Starting /dee2/code/volunteer_pipeline.sh SRR3207941 current disk space = 3053416095744 free memory = 1159292576 SRR3207941 SRAfilesize 03e5c542411378fc49af6c3e410e0e70 SRR3207941.sra SRR3207941.sra file validated SRR3207941 is single end SRR3207941 is conventional basespace SRR3207941 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207941_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1685 34.0 33.0 34.0 31.0 34.0 2 33.293 34.0 34.0 34.0 31.0 34.0 3 33.34 34.0 34.0 34.0 31.0 34.0 4 36.58675 37.0 37.0 37.0 35.0 37.0 5 36.522 37.0 37.0 37.0 35.0 37.0 6 36.45575 37.0 37.0 37.0 35.0 37.0 7 36.449 37.0 37.0 37.0 35.0 37.0 8 36.462 37.0 37.0 37.0 35.0 37.0 9 38.363 39.0 39.0 39.0 37.0 39.0 10-11 38.335875 39.0 39.0 39.0 37.0 39.0 12-13 38.02725 39.0 39.0 39.0 36.0 39.0 14-15 39.961625 41.0 40.0 41.0 38.0 41.0 16-17 39.929125 41.0 40.0 41.0 38.0 41.0 18-19 39.811125000000004 41.0 40.0 41.0 38.0 41.0 20-21 39.921375 41.0 40.0 41.0 38.0 41.0 22-23 39.9495 41.0 40.0 41.0 38.0 41.0 24-25 39.906375 41.0 40.0 41.0 38.0 41.0 26-27 39.826875 41.0 40.0 41.0 38.0 41.0 28-29 39.698375 41.0 40.0 41.0 37.5 41.0 30-31 39.61525 41.0 40.0 41.0 37.0 41.0 32-33 39.56 41.0 40.0 41.0 37.0 41.0 34-35 39.463 41.0 40.0 41.0 37.0 41.0 36-37 39.471625 41.0 40.0 41.0 37.0 41.0 38-39 39.291375 41.0 40.0 41.0 36.0 41.0 40-41 39.177625 41.0 39.0 41.0 36.0 41.0 42-43 39.258624999999995 41.0 39.0 41.0 36.0 41.0 44-45 38.95575 41.0 39.0 41.0 35.0 41.0 46-47 39.113125 41.0 39.0 41.0 35.5 41.0 48-49 39.11725 41.0 39.0 41.0 36.0 41.0 50-51 39.23925 41.0 39.0 41.0 36.0 41.0 52-53 39.257374999999996 41.0 39.0 41.0 36.0 41.0 54-55 38.97425 41.0 39.0 41.0 35.0 41.0 56-57 38.8775 41.0 39.0 41.0 35.0 41.0 58-59 38.608625 40.5 38.0 41.0 35.0 41.0 60-61 38.600125000000006 40.0 38.0 41.0 35.0 41.0 62-63 38.267250000000004 40.0 37.0 41.0 34.5 41.0 64-65 37.882000000000005 39.5 36.5 41.0 34.0 41.0 66-67 37.71825 39.0 36.0 41.0 34.0 41.0 68-69 37.22575 39.0 36.0 41.0 34.0 41.0 70-71 36.488625 37.5 35.0 40.0 33.0 41.0 72-73 35.903999999999996 37.0 35.0 39.0 33.0 41.0 74-75 35.5535 36.5 35.0 39.0 32.5 41.0 76-77 34.624375 35.5 34.5 37.0 31.0 39.0 78-79 34.594125 35.5 35.0 37.0 31.5 39.0 80-81 34.49225 35.0 35.0 37.0 32.0 39.0 82-83 34.24575 35.0 35.0 36.0 32.0 37.0 84-85 33.917 35.0 35.0 36.0 32.0 37.0 86-87 33.760374999999996 35.0 35.0 36.0 32.0 37.0 88-89 33.516125 35.0 35.0 35.5 31.5 36.0 90-91 33.205625 35.0 34.5 35.0 31.0 36.0 92-93 32.966125000000005 35.0 34.0 35.0 30.0 36.0 94-95 32.96275 35.0 34.0 35.0 30.5 36.0 96-97 32.970124999999996 35.0 34.0 35.0 31.0 35.5 98-99 32.894875 35.0 34.0 35.0 30.5 35.0 100 32.82875 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 2.0 10 2.0 11 0.0 12 2.0 13 1.0 14 4.0 15 6.0 16 2.0 17 1.0 18 1.0 19 1.0 20 4.0 21 4.0 22 6.0 23 8.0 24 12.0 25 17.0 26 15.0 27 39.0 28 38.0 29 22.0 30 33.0 31 43.0 32 46.0 33 67.0 34 95.0 35 138.0 36 246.0 37 718.0 38 1788.0 39 638.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.525 17.25 16.650000000000002 41.575 2 18.35 25.8 37.925 17.925 3 20.925 27.250000000000004 29.549999999999997 22.275 4 23.65 32.975 19.775000000000002 23.599999999999998 5 24.8062015503876 35.80895223805952 22.355588897224308 17.029257314328582 6 20.325 36.4 25.35 17.925 7 16.6 19.575 43.974999999999994 19.85 8 18.125 24.9 29.549999999999997 27.425 9 21.05 23.549999999999997 31.8 23.599999999999998 10-11 23.5125 33.5875 22.8 20.1 12-13 20.1375 26.7125 29.475 23.674999999999997 14-15 20.6125 28.225 28.9 22.2625 16-17 22.6 26.950000000000003 28.237499999999997 22.2125 18-19 21.4375 28.1125 27.8375 