Starting /dee2/code/volunteer_pipeline.sh SRR3207944 current disk space = 3053343010816 free memory = 1572886644 SRR3207944 SRAfilesize a27c5ac92c6bf469d0445d23ed2428ec SRR3207944.sra SRR3207944.sra file validated SRR3207944 is single end SRR3207944 is conventional basespace SRR3207944 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207944_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.16025 34.0 33.0 34.0 31.0 34.0 2 33.31675 34.0 34.0 34.0 31.0 34.0 3 33.38075 34.0 34.0 34.0 31.0 34.0 4 36.603 37.0 37.0 37.0 35.0 37.0 5 36.51075 37.0 37.0 37.0 35.0 37.0 6 36.53225 37.0 37.0 37.0 35.0 37.0 7 36.5245 37.0 37.0 37.0 35.0 37.0 8 36.54175 37.0 37.0 37.0 35.0 37.0 9 38.44425 39.0 39.0 39.0 37.0 39.0 10-11 38.41825 39.0 39.0 39.0 37.0 39.0 12-13 38.362125000000006 39.0 39.0 39.0 37.0 39.0 14-15 40.04625 41.0 40.0 41.0 38.0 41.0 16-17 39.915499999999994 41.0 40.0 41.0 38.0 41.0 18-19 39.9365 41.0 40.0 41.0 38.0 41.0 20-21 39.957750000000004 41.0 40.0 41.0 38.0 41.0 22-23 39.882625000000004 41.0 40.0 41.0 38.0 41.0 24-25 39.8605 41.0 40.0 41.0 38.0 41.0 26-27 39.730000000000004 41.0 40.0 41.0 37.5 41.0 28-29 39.585375 41.0 40.0 41.0 37.0 41.0 30-31 39.611999999999995 41.0 40.0 41.0 37.0 41.0 32-33 39.308499999999995 41.0 39.5 41.0 36.5 41.0 34-35 39.345125 41.0 39.0 41.0 36.5 41.0 36-37 39.424375 41.0 40.0 41.0 37.0 41.0 38-39 39.375125 41.0 39.0 41.0 37.0 41.0 40-41 39.209625 41.0 39.0 41.0 36.0 41.0 42-43 39.248125 40.5 39.0 41.0 36.0 41.0 44-45 39.2515 41.0 39.0 41.0 36.0 41.0 46-47 39.041375 41.0 39.0 41.0 35.5 41.0 48-49 39.079375 41.0 39.0 41.0 35.5 41.0 50-51 39.235 41.0 39.0 41.0 36.0 41.0 52-53 39.2805 41.0 39.0 41.0 36.0 41.0 54-55 39.104124999999996 41.0 39.0 41.0 35.0 41.0 56-57 39.038875 41.0 39.0 41.0 35.0 41.0 58-59 38.809375 41.0 39.0 41.0 35.0 41.0 60-61 38.472875 40.0 38.0 41.0 35.0 41.0 62-63 38.32825 40.0 37.0 41.0 35.0 41.0 64-65 38.107625 39.5 37.0 41.0 35.0 41.0 66-67 37.757625000000004 39.0 36.5 41.0 34.0 41.0 68-69 37.307249999999996 39.0 36.0 40.5 34.0 41.0 70-71 36.878 37.5 35.0 40.0 34.0 41.0 72-73 36.457750000000004 37.0 35.0 39.0 33.5 41.0 74-75 35.9925 36.5 35.0 39.0 33.0 41.0 76-77 35.091875 36.0 34.5 37.0 31.5 39.0 78-79 35.130250000000004 36.0 35.0 37.0 32.5 39.0 80-81 34.87375 35.0 35.0 37.0 33.0 39.0 82-83 34.552499999999995 35.0 35.0 36.0 33.0 37.0 84-85 34.31125 35.0 35.0 36.0 32.5 37.0 86-87 34.074625 35.0 35.0 36.0 32.0 37.0 88-89 33.948 35.0 35.0 35.0 32.0 36.0 90-91 33.76475 35.0 35.0 35.0 32.0 36.0 92-93 33.528999999999996 35.0 34.0 35.0 31.5 36.0 94-95 33.393625 35.0 34.0 35.0 31.5 36.0 96-97 33.264625 35.0 34.0 35.0 31.0 35.5 98-99 33.032250000000005 35.0 34.0 35.0 30.5 35.0 100 32.80375 35.0 34.0 35.0 30.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 2.0 14 3.0 15 3.0 16 1.0 17 3.0 18 5.0 19 5.0 20 6.0 21 3.0 22 2.0 23 10.0 24 6.0 25 9.0 26 9.0 27 17.0 28 17.0 29 31.0 30 28.0 31 35.0 32 62.0 33 53.0 34 82.0 35 151.0 36 267.0 37 756.0 38 1818.0 39 612.