Starting /dee2/code/volunteer_pipeline.sh SRR3207942 current disk space = 3053462892544 free memory = 1413153532 SRR3207942 SRAfilesize 1aa4d7232628e0daa13bc9875c6b93c4 SRR3207942.sra SRR3207942.sra file validated SRR3207942 is single end SRR3207942 is conventional basespace SRR3207942 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207942_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.124 34.0 33.0 34.0 31.0 34.0 2 33.2615 34.0 34.0 34.0 31.0 34.0 3 33.34075 34.0 34.0 34.0 31.0 34.0 4 36.593 37.0 37.0 37.0 35.0 37.0 5 36.508 37.0 37.0 37.0 35.0 37.0 6 36.454 37.0 37.0 37.0 35.0 37.0 7 36.4925 37.0 37.0 37.0 35.0 37.0 8 36.47975 37.0 37.0 37.0 35.0 37.0 9 38.3475 39.0 39.0 39.0 37.0 39.0 10-11 38.336625 39.0 39.0 39.0 37.0 39.0 12-13 38.019000000000005 39.0 39.0 39.0 36.0 39.0 14-15 39.956875 41.0 40.0 41.0 38.0 41.0 16-17 39.980875 41.0 40.0 41.0 38.0 41.0 18-19 39.8305 41.0 40.0 41.0 38.0 41.0 20-21 39.935249999999996 41.0 40.0 41.0 38.0 41.0 22-23 39.94475 41.0 40.0 41.0 38.0 41.0 24-25 39.87175 41.0 40.0 41.0 38.0 41.0 26-27 39.838125000000005 41.0 40.0 41.0 38.0 41.0 28-29 39.717625 41.0 40.0 41.0 38.0 41.0 30-31 39.620625000000004 41.0 40.0 41.0 37.5 41.0 32-33 39.595375000000004 41.0 40.0 41.0 37.0 41.0 34-35 39.5115 41.0 40.0 41.0 37.0 41.0 36-37 39.4435 41.0 40.0 41.0 37.0 41.0 38-39 39.35775 41.0 40.0 41.0 37.0 41.0 40-41 39.2035 41.0 39.0 41.0 35.5 41.0 42-43 39.292 41.0 39.5 41.0 36.0 41.0 44-45 38.935249999999996 41.0 39.0 41.0 35.5 41.0 46-47 39.07625 41.0 39.0 41.0 35.5 41.0 48-49 39.01925 41.0 39.0 41.0 35.0 41.0 50-51 39.183 41.0 39.0 41.0 36.0 41.0 52-53 39.243625 41.0 39.0 41.0 35.5 41.0 54-55 38.95125 41.0 39.0 41.0 35.0 41.0 56-57 38.97125 41.0 39.0 41.0 35.0 41.0 58-59 38.630375 40.5 38.0 41.0 35.0 41.0 60-61 38.586749999999995 40.0 37.5 41.0 35.0 41.0 62-63 38.1625 40.0 37.0 41.0 34.0 41.0 64-65 37.848749999999995 39.5 36.5 41.0 34.0 41.0 66-67 37.57475 39.0 36.0 41.0 34.0 41.0 68-69 37.221625 39.0 35.5 41.0 34.0 41.0 70-71 36.870374999999996 37.5 35.0 40.0 34.0 41.0 72-73 36.114875 37.0 35.0 39.0 33.0 41.0 74-75 35.709625 36.5 35.0 39.0 33.0 40.5 76-77 34.76775 36.0 34.5 37.0 31.5 39.0 78-79 34.838 36.0 35.0 37.0 32.0 39.0 80-81 34.5685 35.0 35.0 37.0 32.0 39.0 82-83 34.222125000000005 35.0 35.0 36.0 32.0 37.0 84-85 33.917 35.0 35.0 36.0 32.0 37.0 86-87 33.720875 35.0 35.0 36.0 32.0 36.5 88-89 33.52525 35.0 35.0 35.0 31.0 36.0 90-91 33.248125 35.0 34.5 35.0 31.0 36.0 92-93 32.981375 35.0 34.0 35.0 30.5 36.0 94-95 33.08925 35.0 34.0 35.0 31.0 36.0 96-97 32.926874999999995 35.0 34.0 35.0 31.0 35.0 98-99 32.802 35.0 34.0 35.0 31.0 35.0 100 32.615 35.0 34.0 35.0 30.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 4.0 13 2.0 14 2.0 15 2.0 16 2.0 17 4.0 18 3.0 19 2.0 20 3.0 21 5.0 22 8.0 23 8.0 24 10.0 25 11.0 26 10.0 27 23.0 28 41.0 29 31.0 30 29.0 31 43.0 32 48.0 33 87.0 34 90.0 35 137.0 36 262.0 37 727.0 38 1808.0 39 595.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.3 15.625 16.075 42.0 2 18.2 24.275 39.0 18.525 3 19.775000000000002 27.575 28.825 23.825 4 23.474999999999998 32.5 21.15 22.875 5 24.056014003500874 34.883720930232556 24.031007751937985 17.029257314328582 6 19.675 36.6 24.85 18.875 7 16.375 19.375 43.625 20.625 8 18.725 24.0 29.625 27.650000000000002 9 20.625 23.375 30.875000000000004 25.124999999999996 10-11 22.4375 33.4375 23.1875 20.9375 12-13 20.525 26.5625 29.8375 23.075000000000003 14-15 20.7125 27.9125 28.749999999999996 22.625 16-17 22.025 28.025 27.950000000000003 22.0 18-19 20.525 28.025 28.4125 