22.6125 20-21 21.1875 28.3875 29.212500000000002 21.212500000000002 22-23 21.2875 30.175 26.700000000000003 21.837500000000002 24-25 20.9375 28.000000000000004 27.950000000000003 23.1125 26-27 21.4 27.825 27.787499999999998 22.9875 28-29 21.6 29.262500000000003 27.987499999999997 21.15 30-31 21.512500000000003 28.4125 28.199999999999996 21.875 32-33 20.849999999999998 29.037499999999998 28.037499999999998 22.075 34-35 21.125 28.462500000000002 28.262500000000003 22.15 36-37 21.05 28.8625 28.212500000000002 21.875 38-39 20.599999999999998 29.8875 28.5625 20.95 40-41 21.275 28.4375 29.375 20.9125 42-43 21.512500000000003 28.462500000000002 28.8375 21.1875 44-45 22.037499999999998 28.287499999999998 28.4 21.275 46-47 21.4 28.7 29.2375 20.6625 48-49 22.5125 28.262500000000003 28.8875 20.3375 50-51 21.7875 27.6125 27.775 22.825 52-53 21.75 28.375 28.675 21.2 54-55 20.9 28.000000000000004 28.962500000000002 22.1375 56-57 21.1375 27.825 28.825 22.2125 58-59 21.3625 28.449999999999996 29.125 21.0625 60-61 20.7625 29.3875 28.449999999999996 21.4 62-63 22.225 28.275 29.099999999999998 20.4 64-65 22.0625 29.425 28.249999999999996 20.2625 66-67 21.775 30.45 27.275 20.5 68-69 21.337500000000002 30.2625 27.900000000000002 20.5 70-71 21.275 30.0875 27.287499999999998 21.349999999999998 72-73 21.1125 29.775000000000002 28.3125 20.8 74-75 22.1375 29.4375 27.3 21.125 76-77 22.95 29.6625 26.6 20.7875 78-79 21.9 30.337500000000002 27.5875 20.175 80-81 21.1875 29.475 28.1625 21.175 82-83 21.8875 29.1625 28.1625 20.7875 84-85 20.7375 29.075 29.575000000000003 20.6125 86-87 21.3125 29.049999999999997 28.287499999999998 21.349999999999998 88-89 21.9625 28.812500000000004 28.425 20.8 90-91 21.837500000000002 29.012500000000003 28.175 20.974999999999998 92-93 21.9 29.4125 26.737499999999997 21.95 94-95 21.9375 28.675 28.275 21.1125 96-97 21.15 28.712500000000002 28.175 21.9625 98-99 21.9 28.175 28.000000000000004 21.925 100 20.849999999999998 29.425 28.275 21.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 1.0 23 2.0 24 3.0 25 2.5 26 3.5 27 6.5 28 12.5 29 22.0 30 26.0 31 28.0 32 40.0 33 53.0 34 70.5 35 91.5 36 111.0 37 135.0 38 161.0 39 197.5 40 226.5 41 248.0 42 269.0 43 283.5 44 264.5 45 256.0 46 263.0 47 224.0 48 199.5 49 170.5 50 137.5 51 120.5 52 96.0 53 77.5 54 54.5 55 36.5 56 26.5 57 20.5 58 13.5 59 8.0 60 5.5 61 7.0 62 7.5 63 3.0 64 2.0 65 2.0 66 2.0 67 1.0 68 0.5 69 1.0 70 0.5 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 1.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84728938661237 98.075 2 0.10180707559175363 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025451768897938407 0.22499999999999998 >10 0.0 0.0 >50 0.025451768897938407 1.5 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGC 60 1.5 TruSeq Adapter, Index 12 (100% over 50bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATG 9 0.22499999999999998 TruSeq Adapter, Index 12 (100% over 49bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.225 0.0 0.0 0.0 0.0 2 0.225 0.0 0.0 0.0 0.0 3 0.225 0.0 0.0 0.0 0.0 4 0.225 0.0 0.0 0.0 0.0 5 0.225 0.0 0.0 0.0 0.0 6 0.225 0.0 0.0 0.0 0.0 7 0.225 0.0 0.0 0.0 0.0 8 0.225 0.0 0.0 0.0 0.0 9 0.225 0.0 0.0 0.0 0.0 10-11 0.225 0.0 0.0 0.0 0.0 12-13 0.225 0.0 0.0 0.0 0.0 14-15 0.225 0.0 0.0 0.0 0.0 16-17 0.225 0.0 0.0 0.0 0.0 18-19 0.225 0.0 0.0 0.0 0.0 20-21 0.225 0.0 0.0 0.0 0.0 22-23 0.225 0.0 0.0 0.0 0.0 24-25 0.225 0.0 0.0 0.0 0.0 26-27 0.225 0.0 0.0 0.0 0.0 28-29 0.225 0.0 0.0 0.0 0.0 30-31 0.225 0.0 0.0 0.0 0.0 32-33 0.225 0.0 0.0 0.0 0.0 34-35 0.225 0.0 0.0 0.0 0.0 36-37 0.225 0.0 0.0 