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.974999999999998 15.675 14.899999999999999 43.45 2 21.275 23.549999999999997 36.05 19.125 3 21.075 27.05 28.225 23.65 4 23.075000000000003 33.35 20.825 22.75 5 24.006001500375092 33.908477119279816 23.055763940985248 19.02975743935984 6 17.875 36.775000000000006 25.924999999999997 19.425 7 16.55 18.575 43.3 21.575 8 20.225 23.225 31.275 25.275 9 19.25 22.175 32.975 25.6 10-11 21.575 34.4 22.725 21.3 12-13 21.337500000000002 26.7125 29.762499999999996 22.1875 14-15 21.0 27.962500000000002 29.049999999999997 21.987499999999997 16-17 22.1875 28.0875 27.1625 22.5625 18-19 21.9375 28.499999999999996 26.9125 22.650000000000002 20-21 22.3 26.6 28.575 22.525000000000002 22-23 22.0875 28.375 27.725 21.8125 24-25 21.734234234234233 29.291791791791795 27.102102102102105 21.871871871871875 26-27 21.462500000000002 28.762500000000003 28.000000000000004 21.775 28-29 22.13319979969955 28.14221331997997 27.32849273910866 22.396094141211815 30-31 22.048328533867533 27.83272818329786 28.6465506447978 21.472392638036812 32-33 21.712500000000002 28.9 27.487499999999997 21.9 34-35 21.725 28.425 27.6625 22.1875 36-37 22.6125 27.575 27.287499999999998 22.525000000000002 38-39 21.6 28.212500000000002 28.0625 22.125 40-41 22.037499999999998 28.0625 27.8375 22.0625 42-43 21.4375 29.1125 27.0875 22.3625 44-45 21.5625 27.8875 28.287499999999998 22.2625 46-47 21.55 27.737499999999997 28.249999999999996 22.4625 48-49 22.25 27.437499999999996 28.499999999999996 21.8125 50-51 21.675 28.4 27.474999999999998 22.45 52-53 22.075 28.3625 27.712500000000002 21.85 54-55 21.512500000000003 28.449999999999996 28.1625 21.875 56-57 21.125 27.775 28.3125 22.787499999999998 58-59 22.175 28.1375 27.5125 22.175 60-61 22.0875 27.6 28.15 22.162499999999998 62-63 22.225 27.0625 28.537499999999998 22.175 64-65 21.762500000000003 27.925 29.025000000000002 21.2875 66-67 22.3375 27.425 27.9125 22.325 68-69 21.2 28.15 28.225 22.425 70-71 21.4875 28.050000000000004 28.1125 22.35 72-73 21.125 28.000000000000004 28.175 22.7 74-75 21.9375 28.075 27.762500000000003 22.225 76-77 21.65 28.125 27.5875 22.6375 78-79 21.512500000000003 27.6625 28.749999999999996 22.075 80-81 22.5125 28.1125 27.425 21.95 82-83 21.775 28.449999999999996 27.987499999999997 21.7875 84-85 22.175 27.800000000000004 27.1 22.925 86-87 22.15 28.7 27.6875 21.462500000000002 88-89 21.925 27.625 28.475 21.975 90-91 22.35 27.6125 27.8125 22.225 92-93 22.7375 27.5875 27.925 21.75 94-95 21.675 28.5875 26.9625 22.775000000000002 96-97 22.5625 27.187499999999996 28.925 21.325 98-99 22.1875 28.525 27.487499999999997 21.8 100 22.875 28.175 27.400000000000002 21.55 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 0.5 22 0.0 23 1.0 24 2.0 25 1.5 26 4.0 27 7.5 28 8.5 29 10.5 30 16.5 31 25.5 32 35.0 33 45.5 34 59.5 35 78.0 36 93.5 37 111.0 38 130.5 39 166.0 40 194.0 41 227.5 42 256.5 43 249.0 44 252.0 45 258.5 46 264.0 47 241.0 48 219.0 49 207.0 50 174.0 51 150.0 52 118.0 53 93.0 54 72.0 55 50.0 56 36.0 57 24.0 58 23.0 59 21.5 60 14.0 61 9.5 62 8.0 63 5.5 64 6.0 65 6.5 66 5.5 67 4.5 68 4.0 69 2.0 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 1.0 76 1.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.1 26-27 0.0 28-29 0.15 30-31 0.1625 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88 0.