23.0375 20-21 23.3125 27.525 28.1375 21.025 22-23 21.4 29.775000000000002 27.1125 21.712500000000002 24-25 20.4625 29.125 28.050000000000004 22.3625 26-27 20.6375 28.3875 27.537499999999998 23.4375 28-29 22.15134459036898 28.15509693558474 27.592245153220762 22.101313320825515 30-31 20.55291468601451 28.246184638478862 28.15861896422317 23.042281711283465 32-33 21.65 28.599999999999998 27.725 22.025 34-35 22.1 29.25 26.75 21.9 36-37 21.975 27.900000000000002 27.525 22.6 38-39 21.837500000000002 27.9125 27.737499999999997 22.5125 40-41 22.2125 28.9375 27.0875 21.762500000000003 42-43 20.837500000000002 29.9625 27.3625 21.837500000000002 44-45 22.1875 26.724999999999998 29.075 22.0125 46-47 22.3125 27.925 28.3375 21.425 48-49 21.15 28.050000000000004 28.512500000000003 22.287499999999998 50-51 21.75 28.225 28.199999999999996 21.825 52-53 22.2125 28.199999999999996 26.8625 22.725 54-55 22.2 27.8375 28.775000000000002 21.1875 56-57 21.2375 28.599999999999998 27.450000000000003 22.7125 58-59 21.725 28.875 28.625 20.775 60-61 22.175 27.925 27.650000000000002 22.25 62-63 22.1875 27.987499999999997 28.725 21.099999999999998 64-65 21.9 28.487499999999997 28.050000000000004 21.5625 66-67 22.025 28.787499999999998 28.050000000000004 21.1375 68-69 22.0625 28.675 27.675 21.587500000000002 70-71 21.9625 28.812500000000004 27.0125 22.2125 72-73 21.712500000000002 28.9 28.4125 20.974999999999998 74-75 21.1625 28.475 28.275 22.0875 76-77 21.1625 29.3875 27.737499999999997 21.712500000000002 78-79 21.325 29.325000000000003 27.8875 21.462500000000002 80-81 22.025 28.375 27.5875 22.0125 82-83 22.3375 28.9 27.775 20.9875 84-85 21.925 29.312500000000004 26.974999999999998 21.7875 86-87 21.8 28.499999999999996 27.537499999999998 22.162499999999998 88-89 22.0875 28.475 28.037499999999998 21.4 90-91 22.4375 28.787499999999998 26.875 21.9 92-93 22.375 28.462500000000002 28.237499999999997 20.925 94-95 22.0875 29.1625 27.175 21.575 96-97 21.55 27.8375 28.3625 22.25 98-99 21.337500000000002 28.4125 28.050000000000004 22.2 100 21.55 27.85 28.825 21.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.5 19 0.5 20 0.5 21 1.0 22 0.5 23 1.0 24 2.5 25 3.5 26 5.0 27 8.0 28 9.5 29 14.0 30 17.0 31 25.0 32 32.5 33 37.5 34 60.0 35 76.0 36 89.5 37 122.0 38 150.0 39 178.5 40 223.5 41 246.5 42 256.0 43 268.5 44 267.5 45 258.0 46 261.5 47 263.5 48 215.5 49 173.5 50 157.5 51 128.0 52 106.0 53 81.0 54 62.0 55 52.5 56 35.0 57 20.5 58 13.0 59 14.0 60 12.5 61 9.5 62 6.0 63 2.5 64 2.5 65 3.0 66 2.5 67 3.0 68 3.0 69 1.0 70 1.5 71 3.5 72 2.5 73 1.0 74 1.5 75 1.5 76 1.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0625 30-31 0.075 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77203647416414 98.475 2 0.12664640324214793 0.25 3 0.050658561296859174 0.15 4 0.0 0.0 5 0.0 0.0 6 0.025329280648429587 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025329280648429587 0.975 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTAT 39 0.975 TruSeq Adapter, Index 13 (97% over 40bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTA 6 0.15 TruSeq Adapter, Index 13 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.15 0.0 0.0 0.0 0.0 2 0.15 0.0 0.0 0.0 0.0 3 0.15 0.0 0.0 0.0 0.0 4 0.15 0.0 0.0 0.0 0.0 5 0.15 0.0 0.0 0.0 0.0 6 0.15 0.0 0.0 0.0 0.0 7 0.15 0.0 0.0 0.0 0.0 8 0.15 0.0 0.0 0.0 0.0 9 0.15 0.0 0.0 0.0 0.0 10-11 0.15 0.0 0.0 0.0 0.0 12-13 0.15 0.0 0.0 0.0 0.0 14-15 0.15 0.0 0.0 0.0 0.0 16-17 0.15 0.0 0.0 0.0 0.0 18-19 0.15 0.0 0.0 0.0 0.0 20-21 0.15 0.0 0.0 0.0 0.0 22-23 0.15 0.0 0.0 0.0 0.0 24-25 