0.0 0.0 38-39 0.225 0.0 0.0 0.0 0.0 40-41 0.225 0.0 0.0 0.0 0.0 42-43 0.225 0.0 0.0 0.0 0.0 44-45 0.225 0.0 0.0 0.0 0.0 46-47 0.225 0.0 0.0 0.0 0.0 48-49 0.225 0.0 0.0 0.0 0.0 50-51 0.225 0.0 0.0 0.0 0.0 52-53 0.225 0.0 0.0 0.0 0.0 54-55 0.225 0.0 0.0 0.0 0.0 56-57 0.225 0.0 0.0 0.0 0.0 58-59 0.25 0.0 0.0 0.0 0.0 60-61 0.275 0.0 0.0 0.0 0.0 62-63 0.3 0.0 0.0 0.0 0.0 64-65 0.3 0.0 0.0 0.0 0.0 66-67 0.3 0.0 0.0 0.0 0.0 68-69 0.32499999999999996 0.0 0.0 0.0 0.0 70-71 0.3625 0.0 0.0 0.0 0.0 72-73 0.4 0.0 0.0 0.0 0.0 74-75 0.4 0.0 0.0 0.0 0.0 76-77 0.4125 0.0 0.0 0.0 0.0 78-79 0.45 0.0 0.0 0.0 0.0 80-81 0.525 0.0 0.0 0.0 0.0 82-83 0.5625 0.0 0.0 0.0 0.0 84-85 0.5874999999999999 0.0 0.0 0.0 0.0 86-87 0.65 0.0 0.0 0.0 0.0 88 0.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 508684 spots for SRR3207941.sra Written 508684 spots for SRR3207941.sra Read 508684 spots for SRR3207941.sra Written 508684 spots for SRR3207941.sra Read 508684 spots for SRR3207941.sra Written 508684 spots for SRR3207941.sra Read 508684 spots for SRR3207941.sra Written 508684 spots for SRR3207941.sra Read 508684 spots for SRR3207941.sra Written 508684 spots for SRR3207941.sra Read 508684 spots for SRR3207941.sra Written 508684 spots for SRR3207941.sra Read 508684 spots for SRR3207941.sra Written 508684 spots for SRR3207941.sra Read 508684 spots for SRR3207941.sra Written 508684 spots for SRR3207941.sra Read 508684 spots for SRR3207941.sra Written 508684 spots for SRR3207941.sra Read 508684 spots for SRR3207941.sra Written 508684 spots for SRR3207941.sra Read 508684 spots for SRR3207941.sra Written 508684 spots for SRR3207941.sra Read 508692 spots for SRR3207941.sra Written 508692 spots for SRR3207941.sra Read 508684 spots for SRR3207941.sra Written 508684 spots for SRR3207941.sra Read 508684 spots for SRR3207941.sra Written 508684 spots for SRR3207941.sra Read 508684 spots for SRR3207941.sra Written 508684 spots for SRR3207941.sra Read 508684 spots for SRR3207941.sra Written 508684 spots for SRR3207941.sra Read 508684 spots for SRR3207941.sra Written 508684 spots for SRR3207941.sra Read 508684 spots for SRR3207941.sra Written 508684 spots for SRR3207941.sra Read 508684 spots for SRR3207941.sra Written 508684 spots for SRR3207941.sra Read 508684 spots for SRR3207941.sra Written 508684 spots for SRR3207941.sra SRR ids: ['SRR3207941.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ha4gzad4 SRR3207941.sra spots: 10173688 blocks: [[1, 508684], [508685, 1017368], [1017369, 1526052], [1526053, 2034736], [2034737, 2543420], [2543421, 3052104], [3052105, 3560788], [3560789, 4069472], [4069473, 4578156], [4578157, 5086840], [5086841, 5595524], [5595525, 6104208], [6104209, 6612892], [6612893, 7121576], [7121577, 7630260], [7630261, 8138944], [8138945, 8647628], [8647629, 9156312], [9156313, 9664996], [9664997, 10173688]] SRR3207941 file size 2636794 SRR3207941 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207941 SRR3207941_1.fastq Input file: SRR3207941_1.fastq trimmed: SRR3207941-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 18:29:35 2025 >> started Tue Feb 11 18:29:43 2025 >> done (8.047s) 10173688 reads processed; of these: 780 ( 0.01%) short reads filtered out after trimming by size control 194684 ( 1.91%) empty reads filtered out after trimming by size control 9978224 (98.08%) reads available; of these: 373000 ( 3.74%) trimmed reads available after processing 9605224 (96.26%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 106 0.00% 19 137 0.00% 20 226 0.00% 21 239 0.00% 22 369 0.00% 23 573 0.01% 24 731 0.01% 25 967 