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 917051 spots for SRR3207944.sra Written 917051 spots for SRR3207944.sra Read 917051 spots for SRR3207944.sra Written 917051 spots for SRR3207944.sra Read 917051 spots for SRR3207944.sra Written 917051 spots for SRR3207944.sra Read 917051 spots for SRR3207944.sra Written 917051 spots for SRR3207944.sra Read 917051 spots for SRR3207944.sra Written 917051 spots for SRR3207944.sra Read 917051 spots for SRR3207944.sra Written 917051 spots for SRR3207944.sra Read 917051 spots for SRR3207944.sra Written 917051 spots for SRR3207944.sra Read 917051 spots for SRR3207944.sra Written 917051 spots for SRR3207944.sra Read 917051 spots for SRR3207944.sra Written 917051 spots for SRR3207944.sra Read 917051 spots for SRR3207944.sra Written 917051 spots for SRR3207944.sra Read 917051 spots for SRR3207944.sra Written 917051 spots for SRR3207944.sra Read 917051 spots for SRR3207944.sra Written 917051 spots for SRR3207944.sra Read 917051 spots for SRR3207944.sra Written 917051 spots for SRR3207944.sra Read 917051 spots for SRR3207944.sra Written 917051 spots for SRR3207944.sra Read 917051 spots for SRR3207944.sra Written 917051 spots for SRR3207944.sra Read 917051 spots for SRR3207944.sra Written 917051 spots for SRR3207944.sra Read 917051 spots for SRR3207944.sra Written 917051 spots for SRR3207944.sra Read 917068 spots for SRR3207944.sra Written 917068 spots for SRR3207944.sra Read 917051 spots for SRR3207944.sra Written 917051 spots for SRR3207944.sra Read 917051 spots for SRR3207944.sra Written 917051 spots for SRR3207944.sra SRR ids: ['SRR3207944.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dneuv32g SRR3207944.sra spots: 18341037 blocks: [[1, 917051], [917052, 1834102], [1834103, 2751153], [2751154, 3668204], [3668205, 4585255], [4585256, 5502306], [5502307, 6419357], [6419358, 7336408], [7336409, 8253459], [8253460, 9170510], [9170511, 10087561], [10087562, 11004612], [11004613, 11921663], [11921664, 12838714], [12838715, 13755765], [13755766, 14672816], [14672817, 15589867], [15589868, 16506918], [16506919, 17423969], [17423970, 18341037]] SRR3207944 file size 4762335 SRR3207944 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207944 SRR3207944_1.fastq Input file: SRR3207944_1.fastq trimmed: SRR3207944-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 20:00:29 2025 >> started Tue Feb 11 20:00:38 2025 >> done (9.426s) 18341037 reads processed; of these: 2933 ( 0.02%) short reads filtered out after trimming by size control 38240 ( 0.21%) empty reads filtered out after trimming by size control 18299864 (99.78%) reads available; of these: 761685 ( 4.16%) trimmed reads available after processing 17538179 (95.84%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 363 0.00% 19 465 0.00% 20 534 0.00% 21 657 0.00% 22 853 0.00% 23 1200 0.01% 24 1656 0.01% 25 2126 0.01% 26 2584 0.01% 27 2712 0.01% 28 2412 0.01% 29 2353 0.01% 30 2355 0.01% 31 2367 0.01% 32 2449 0.01% 33 2410 0.01% 34 2575 0.01% 35 2673 0.01% 36 2828 0.02% 37 2812 0.02% 38 2905 0.02% 39 3142 0.02% 40 3115 0.02% 41 3276 0.02% 42 3454 0.02% 43 3387 0.02% 44 3510 0.02% 45 3663 0.02% 46 3766 0.02% 47 3906 0.02% 48 4041 0.02% 49 4289 0.02% 50 4003 0.02% 51 4252 0.02% 52 4297 0.02% 53 