0.15 0.0 0.0 0.0 0.0 26-27 0.15 0.0 0.0 0.0 0.0 28-29 0.15 0.0 0.0 0.0 0.0 30-31 0.15 0.0 0.0 0.0 0.0 32-33 0.15 0.0 0.0 0.0 0.0 34-35 0.15 0.0 0.0 0.0 0.0 36-37 0.15 0.0 0.0 0.0 0.0 38-39 0.15 0.0 0.0 0.0 0.0 40-41 0.15 0.0 0.0 0.0 0.0 42-43 0.16249999999999998 0.0 0.0 0.0 0.0 44-45 0.175 0.0 0.0 0.0 0.0 46-47 0.175 0.0 0.0 0.0 0.0 48-49 0.175 0.0 0.0 0.0 0.0 50-51 0.175 0.0 0.0 0.0 0.0 52-53 0.175 0.0 0.0 0.0 0.0 54-55 0.175 0.0 0.0 0.0 0.0 56-57 0.175 0.0 0.0 0.0 0.0 58-59 0.175 0.0 0.0 0.0 0.0 60-61 0.175 0.0 0.0 0.0 0.0 62-63 0.1875 0.0 0.0 0.0 0.0 64-65 0.2 0.0 0.0 0.0 0.0 66-67 0.2 0.0 0.0 0.0 0.0 68-69 0.2 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88 0.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 556307 spots for SRR3207942.sra Written 556307 spots for SRR3207942.sra Read 556307 spots for SRR3207942.sra Written 556307 spots for SRR3207942.sra Read 556307 spots for SRR3207942.sra Written 556307 spots for SRR3207942.sra Read 556307 spots for SRR3207942.sra Written 556307 spots for SRR3207942.sra Read 556307 spots for SRR3207942.sra Written 556307 spots for SRR3207942.sra Read 556307 spots for SRR3207942.sra Written 556307 spots for SRR3207942.sra Read 556307 spots for SRR3207942.sra Written 556307 spots for SRR3207942.sra Read 556307 spots for SRR3207942.sra Written 556307 spots for SRR3207942.sra Read 556307 spots for SRR3207942.sra Written 556307 spots for SRR3207942.sra Read 556307 spots for SRR3207942.sra Written 556307 spots for SRR3207942.sra Read 556307 spots for SRR3207942.sra Written 556307 spots for SRR3207942.sra Read 556307 spots for SRR3207942.sra Written 556307 spots for SRR3207942.sra Read 556307 spots for SRR3207942.sra Written 556307 spots for SRR3207942.sra Read 556307 spots for SRR3207942.sra Written 556307 spots for SRR3207942.sra Read 556307 spots for SRR3207942.sra Written 556307 spots for SRR3207942.sra Read 556307 spots for SRR3207942.sra Written 556307 spots for SRR3207942.sra Read 556307 spots for SRR3207942.sra Written 556307 spots for SRR3207942.sra Read 556307 spots for SRR3207942.sra Written 556307 spots for SRR3207942.sra Read 556326 spots for SRR3207942.sra Written 556326 spots for SRR3207942.sra Read 556307 spots for SRR3207942.sra Written 556307 spots for SRR3207942.sra SRR ids: ['SRR3207942.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1v4j0xu2 SRR3207942.sra spots: 11126159 blocks: [[1, 556307], [556308, 1112614], [1112615, 1668921], [1668922, 2225228], [2225229, 2781535], [2781536, 3337842], [3337843, 3894149], [3894150, 4450456], [4450457, 5006763], [5006764, 5563070], [5563071, 6119377], [6119378, 6675684], [6675685, 7231991], [7231992, 7788298], [7788299, 8344605], [8344606, 8900912], [8900913, 9457219], [9457220, 10013526], [10013527, 10569833], [10569834, 11126159]] SRR3207942 file size 2884664 SRR3207942 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207942 SRR3207942_1.fastq Input file: SRR3207942_1.fastq trimmed: SRR3207942-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 18:24:17 2025 >> started Tue Feb 11 18:24:23 2025 >> done (6.323s) 11126159 reads processed; of these: 1573 ( 0.01%) short reads filtered out after trimming by size control 161825 ( 1.45%) empty reads filtered out after trimming by size control 10962761 (98.53%) reads available; of these: 461656 ( 4.21%) trimmed reads available after processing 10501105 (95.79%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 245 0.00% 19 354 0.00% 20 625 0.01% 21 478 0.00% 22 541 0.00% 23 729 0.01% 24 978 0.01% 25 1226 0.01% 