0.01% 26 1008 0.01% 27 980 0.01% 28 1016 0.01% 29 1066 0.01% 30 1121 0.01% 31 1066 0.01% 32 1086 0.01% 33 1154 0.01% 34 1195 0.01% 35 1216 0.01% 36 1276 0.01% 37 1347 0.01% 38 1416 0.01% 39 1432 0.01% 40 1475 0.01% 41 1566 0.02% 42 1575 0.02% 43 1689 0.02% 44 1705 0.02% 45 1833 0.02% 46 1952 0.02% 47 1920 0.02% 48 1956 0.02% 49 2043 0.02% 50 2011 0.02% 51 2178 0.02% 52 2323 0.02% 53 2333 0.02% 54 2385 0.02% 55 2586 0.03% 56 2653 0.03% 57 2653 0.03% 58 2882 0.03% 59 2940 0.03% 60 3065 0.03% 61 3094 0.03% 62 3183 0.03% 63 3391 0.03% 64 3280 0.03% 65 3567 0.04% 66 3832 0.04% 67 3985 0.04% 68 4731 0.05% 69 5248 0.05% 70 4698 0.05% 71 4098 0.04% 72 3958 0.04% 73 4002 0.04% 74 4191 0.04% 75 4129 0.04% 76 3053 0.03% 77 3335 0.03% 78 3632 0.04% 79 4062 0.04% 80 4343 0.04% 81 4645 0.05% 82 4961 0.05% 83 5360 0.05% 84 5734 0.06% 85 5876 0.06% 86 6312 0.06% 87 6806 0.07% 88 7287 0.07% 89 8122 0.08% 90 8895 0.09% 91 9919 0.10% 92 11306 0.11% 93 12619 0.13% 94 14860 0.15% 95 17483 0.18% 96 20487 0.21% 97 23976 0.24% 98 26938 0.27% 99 28152 0.28% 100 9605224 96.26% 9978224 reads passed initial QC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=55.39 fanout-score-rank=15 prefix-density=0.60 prefix-fanout=39.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTGAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=15 fanout-score=307.23 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=26.1 sequence=CTTCTTCTTTTT Started job on | Feb 11 18:30:05 Started mapping on | Feb 11 18:30:05 Finished on | Feb 11 18:30:20 Mapping speed, Million of reads per hour | 2394.77 Number of input reads | 9978224 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 9385048 Uniquely mapped reads % | 94.06% Average mapped length | 98.97 Number of splices: Total | 2684308 Number of splices: Annotated (sjdb) | 2625702 Number of splices: GT/AG | 2640714 Number of splices: GC/AG | 35893 Number of splices: AT/AC | 2730 Number of splices: Non-canonical | 4971 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.02% Deletion average length | 2.05 Insertion rate per base | 0.02% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 228141 % of reads mapped to multiple loci | 2.29% Number of reads mapped to too many loci | 173614 % of reads mapped to too many loci | 1.74% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.91% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 365035 365035 365035 N_multimapping 228141 228141 228141 N_noFeature 537507 4806809 5056813 N_ambiguous 95152 18647 17732 UnstrandedReadsAssigned:8752389 PositiveStrandReadsAssigned:4559592 NegativeStrandReadsAssigned:4310503 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207941 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207941-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,978,224 reads, 9,070,084 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,281 rounds 52401 SRR3207941.ke.tsv 34699 SRR3207941.se.tsv 87100 total ==> SRR3207941.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 348.469 29.5448 Potri.005G024800.1.v4.1 1035 936 163 28.3337 Potri.004G059700.1.v4.1 961 862 9 1.69874 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 170.407 9.74878 Potri.016G087400.1.v4.1 270 171 338 321.597 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 59.1543 5.74941 Potri.012G127500.1.v4.1 977 878 1443 267.401 ==> SRR3207941.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1036 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 192 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR3207941 completed mapping pipeline successfully