4578 0.03% 54 4808 0.03% 55 4976 0.03% 56 5148 0.03% 57 5351 0.03% 58 5408 0.03% 59 5325 0.03% 60 5631 0.03% 61 5777 0.03% 62 5927 0.03% 63 6097 0.03% 64 6245 0.03% 65 6652 0.04% 66 6772 0.04% 67 6834 0.04% 68 7024 0.04% 69 6832 0.04% 70 7478 0.04% 71 7885 0.04% 72 8123 0.04% 73 8271 0.05% 74 8659 0.05% 75 8541 0.05% 76 6230 0.03% 77 6818 0.04% 78 8053 0.04% 79 8515 0.05% 80 8939 0.05% 81 9496 0.05% 82 10443 0.06% 83 11308 0.06% 84 11870 0.06% 85 12321 0.07% 86 13185 0.07% 87 14289 0.08% 88 15332 0.08% 89 16603 0.09% 90 18270 0.10% 91 20376 0.11% 92 23022 0.13% 93 25786 0.14% 94 30720 0.17% 95 35466 0.19% 96 42436 0.23% 97 49707 0.27% 98 55787 0.30% 99 64981 0.36% 100 17538179 95.84% 18299864 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=4.91 fanout-score-rank=22 prefix-density=0.03 prefix-fanout=4.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTATGCCGTCTTCTGCTTGAAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=22 fanout-score=290.97 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=28.9 sequence=TTCTTCTTCTTT Started job on | Feb 11 20:00:54 Started mapping on | Feb 11 20:00:55 Finished on | Feb 11 20:01:19 Mapping speed, Million of reads per hour | 2744.98 Number of input reads | 18299864 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 17146859 Uniquely mapped reads % | 93.70% Average mapped length | 99.02 Number of splices: Total | 5052509 Number of splices: Annotated (sjdb) | 4965720 Number of splices: GT/AG | 4978132 Number of splices: GC/AG | 61723 Number of splices: AT/AC | 5119 Number of splices: Non-canonical | 7535 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 2.04 Insertion rate per base | 0.01% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 388739 % of reads mapped to multiple loci | 2.12% Number of reads mapped to too many loci | 60837 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.84% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 764266 764266 764266 N_multimapping 388739 388739 388739 N_noFeature 667803 8816519 8882943 N_ambiguous 170851 27402 28476 UnstrandedReadsAssigned:16308205 PositiveStrandReadsAssigned:8302938 NegativeStrandReadsAssigned:8235440 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207944 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207944-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,299,864 reads, 16,690,532 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,042 rounds 52401 SRR3207944.ke.tsv 34699 SRR3207944.se.tsv 87100 total ==> SRR3207944.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 462 21.2314 Potri.005G024800.1.v4.1 1035 936 53.0058 4.99412 Potri.004G059700.1.v4.1 961 862 16 1.63691 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 324.143 10.0512 Potri.016G087400.1.v4.1 270 171 752 387.823 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 58.4266 3.07799 Potri.012G127500.1.v4.1 977 878 2161 217.056 ==> SRR3207944.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1644 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 267 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 17 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR3207944 completed mapping pipeline successfully