots for SRR3207940.sra Read 646508 spots for SRR3207940.sra Written 646508 spots for SRR3207940.sra SRR ids: ['SRR3207940.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o8h4m403 SRR3207940.sra spots: 12930176 blocks: [[1, 646508], [646509, 1293016], [1293017, 1939524], [1939525, 2586032], [2586033, 3232540], [3232541, 3879048], [3879049, 4525556], [4525557, 5172064], [5172065, 5818572], [5818573, 6465080], [6465081, 7111588], [7111589, 7758096], [7758097, 8404604], [8404605, 9051112], [9051113, 9697620], [9697621, 10344128], [10344129, 10990636], [10990637, 11637144], [11637145, 12283652], [12283653, 12930176]] SRR3207940 file size 3354134 SRR3207940 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207940 SRR3207940_1.fastq Input file: SRR3207940_1.fastq trimmed: SRR3207940-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 19:39:54 2025 >> started Tue Feb 11 19:40:01 2025 >> done (6.408s) 12930176 reads processed; of these: 1054 ( 0.01%) short reads filtered out after trimming by size control 16814 ( 0.13%) empty reads filtered out after trimming by size control 12912308 (99.86%) reads available; of these: 488165 ( 3.78%) trimmed reads available after processing 12424143 (96.22%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 151 0.00% 19 228 0.00% 20 265 0.00% 21 384 0.00% 22 551 0.00% 23 810 0.01% 24 1130 0.01% 25 1360 0.01% 26 1441 0.01% 27 1416 0.01% 28 1469 0.01% 29 1526 0.01% 30 1520 0.01% 31 1639 0.01% 32 1619 0.01% 33 1608 0.01% 34 1797 0.01% 35 1855 0.01% 36 1937 0.02% 37 1958 0.02% 38 2002 0.02% 39 2028 0.02% 40 2041 0.02% 41 2269 0.02% 42 2225 0.02% 43 2319 0.02% 44 2320 0.02% 45 2443 0.02% 46 2444 0.02% 47 2603 0.02% 48 2791 0.02% 49 2768 0.02% 50 2731 0.02% 51 2876 0.02% 52 2985 0.02% 53 3000 0.02% 54 3094 0.02% 55 3401 0.03% 56 3369 0.03% 57 3499 0.03% 58 3632 0.03% 59 3744 0.03% 60 3840 0.03% 61 3930 0.03% 62 3982 0.03% 63 4098 0.03% 64 4026 0.03% 65 4167 0.03% 66 4556 0.04% 67 4610 0.04% 68 4792 0.04% 69 4612 0.04% 70 4717 0.04% 71 4888 0.04% 72 5071 0.04% 73 5294 0.04% 74 5584 0.04% 75 5380 0.04% 76 3982 0.03% 77 4556 0.04% 78 4982 0.04% 79 5277 0.04% 80 5895 0.05% 81 6156 0.05% 82 6690 0.05% 83 7122 0.06% 84 7709 0.06% 85 8036 0.06% 86 8495 0.07% 87 9209 0.07% 88 9894 0.08% 89 10742 0.08% 90 11955 0.09% 91 12904 0.10% 92 14714 0.11% 93 16489 0.13% 94 19693 0.15% 95 22983 0.18% 96 26953 0.21% 97 31913 0.25% 98 35827 0.28% 99 37194 0.29% 100 12424143 96.22% 12912308 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=23.47 fanout-score-rank=10 prefix-density=0.20 prefix-fanout=22.2 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTGAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=15 fanout-score=269.82 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=28.1 sequence=TTCTTCTTCTTTT Started job on | Feb 11 19:40:17 Started mapping on | Feb 11 19:40:17 Finished on | Feb 11 19:40:32 Mapping speed, Million of reads per hour | 3098.95 Number of input reads | 12912308 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 12417457 Uniquely mapped reads % | 96.17% Average mapped length | 98.91 Number of splices: Total | 3562927 Number of splices: Annotated (sjdb) | 3492696 Number of splices: GT/AG | 3508626 Number of splices: GC/AG | 43770 Number of splices: AT/AC | 3849 Number of splices: Non-canonical | 6682 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.02% Deletion average length | 2.04 Insertion rate per base | 0.01% Insertion average length | 1.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 263129 % of reads mapped to multiple loci | 2.04% Number of reads mapped to too many loci | 64166 % of reads mapped to too many loci | 0.50% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.29% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 231722 231722 231722 N_multimapping 263129 263129 263129 N_noFeature 603542 6476508 6454497 N_ambiguous 134498 22255 22465 UnstrandedReadsAssigned:11679417 PositiveStrandReadsAssigned:5918694 NegativeStrandReadsAssigned:5940495 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207940 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207940-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,912,308 reads, 11,975,003 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,047 rounds 52401 SRR3207940.ke.tsv 34699 SRR3207940.se.tsv 87100 total ==> SRR3207940.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 418 28.2417 Potri.005G024800.1.v4.1 1035 936 61 8.44974 Potri.004G059700.1.v4.1 961 862 6 0.902471 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 175.272 7.99045 Potri.016G087400.1.v4.1 270 171 424 321.484 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 45.3637 3.51352 Potri.012G127500.1.v4.1 977 878 739 109.129 ==> SRR3207940.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1327 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 235 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 15 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR3207940 completed mapping pipeline successfully