26 1322 0.01% 27 1313 0.01% 28 1365 0.01% 29 1383 0.01% 30 1385 0.01% 31 1465 0.01% 32 1762 0.02% 33 1569 0.01% 34 1550 0.01% 35 1646 0.02% 36 1861 0.02% 37 1892 0.02% 38 2108 0.02% 39 1957 0.02% 40 2040 0.02% 41 2175 0.02% 42 2427 0.02% 43 2237 0.02% 44 2377 0.02% 45 2290 0.02% 46 2321 0.02% 47 2487 0.02% 48 2713 0.02% 49 2642 0.02% 50 3107 0.03% 51 2759 0.03% 52 2999 0.03% 53 3073 0.03% 54 3627 0.03% 55 3361 0.03% 56 3978 0.04% 57 3622 0.03% 58 4486 0.04% 59 4345 0.04% 60 4691 0.04% 61 4057 0.04% 62 4560 0.04% 63 4521 0.04% 64 4889 0.04% 65 5053 0.05% 66 4425 0.04% 67 4469 0.04% 68 4528 0.04% 69 4490 0.04% 70 5302 0.05% 71 6527 0.06% 72 5578 0.05% 73 5223 0.05% 74 5279 0.05% 75 5201 0.05% 76 3534 0.03% 77 4086 0.04% 78 4490 0.04% 79 4872 0.04% 80 5327 0.05% 81 5568 0.05% 82 6041 0.06% 83 6555 0.06% 84 7047 0.06% 85 7141 0.07% 86 7669 0.07% 87 8030 0.07% 88 8716 0.08% 89 9810 0.09% 90 10659 0.10% 91 11660 0.11% 92 13433 0.12% 93 15180 0.14% 94 17508 0.16% 95 20304 0.19% 96 24518 0.22% 97 28952 0.26% 98 31715 0.29% 99 33228 0.30% 100 10501105 95.79% 10962761 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=31.22 fanout-score-rank=8 prefix-density=0.26 prefix-fanout=27.2 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTATGCCGTCTTCTGCTTGAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=9 fanout-score=339.53 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=31.2 sequence=TTCTTCTTCTTT Started job on | Feb 11 18:24:40 Started mapping on | Feb 11 18:24:40 Finished on | Feb 11 18:24:55 Mapping speed, Million of reads per hour | 2631.06 Number of input reads | 10962761 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 10206635 Uniquely mapped reads % | 93.10% Average mapped length | 98.98 Number of splices: Total | 2975368 Number of splices: Annotated (sjdb) | 2914146 Number of splices: GT/AG | 2927949 Number of splices: GC/AG | 38988 Number of splices: AT/AC | 3283 Number of splices: Non-canonical | 5148 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 2.03 Insertion rate per base | 0.02% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 253338 % of reads mapped to multiple loci | 2.31% Number of reads mapped to too many loci | 275202 % of reads mapped to too many loci | 2.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.06% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 502788 502788 502788 N_multimapping 253338 253338 253338 N_noFeature 549247 5300738 5389113 N_ambiguous 104801 19565 19345 UnstrandedReadsAssigned:9552587 PositiveStrandReadsAssigned:4886332 NegativeStrandReadsAssigned:4798177 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207942 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207942-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,962,761 reads, 9,993,519 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,160 rounds 52401 SRR3207942.ke.tsv 34699 SRR3207942.se.tsv 87100 total ==> SRR3207942.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 382 29.4475 Potri.005G024800.1.v4.1 1035 936 82 12.9598 Potri.004G059700.1.v4.1 961 862 9 1.54453 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 192.205 9.99759 Potri.016G087400.1.v4.1 270 171 380 328.736 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 33 2.91621 Potri.012G127500.1.v4.1 977 878 1321 222.571 ==> SRR3207942.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1029 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 145 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 10 SRR3207942 completed mapping pipeline successfully